ClinVar Miner

List of variants in gene LDB3 reported by GeneDx

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 190
Download table as spreadsheet
NM_001080116.1(LDB3):c.771G>A (p.Thr257=) rs144445130
NM_001368063.1(LDB3):c.-23-259G>T rs11812601
NM_001368063.1(LDB3):c.-23-268T>C rs2803555
NM_001368063.1(LDB3):c.-23-350A>T rs2675692
NM_001368063.1(LDB3):c.-23-379G>A rs35777670
NM_001368063.1(LDB3):c.-23-390A>G rs34073498
NM_007078.3(LDB3):c.-18G>A rs778777335
NM_007078.3(LDB3):c.-19G>A rs770775053
NM_007078.3(LDB3):c.-23-20T>C rs45453092
NM_007078.3(LDB3):c.-24+18G>A rs1054080127
NM_007078.3(LDB3):c.-24+8T>C rs2803558
NM_007078.3(LDB3):c.-36A>G rs2803557
NM_007078.3(LDB3):c.-48G>A rs2803556
NM_007078.3(LDB3):c.-48G>T rs2803556
NM_007078.3(LDB3):c.-49C>T rs146911972
NM_007078.3(LDB3):c.1035C>T (p.Ile345=) rs121908336
NM_007078.3(LDB3):c.1036G>A (p.Ala346Thr) rs201968775
NM_007078.3(LDB3):c.1041C>T (p.Ser347=) rs45555240
NM_007078.3(LDB3):c.1045T>A (p.Ser349Thr) rs147042608
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) rs138251566
NM_007078.3(LDB3):c.1071T>A (p.Pro357=) rs143823978
NM_007078.3(LDB3):c.1075G>A (p.Asp359Asn) rs557956141
NM_007078.3(LDB3):c.1086-75G>T rs3740347
NM_007078.3(LDB3):c.1105A>G (p.Ser369Gly) rs181700296
NM_007078.3(LDB3):c.1109C>T (p.Pro370Leu) rs794729060
NM_007078.3(LDB3):c.1111G>A (p.Ala371Thr) rs45539535
NM_007078.3(LDB3):c.1129G>A (p.Ala377Thr) rs794729061
NM_007078.3(LDB3):c.1164C>T (p.Pro388=) rs780108812
NM_007078.3(LDB3):c.1166_1167inv (p.Ala389Gly)
NM_007078.3(LDB3):c.1200T>G (p.Thr400=) rs1447980981
NM_007078.3(LDB3):c.1225C>A (p.Gln409Lys) rs139104492
NM_007078.3(LDB3):c.1231+19G>A rs763969244
NM_007078.3(LDB3):c.1231+209G>A rs143431229
NM_007078.3(LDB3):c.1231+240G>A rs10887651
NM_007078.3(LDB3):c.1231+30C>G rs11597201
NM_007078.3(LDB3):c.1232-100G>A rs114915313
NM_007078.3(LDB3):c.1232-278G>A rs12218053
NM_007078.3(LDB3):c.1232-96A>C rs59439194
NM_007078.3(LDB3):c.1232-96A>G rs59439194
NM_007078.3(LDB3):c.1232-97_1232-96insG rs537326671
NM_007078.3(LDB3):c.1256C>A (p.Ser419Tyr) rs368888118
NM_007078.3(LDB3):c.1296C>T (p.Ser432=) rs753546855
NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[1] (p.434_441APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.1335C>T (p.Tyr445=) rs587781024
NM_007078.3(LDB3):c.133C>T (p.Gln45Ter) rs1057524744
NM_007078.3(LDB3):c.1386C>T (p.Thr462=) rs764330273
NM_007078.3(LDB3):c.1437G>C (p.Gly479=) rs960379328
NM_007078.3(LDB3):c.144C>T (p.Leu48=) rs397517213
NM_007078.3(LDB3):c.1460G>A (p.Arg487His) rs146265188
NM_007078.3(LDB3):c.147G>A (p.Val49=) rs45591834
NM_007078.3(LDB3):c.1487T>C (p.Phe496Ser) rs147072071
NM_007078.3(LDB3):c.1502C>T (p.Ala501Val) rs755362259
NM_007078.3(LDB3):c.1521C>T (p.Thr507=) rs200838004
NM_007078.3(LDB3):c.1535A>C (p.Gln512Pro) rs138951890
NM_007078.3(LDB3):c.1546C>T (p.Arg516Trp) rs773327911
NM_007078.3(LDB3):c.1562A>G (p.Tyr521Cys) rs535737552
NM_007078.3(LDB3):c.1567C>G (p.Pro523Ala) rs794729062
NM_007078.3(LDB3):c.1573G>C (p.Gly525Arg) rs794729063
NM_007078.3(LDB3):c.1594G>C (p.Ala532Pro) rs143764931
NM_007078.3(LDB3):c.1606G>A (p.Val536Ile) rs113817827
NM_007078.3(LDB3):c.162C>T (p.Gly54=) rs757856121
NM_007078.3(LDB3):c.1639C>T (p.Arg547Trp) rs374426474
NM_007078.3(LDB3):c.1667A>G (p.Asn556Ser) rs372583830
NM_007078.3(LDB3):c.1668T>C (p.Asn556=) rs916700413
NM_007078.3(LDB3):c.1672A>G (p.Ile558Val) rs372331627
NM_007078.3(LDB3):c.1676+250G>A rs7910307
NM_007078.3(LDB3):c.1676+267C>T rs184741262
NM_007078.3(LDB3):c.1677-197G>A rs7090715
NM_007078.3(LDB3):c.1677-19C>T rs749512075
NM_007078.3(LDB3):c.1728C>T (p.Thr576=) rs749988944
NM_007078.3(LDB3):c.1752G>C (p.Leu584=) rs1589676711
NM_007078.3(LDB3):c.1774G>C (p.Glu592Gln) rs727504944
NM_007078.3(LDB3):c.1789T>C (p.Tyr597His) rs727503131
NM_007078.3(LDB3):c.1799G>A (p.Arg600Gln) rs747523570
NM_007078.3(LDB3):c.1815C>T (p.Phe605=) rs1057522289
NM_007078.3(LDB3):c.1823C>T (p.Pro608Leu) rs145983824
NM_007078.3(LDB3):c.1824G>A (p.Pro608=) rs748428531
NM_007078.3(LDB3):c.184C>T (p.His62Tyr) rs779234633
NM_007078.3(LDB3):c.1857+32_1857+33del rs149127817
NM_007078.3(LDB3):c.1858-10T>C rs202208256
NM_007078.3(LDB3):c.1858-11C>A rs369454227
NM_007078.3(LDB3):c.1858-7C>G rs1057520727
NM_007078.3(LDB3):c.1903G>A (p.Val635Ile) rs45618633
NM_007078.3(LDB3):c.1910C>T (p.Ala637Val) rs141569007
NM_007078.3(LDB3):c.1911G>A (p.Ala637=) rs150710377
NM_007078.3(LDB3):c.1956C>T (p.Asp652=) rs139213290
NM_007078.3(LDB3):c.1971C>T (p.Cys657=) rs140552419
NM_007078.3(LDB3):c.1978+175G>A rs11202138
NM_007078.3(LDB3):c.1978+198A>G rs117918530
NM_007078.3(LDB3):c.1978+284G>T rs12219069
NM_007078.3(LDB3):c.1978+2_1978+5del rs1554864768
NM_007078.3(LDB3):c.1979-174T>G rs7092188
NM_007078.3(LDB3):c.1979-310G>A rs114139889
NM_007078.3(LDB3):c.200A>G (p.Asn67Ser) rs727504500
NM_007078.3(LDB3):c.2017G>A (p.Asp673Asn) rs45514002
NM_007078.3(LDB3):c.2091C>T (p.Cys697=) rs571356142
NM_007078.3(LDB3):c.2092G>A (p.Ala698Thr) rs45577134
NM_007078.3(LDB3):c.2092G>T (p.Ala698Ser) rs45577134
NM_007078.3(LDB3):c.2094+10T>C rs769802374
NM_007078.3(LDB3):c.2094+148G>A rs17106978
NM_007078.3(LDB3):c.2094+162G>A rs112207292
NM_007078.3(LDB3):c.2094+94del rs34647099
NM_007078.3(LDB3):c.2095-235G>C rs7899337
NM_007078.3(LDB3):c.2095-282G>A rs7899324
NM_007078.3(LDB3):c.2095-295C>G rs59412880
NM_007078.3(LDB3):c.2124G>A (p.Pro708=) rs759812655
NM_007078.3(LDB3):c.245+156A>C rs3740344
NM_007078.3(LDB3):c.245+278T>C rs60835566
NM_007078.3(LDB3):c.246-162C>T rs75738068
NM_007078.3(LDB3):c.253C>T (p.Arg85Cys) rs780200228
NM_007078.3(LDB3):c.273G>A (p.Thr91=) rs45613039
NM_007078.3(LDB3):c.287T>C (p.Val96Ala) rs794729056
NM_007078.3(LDB3):c.295C>T (p.Pro99Ser) rs201693259
NM_007078.3(LDB3):c.321+104G>A rs45598635
NM_007078.3(LDB3):c.321+192G>C rs45519132
NM_007078.3(LDB3):c.321+248G>A rs45617137
NM_007078.3(LDB3):c.322-156T>C rs117975031
NM_007078.3(LDB3):c.322-161A>G rs2675686
NM_007078.3(LDB3):c.322-197C>G rs2248643
NM_007078.3(LDB3):c.322-1G>A rs794729059
NM_007078.3(LDB3):c.322-290C>G rs11813013
NM_007078.3(LDB3):c.322-305G>A rs11596380
NM_007078.3(LDB3):c.328G>A (p.Ala110Thr) rs768737496
NM_007078.3(LDB3):c.352G>A (p.Val118Met) rs35507268
NM_007078.3(LDB3):c.356C>T (p.Ala119Val) rs397517223
NM_007078.3(LDB3):c.385A>G (p.Ser129Gly) rs794729057
NM_007078.3(LDB3):c.398C>T (p.Pro133Leu) rs200239096
NM_007078.3(LDB3):c.407C>T (p.Pro136Leu) rs772887402
NM_007078.3(LDB3):c.465C>T (p.Leu155=) rs45516997
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) rs200596619
NM_007078.3(LDB3):c.468C>T (p.Ala156=) rs374233873
NM_007078.3(LDB3):c.493C>T (p.Arg165Trp) rs45610637
NM_007078.3(LDB3):c.529dup (p.Ala177fs) rs730880345
NM_007078.3(LDB3):c.533G>A (p.Arg178Gln) rs143311349
NM_007078.3(LDB3):c.536A>G (p.Asp179Gly) rs794729058
NM_007078.3(LDB3):c.540A>G (p.Leu180=) rs1283051092
NM_007078.3(LDB3):c.54G>T (p.Gln18His) rs149348427
NM_007078.3(LDB3):c.550A>G (p.Lys184Glu) rs774886148
NM_007078.3(LDB3):c.567G>A (p.Ser189=) rs778777214
NM_007078.3(LDB3):c.575C>T (p.Pro192Leu) rs758182278
NM_007078.3(LDB3):c.576G>A (p.Pro192=) rs45543741
NM_007078.3(LDB3):c.646A>T (p.Met216Leu) rs765199175
NM_007078.3(LDB3):c.655C>T (p.Arg219Ter) rs727503123
NM_007078.3(LDB3):c.656G>A (p.Arg219Gln) rs530979771
NM_007078.3(LDB3):c.664G>A (p.Ala222Thr) rs139922045
NM_007078.3(LDB3):c.668C>T (p.Ser223Leu) rs375306400
NM_007078.3(LDB3):c.686G>T (p.Gly229Val) rs1131691665
NM_007078.3(LDB3):c.689+149A>G rs56165849
NM_007078.3(LDB3):c.689+323T>C rs145371401
NM_007078.3(LDB3):c.689+9C>T rs727503124
NM_007078.3(LDB3):c.690-17CT[3] rs544039308
NM_007078.3(LDB3):c.690-228del rs11312118
NM_007078.3(LDB3):c.714C>T (p.Ala238=) rs727503125
NM_007078.3(LDB3):c.715G>A (p.Val239Ile) rs201417512
NM_007078.3(LDB3):c.732C>T (p.Pro244=) rs144509718
NM_007078.3(LDB3):c.752A>G (p.Lys251Arg) rs34423165
NM_007078.3(LDB3):c.793C>T (p.Arg265Cys) rs45521338
NM_007078.3(LDB3):c.794G>A (p.Arg265His) rs45458895
NM_007078.3(LDB3):c.79C>T (p.Leu27Phe) rs1554844343
NM_007078.3(LDB3):c.805A>C (p.Asn269His) rs1367297073
NM_007078.3(LDB3):c.80T>C (p.Leu27Pro) rs1057517864
NM_007078.3(LDB3):c.81C>G (p.Leu27=) rs1554844351
NM_007078.3(LDB3):c.859+14C>G rs748281629
NM_007078.3(LDB3):c.859+47G>C rs3740346
NM_007078.3(LDB3):c.860-15C>T rs727503126
NM_007078.3(LDB3):c.891G>A (p.Arg297=) rs374336814
NM_007078.3(LDB3):c.896+45G>A rs11202128
NM_007078.3(LDB3):c.896+6723G>A rs868365512
NM_007078.3(LDB3):c.896+6731C>T rs372789789
NM_007078.3(LDB3):c.896+6823C>T rs377726575
NM_007078.3(LDB3):c.897-10G>A rs77304928
NM_007078.3(LDB3):c.897-11C>T rs766463668
NM_007078.3(LDB3):c.897-14T>C rs763081924
NM_007078.3(LDB3):c.897-164C>A rs11815273
NM_007078.3(LDB3):c.897-16G>C rs45513100
NM_007078.3(LDB3):c.897-298A>C rs117230487
NM_007078.3(LDB3):c.897-304A>C rs17106956
NM_007078.3(LDB3):c.897-6907A>G rs79068721
NM_007078.3(LDB3):c.900C>A (p.Thr300=) rs760071118
NM_007078.3(LDB3):c.91C>T (p.Arg31Trp) rs367792378
NM_007078.3(LDB3):c.93+10C>A rs1222755412
NM_007078.3(LDB3):c.93+12C>T rs746751581
NM_007078.3(LDB3):c.93+165C>A rs12259201
NM_007078.3(LDB3):c.93+177C>T rs3740342
NM_007078.3(LDB3):c.94-119G>A rs4468255
NM_007078.3(LDB3):c.94-119G>C rs4468255
NM_007078.3(LDB3):c.94-124G>A rs12254069
NM_007078.3(LDB3):c.94-294T>C rs112790021
NM_007078.3(LDB3):c.955G>A (p.Ala319Thr) rs151219713
NM_007078.3(LDB3):c.991G>A (p.Ala331Thr) rs749520121

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.