ClinVar Miner

List of variants in gene LDB3 reported as likely benign by GeneDx

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 77
Download table as spreadsheet
NM_001368063.1(LDB3):c.-23-390A>G rs34073498
NM_007078.3(LDB3):c.-18G>A rs778777335
NM_007078.3(LDB3):c.-19G>A rs770775053
NM_007078.3(LDB3):c.-23-20T>C rs45453092
NM_007078.3(LDB3):c.-24+18G>A rs1054080127
NM_007078.3(LDB3):c.-48G>T rs2803556
NM_007078.3(LDB3):c.1041C>T (p.Ser347=) rs45555240
NM_007078.3(LDB3):c.1045T>A (p.Ser349Thr) rs147042608
NM_007078.3(LDB3):c.1071T>A (p.Pro357=) rs143823978
NM_007078.3(LDB3):c.1105A>G (p.Ser369Gly) rs181700296
NM_007078.3(LDB3):c.1111G>A (p.Ala371Thr) rs45539535
NM_007078.3(LDB3):c.1164C>T (p.Pro388=) rs780108812
NM_007078.3(LDB3):c.1200T>G (p.Thr400=) rs1447980981
NM_007078.3(LDB3):c.1231+209G>A rs143431229
NM_007078.3(LDB3):c.1232-96A>G rs59439194
NM_007078.3(LDB3):c.1232-97_1232-96insG rs537326671
NM_007078.3(LDB3):c.1256C>A (p.Ser419Tyr) rs368888118
NM_007078.3(LDB3):c.1296C>T (p.Ser432=) rs753546855
NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[1] (p.434_441APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.1437G>C (p.Gly479=) rs960379328
NM_007078.3(LDB3):c.144C>T (p.Leu48=) rs397517213
NM_007078.3(LDB3):c.1521C>T (p.Thr507=) rs200838004
NM_007078.3(LDB3):c.1535A>C (p.Gln512Pro) rs138951890
NM_007078.3(LDB3):c.1562A>G (p.Tyr521Cys) rs535737552
NM_007078.3(LDB3):c.1606G>A (p.Val536Ile) rs113817827
NM_007078.3(LDB3):c.1668T>C (p.Asn556=) rs916700413
NM_007078.3(LDB3):c.1672A>G (p.Ile558Val) rs372331627
NM_007078.3(LDB3):c.1676+267C>T rs184741262
NM_007078.3(LDB3):c.1677-19C>T rs749512075
NM_007078.3(LDB3):c.1728C>T (p.Thr576=) rs749988944
NM_007078.3(LDB3):c.1752G>C (p.Leu584=) rs1589676711
NM_007078.3(LDB3):c.1815C>T (p.Phe605=) rs1057522289
NM_007078.3(LDB3):c.1824G>A (p.Pro608=) rs748428531
NM_007078.3(LDB3):c.1857+32_1857+33del rs149127817
NM_007078.3(LDB3):c.1858-10T>C rs202208256
NM_007078.3(LDB3):c.1858-7C>G rs1057520727
NM_007078.3(LDB3):c.1911G>A (p.Ala637=) rs150710377
NM_007078.3(LDB3):c.1971C>T (p.Cys657=) rs140552419
NM_007078.3(LDB3):c.1978+198A>G rs117918530
NM_007078.3(LDB3):c.1979-310G>A rs114139889
NM_007078.3(LDB3):c.2091C>T (p.Cys697=) rs571356142
NM_007078.3(LDB3):c.2094+10T>C rs769802374
NM_007078.3(LDB3):c.2094+148G>A rs17106978
NM_007078.3(LDB3):c.2094+162G>A rs112207292
NM_007078.3(LDB3):c.2124G>A (p.Pro708=) rs759812655
NM_007078.3(LDB3):c.273G>A (p.Thr91=) rs45613039
NM_007078.3(LDB3):c.287T>C (p.Val96Ala) rs794729056
NM_007078.3(LDB3):c.295C>T (p.Pro99Ser) rs201693259
NM_007078.3(LDB3):c.322-305G>A rs11596380
NM_007078.3(LDB3):c.328G>A (p.Ala110Thr) rs768737496
NM_007078.3(LDB3):c.385A>G (p.Ser129Gly) rs794729057
NM_007078.3(LDB3):c.398C>T (p.Pro133Leu) rs200239096
NM_007078.3(LDB3):c.407C>T (p.Pro136Leu) rs772887402
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) rs200596619
NM_007078.3(LDB3):c.468C>T (p.Ala156=) rs374233873
NM_007078.3(LDB3):c.493C>T (p.Arg165Trp) rs45610637
NM_007078.3(LDB3):c.540A>G (p.Leu180=) rs1283051092
NM_007078.3(LDB3):c.567G>A (p.Ser189=) rs778777214
NM_007078.3(LDB3):c.646A>T (p.Met216Leu) rs765199175
NM_007078.3(LDB3):c.689+323T>C rs145371401
NM_007078.3(LDB3):c.689+9C>T rs727503124
NM_007078.3(LDB3):c.690-17CT[3] rs544039308
NM_007078.3(LDB3):c.714C>T (p.Ala238=) rs727503125
NM_007078.3(LDB3):c.732C>T (p.Pro244=) rs144509718
NM_007078.3(LDB3):c.81C>G (p.Leu27=) rs1554844351
NM_007078.3(LDB3):c.860-15C>T rs727503126
NM_007078.3(LDB3):c.897-10G>A rs77304928
NM_007078.3(LDB3):c.897-11C>T rs766463668
NM_007078.3(LDB3):c.897-14T>C rs763081924
NM_007078.3(LDB3):c.897-164C>A rs11815273
NM_007078.3(LDB3):c.897-16G>C rs45513100
NM_007078.3(LDB3):c.897-298A>C rs117230487
NM_007078.3(LDB3):c.897-6907A>G rs79068721
NM_007078.3(LDB3):c.900C>A (p.Thr300=) rs760071118
NM_007078.3(LDB3):c.93+10C>A rs1222755412
NM_007078.3(LDB3):c.93+12C>T rs746751581
NM_007078.3(LDB3):c.94-119G>C rs4468255

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.