ClinVar Miner

List of variants in gene LDB3 reported by Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 121
Download table as spreadsheet
HGVS dbSNP
NM_001080116.1(LDB3):c.771G>A (p.Thr257=) rs144445130
NM_001080116.1(LDB3):c.775C>G (p.Arg259Gly) rs397516560
NM_001080116.1(LDB3):c.780C>T (p.Asn260=) rs372789789
NM_001080116.1(LDB3):c.802C>T (p.Arg268Cys) rs121908335
NM_007078.3(LDB3):c.*13G>T rs397517207
NM_007078.3(LDB3):c.-15G>A rs201865389
NM_007078.3(LDB3):c.1014A>G (p.Thr338=) rs150209221
NM_007078.3(LDB3):c.1016C>G (p.Ala339Gly) rs764530865
NM_007078.3(LDB3):c.1017T>G (p.Ala339=) rs727504526
NM_007078.3(LDB3):c.1035C>T (p.Ile345=) rs121908336
NM_007078.3(LDB3):c.1036G>A (p.Ala346Thr) rs201968775
NM_007078.3(LDB3):c.1041C>A (p.Ser347=) rs45555240
NM_007078.3(LDB3):c.1041C>T (p.Ser347=) rs45555240
NM_007078.3(LDB3):c.1045T>A (p.Ser349Thr) rs147042608
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) rs138251566
NM_007078.3(LDB3):c.1071T>A (p.Pro357=) rs143823978
NM_007078.3(LDB3):c.1074C>T (p.Ala358=) rs45459491
NM_007078.3(LDB3):c.10A>C (p.Ser4Arg) rs727505295
NM_007078.3(LDB3):c.1111G>A (p.Ala371Thr) rs45539535
NM_007078.3(LDB3):c.1153A>G (p.Ser385Gly) rs777547764
NM_007078.3(LDB3):c.1167C>T (p.Ala389=) rs768844187
NM_007078.3(LDB3):c.1253C>G (p.Pro418Arg) rs141870580
NM_007078.3(LDB3):c.1263G>A (p.Gly421=) rs139834701
NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[1] (p.434_441APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[3] (p.434_441APAYTPSP[3]) rs397517209
NM_007078.3(LDB3):c.1317C>T (p.Pro439=) rs397517208
NM_007078.3(LDB3):c.1335C>T (p.Tyr445=) rs587781024
NM_007078.3(LDB3):c.1339C>G (p.Pro447Ala) rs397517211
NM_007078.3(LDB3):c.139G>A (p.Asp47Asn) rs397517212
NM_007078.3(LDB3):c.1422G>A (p.Ser474=) rs142625982
NM_007078.3(LDB3):c.144C>T (p.Leu48=) rs397517213
NM_007078.3(LDB3):c.1453G>T (p.Ala485Ser) rs397517214
NM_007078.3(LDB3):c.1460G>A (p.Arg487His) rs146265188
NM_007078.3(LDB3):c.1471G>T (p.Val491Leu) rs397517215
NM_007078.3(LDB3):c.1472T>A (p.Val491Glu) rs139709036
NM_007078.3(LDB3):c.1475C>T (p.Thr492Ile) rs397517216
NM_007078.3(LDB3):c.147G>A (p.Val49=) rs45591834
NM_007078.3(LDB3):c.1503C>T (p.Ala501=) rs147692024
NM_007078.3(LDB3):c.1506G>A (p.Pro502=) rs45579241
NM_007078.3(LDB3):c.1535A>C (p.Gln512Pro) rs138951890
NM_007078.3(LDB3):c.1572G>A (p.Ala524=) rs149423035
NM_007078.3(LDB3):c.1586C>G (p.Pro529Arg) rs397517217
NM_007078.3(LDB3):c.1594G>C (p.Ala532Pro) rs143764931
NM_007078.3(LDB3):c.159C>T (p.Asp53=) rs200114285
NM_007078.3(LDB3):c.1605C>T (p.Thr535=) rs727505207
NM_007078.3(LDB3):c.1607T>C (p.Val536Ala) rs727503128
NM_007078.3(LDB3):c.1609del (p.Gln537fs) rs727503129
NM_007078.3(LDB3):c.163G>A (p.Val55Ile) rs3740343
NM_007078.3(LDB3):c.1653C>T (p.Cys551=) rs45581435
NM_007078.3(LDB3):c.1672A>G (p.Ile558Val) rs372331627
NM_007078.3(LDB3):c.1697T>G (p.Met566Arg) rs566463138
NM_007078.3(LDB3):c.1774G>C (p.Glu592Gln) rs727504944
NM_007078.3(LDB3):c.1786G>A (p.Val596Ile) rs727503130
NM_007078.3(LDB3):c.1789T>C (p.Tyr597His) rs727503131
NM_007078.3(LDB3):c.1798C>T (p.Arg600Ter) rs727503132
NM_007078.3(LDB3):c.1799G>A (p.Arg600Gln) rs747523570
NM_007078.3(LDB3):c.1823C>T (p.Pro608Leu) rs145983824
NM_007078.3(LDB3):c.1858-10T>C rs202208256
NM_007078.3(LDB3):c.1903G>A (p.Val635Ile) rs45618633
NM_007078.3(LDB3):c.1907G>A (p.Cys636Tyr) rs397517218
NM_007078.3(LDB3):c.1910C>T (p.Ala637Val) rs141569007
NM_007078.3(LDB3):c.1956C>T (p.Asp652=) rs139213290
NM_007078.3(LDB3):c.1971C>T (p.Cys657=) rs140552419
NM_007078.3(LDB3):c.200A>G (p.Asn67Ser) rs727504500
NM_007078.3(LDB3):c.2016C>T (p.Cys672=) rs45578640
NM_007078.3(LDB3):c.2025C>T (p.Pro675=) rs876657490
NM_007078.3(LDB3):c.2078C>A (p.Thr693Asn) rs397517219
NM_007078.3(LDB3):c.2091C>T (p.Cys697=) rs571356142
NM_007078.3(LDB3):c.2092G>A (p.Ala698Thr) rs45577134
NM_007078.3(LDB3):c.2155A>G (p.Lys719Glu) rs397517220
NM_007078.3(LDB3):c.2164G>A (p.Ala722Thr) rs727505129
NM_007078.3(LDB3):c.236C>G (p.Thr79Ser) rs397517221
NM_007078.3(LDB3):c.273G>A (p.Thr91=) rs45613039
NM_007078.3(LDB3):c.295C>T (p.Pro99Ser) rs201693259
NM_007078.3(LDB3):c.302C>T (p.Pro101Leu) rs45592139
NM_007078.3(LDB3):c.343G>A (p.Gly115Ser) rs397517222
NM_007078.3(LDB3):c.352G>A (p.Val118Met) rs35507268
NM_007078.3(LDB3):c.356C>T (p.Ala119Val) rs397517223
NM_007078.3(LDB3):c.465C>T (p.Leu155=) rs45516997
NM_007078.3(LDB3):c.493C>T (p.Arg165Trp) rs45610637
NM_007078.3(LDB3):c.529dup (p.Ala177fs) rs730880345
NM_007078.3(LDB3):c.530C>A (p.Ala177Asp) rs397517224
NM_007078.3(LDB3):c.530C>T (p.Ala177Val) rs397517224
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) rs45487699
NM_007078.3(LDB3):c.576G>A (p.Pro192=) rs45543741
NM_007078.3(LDB3):c.576G>T (p.Pro192=) rs45543741
NM_007078.3(LDB3):c.600C>T (p.Gly200=) rs397517225
NM_007078.3(LDB3):c.609G>A (p.Ser203=) rs45531131
NM_007078.3(LDB3):c.655C>T (p.Arg219Ter) rs727503123
NM_007078.3(LDB3):c.656G>A (p.Arg219Gln) rs530979771
NM_007078.3(LDB3):c.664G>A (p.Ala222Thr) rs139922045
NM_007078.3(LDB3):c.668C>T (p.Ser223Leu) rs375306400
NM_007078.3(LDB3):c.689+10G>A rs45563234
NM_007078.3(LDB3):c.689+15T>C rs375094467
NM_007078.3(LDB3):c.689+9C>T rs727503124
NM_007078.3(LDB3):c.690-4A>G rs45529531
NM_007078.3(LDB3):c.714C>T (p.Ala238=) rs727503125
NM_007078.3(LDB3):c.732C>T (p.Pro244=) rs144509718
NM_007078.3(LDB3):c.733G>A (p.Val245Ile) rs573061464
NM_007078.3(LDB3):c.752A>G (p.Lys251Arg) rs34423165
NM_007078.3(LDB3):c.789G>A (p.Trp263Ter) rs876657847
NM_007078.3(LDB3):c.793C>T (p.Arg265Cys) rs45521338
NM_007078.3(LDB3):c.826C>T (p.Arg276Cys) rs397517226
NM_007078.3(LDB3):c.845C>T (p.Thr282Met) rs199811186
NM_007078.3(LDB3):c.859+3G>A rs376313045
NM_007078.3(LDB3):c.860-15C>T rs727503126
NM_007078.3(LDB3):c.860-22_860-12del rs727504602
NM_007078.3(LDB3):c.867C>T (p.Asp289=) rs397517227
NM_007078.3(LDB3):c.896+6669TC[11] rs71019410
NM_007078.3(LDB3):c.896+6669TC[12] rs71019410
NM_007078.3(LDB3):c.896+6669TC[13] rs71019410
NM_007078.3(LDB3):c.896+6669TC[15] rs71019410
NM_007078.3(LDB3):c.896+6669TC[16] rs71019410
NM_007078.3(LDB3):c.897-10G>A rs77304928
NM_007078.3(LDB3):c.897-14T>C rs763081924
NM_007078.3(LDB3):c.899C>A (p.Thr300Asn) rs397517228
NM_007078.3(LDB3):c.93+1G>T rs727505066
NM_007078.3(LDB3):c.93+7G>T rs397517229
NM_007078.3(LDB3):c.954C>T (p.Pro318=) rs45603139
NM_007078.3(LDB3):c.991G>A (p.Ala331Thr) rs749520121
NM_007078.3(LDB3):c.993G>A (p.Ala331=) rs140347820

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.