ClinVar Miner

List of variants in gene LDB3 reported by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 162
Download table as spreadsheet
HGVS dbSNP
NM_001080116.1(LDB3):c.*398C>G rs11594242
NM_001080116.1(LDB3):c.*678C>T rs1554857593
NM_001080116.1(LDB3):c.770C>T (p.Thr257Met) rs375798002
NM_001080116.1(LDB3):c.771G>A (p.Thr257=) rs144445130
NM_001080116.1(LDB3):c.772G>C (p.Glu258Gln) rs868365512
NM_001080116.1(LDB3):c.780C>T (p.Asn260=) rs372789789
NM_001080116.1(LDB3):c.787C>T (p.Arg263Cys) rs377201153
NM_001080116.1(LDB3):c.816T>C (p.His272=) rs748780980
NM_001080116.1(LDB3):c.817G>A (p.Gly273Ser) rs771037817
NM_001080116.1(LDB3):c.830A>C (p.Gln277Pro)
NM_007078.2(LDB3):c.-23-?_93+?dup
NM_007078.3(LDB3):c.1014A>G (p.Thr338=) rs150209221
NM_007078.3(LDB3):c.1041C>A (p.Ser347=) rs45555240
NM_007078.3(LDB3):c.1049C>T (p.Thr350Ile) rs200796750
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) rs138251566
NM_007078.3(LDB3):c.1074C>T (p.Ala358=) rs45459491
NM_007078.3(LDB3):c.1075G>A (p.Asp359Asn) rs557956141
NM_007078.3(LDB3):c.1086-247_1231+2del rs1564653469
NM_007078.3(LDB3):c.1111G>A (p.Ala371Thr) rs45539535
NM_007078.3(LDB3):c.1119C>T (p.Ala373=) rs773647394
NM_007078.3(LDB3):c.1121C>T (p.Ala374Val) rs1554860812
NM_007078.3(LDB3):c.1132C>T (p.Pro378Ser)
NM_007078.3(LDB3):c.1150T>A (p.Tyr384Asn) rs1554860857
NM_007078.3(LDB3):c.1165G>A (p.Ala389Thr)
NM_007078.3(LDB3):c.1167C>T (p.Ala389=) rs768844187
NM_007078.3(LDB3):c.1211G>A (p.Arg404Gln)
NM_007078.3(LDB3):c.1225C>A (p.Gln409Lys) rs139104492
NM_007078.3(LDB3):c.1253C>G (p.Pro418Arg) rs141870580
NM_007078.3(LDB3):c.1256C>A (p.Ser419Tyr) rs368888118
NM_007078.3(LDB3):c.1263G>A (p.Gly421=) rs139834701
NM_007078.3(LDB3):c.1289C>A (p.Thr430Asn) rs746183666
NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[1] (p.434_441APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[3] (p.434_441APAYTPSP[3]) rs397517209
NM_007078.3(LDB3):c.1312A>G (p.Thr438Ala)
NM_007078.3(LDB3):c.1313C>G (p.Thr438Ser) rs767914340
NM_007078.3(LDB3):c.1321C>T (p.Pro441Ser) rs757728320
NM_007078.3(LDB3):c.1328C>T (p.Pro443Leu) rs1554863327
NM_007078.3(LDB3):c.1335C>T (p.Tyr445=) rs587781024
NM_007078.3(LDB3):c.1339C>G (p.Pro447Ala) rs397517211
NM_007078.3(LDB3):c.1381T>G (p.Tyr461Asp) rs145655904
NM_007078.3(LDB3):c.139G>A (p.Asp47Asn) rs397517212
NM_007078.3(LDB3):c.1421C>T (p.Ser474Leu) rs1011836119
NM_007078.3(LDB3):c.1422G>A (p.Ser474=) rs142625982
NM_007078.3(LDB3):c.1442C>G (p.Pro481Arg) rs12761754
NM_007078.3(LDB3):c.1445C>T (p.Ala482Val) rs774313535
NM_007078.3(LDB3):c.1453G>T (p.Ala485Ser) rs397517214
NM_007078.3(LDB3):c.1460G>A (p.Arg487His) rs146265188
NM_007078.3(LDB3):c.1468T>C (p.Trp490Arg)
NM_007078.3(LDB3):c.147G>A (p.Val49=) rs45591834
NM_007078.3(LDB3):c.1487T>C (p.Phe496Ser) rs147072071
NM_007078.3(LDB3):c.1497G>T (p.Lys499Asn) rs1278770988
NM_007078.3(LDB3):c.1505C>T (p.Pro502Leu)
NM_007078.3(LDB3):c.1506G>A (p.Pro502=) rs45579241
NM_007078.3(LDB3):c.1520C>A (p.Thr507Asn)
NM_007078.3(LDB3):c.1535A>C (p.Gln512Pro) rs138951890
NM_007078.3(LDB3):c.1572G>A (p.Ala524=) rs149423035
NM_007078.3(LDB3):c.1594G>C (p.Ala532Pro) rs143764931
NM_007078.3(LDB3):c.1603_1605delinsTGCCACTCA (p.Thr535delinsCysHisSer)
NM_007078.3(LDB3):c.1606G>A (p.Val536Ile) rs113817827
NM_007078.3(LDB3):c.160G>A (p.Gly54Ser) rs201786090
NM_007078.3(LDB3):c.1633A>G (p.Ser545Gly)
NM_007078.3(LDB3):c.163G>A (p.Val55Ile) rs3740343
NM_007078.3(LDB3):c.1640G>A (p.Arg547Gln) rs201968826
NM_007078.3(LDB3):c.1649T>C (p.Leu550Pro)
NM_007078.3(LDB3):c.1653C>T (p.Cys551=) rs45581435
NM_007078.3(LDB3):c.1664A>G (p.Asn555Ser)
NM_007078.3(LDB3):c.1667A>G (p.Asn556Ser) rs372583830
NM_007078.3(LDB3):c.1675C>T (p.Arg559Trp) rs142947567
NM_007078.3(LDB3):c.1676G>A (p.Arg559Gln) rs763908636
NM_007078.3(LDB3):c.1696A>G (p.Met566Val)
NM_007078.3(LDB3):c.1697T>G (p.Met566Arg) rs566463138
NM_007078.3(LDB3):c.1703G>A (p.Arg568His) rs769156627
NM_007078.3(LDB3):c.1728C>T (p.Thr576=) rs749988944
NM_007078.3(LDB3):c.1736A>G (p.Tyr579Cys) rs199749907
NM_007078.3(LDB3):c.1752G>C (p.Leu584=)
NM_007078.3(LDB3):c.1773del (p.Glu592fs)
NM_007078.3(LDB3):c.1774G>C (p.Glu592Gln) rs727504944
NM_007078.3(LDB3):c.1789T>A (p.Tyr597Asn) rs727503131
NM_007078.3(LDB3):c.1798C>T (p.Arg600Ter) rs727503132
NM_007078.3(LDB3):c.1823C>T (p.Pro608Leu) rs145983824
NM_007078.3(LDB3):c.1851T>C (p.Ile617=) rs145402041
NM_007078.3(LDB3):c.1885T>C (p.Trp629Arg)
NM_007078.3(LDB3):c.1894A>G (p.Thr632Ala)
NM_007078.3(LDB3):c.1902C>A (p.Phe634Leu) rs773904344
NM_007078.3(LDB3):c.1903G>A (p.Val635Ile) rs45618633
NM_007078.3(LDB3):c.1903G>C (p.Val635Leu)
NM_007078.3(LDB3):c.1907G>A (p.Cys636Tyr) rs397517218
NM_007078.3(LDB3):c.1910C>T (p.Ala637Val) rs141569007
NM_007078.3(LDB3):c.1956C>T (p.Asp652=) rs139213290
NM_007078.3(LDB3):c.1957G>C (p.Gly653Arg)
NM_007078.3(LDB3):c.1962G>A (p.Glu654=) rs201063130
NM_007078.3(LDB3):c.196C>T (p.Gln66Ter) rs1554849100
NM_007078.3(LDB3):c.1971C>T (p.Cys657=) rs140552419
NM_007078.3(LDB3):c.1972G>A (p.Glu658Lys)
NM_007078.3(LDB3):c.1978+9A>C rs1060504199
NM_007078.3(LDB3):c.2010T>C (p.His670=) rs759857527
NM_007078.3(LDB3):c.2016C>T (p.Cys672=) rs45578640
NM_007078.3(LDB3):c.2017G>A (p.Asp673Asn) rs45514002
NM_007078.3(LDB3):c.2073C>T (p.His691=) rs45486293
NM_007078.3(LDB3):c.2092G>A (p.Ala698Thr) rs45577134
NM_007078.3(LDB3):c.2104G>T (p.Val702Leu) rs773235586
NM_007078.3(LDB3):c.2119C>T (p.Gln707Ter)
NM_007078.3(LDB3):c.2123C>T (p.Pro708Leu)
NM_007078.3(LDB3):c.2124G>A (p.Pro708=) rs759812655
NM_007078.3(LDB3):c.2173A>G (p.Ile725Val) rs1554870749
NM_007078.3(LDB3):c.2174T>A (p.Ile725Asn) rs748399477
NM_007078.3(LDB3):c.23C>A (p.Thr8Asn) rs1060501317
NM_007078.3(LDB3):c.242del (p.Gln81fs) rs1554849133
NM_007078.3(LDB3):c.272C>T (p.Thr91Met) rs769237367
NM_007078.3(LDB3):c.273G>A (p.Thr91=) rs45613039
NM_007078.3(LDB3):c.287T>C (p.Val96Ala) rs794729056
NM_007078.3(LDB3):c.290A>G (p.Gln97Arg) rs762580653
NM_007078.3(LDB3):c.302C>T (p.Pro101Leu) rs45592139
NM_007078.3(LDB3):c.306G>A (p.Val102=) rs201715521
NM_007078.3(LDB3):c.309C>A (p.Ile103=) rs1060504198
NM_007078.3(LDB3):c.348C>T (p.Ser116=) rs1060504200
NM_007078.3(LDB3):c.352G>A (p.Val118Met) rs35507268
NM_007078.3(LDB3):c.356C>T (p.Ala119Val) rs397517223
NM_007078.3(LDB3):c.378G>A (p.Ala126=) rs149872184
NM_007078.3(LDB3):c.450C>T (p.Ser150=) rs878854907
NM_007078.3(LDB3):c.465C>T (p.Leu155=) rs45516997
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) rs200596619
NM_007078.3(LDB3):c.492G>A (p.Pro164=) rs368407147
NM_007078.3(LDB3):c.4T>A (p.Ser2Thr) rs1564626023
NM_007078.3(LDB3):c.529del (p.Ala177fs) rs730880345
NM_007078.3(LDB3):c.529dup (p.Ala177fs) rs730880345
NM_007078.3(LDB3):c.530C>T (p.Ala177Val) rs397517224
NM_007078.3(LDB3):c.54G>T (p.Gln18His) rs149348427
NM_007078.3(LDB3):c.550A>G (p.Lys184Glu) rs774886148
NM_007078.3(LDB3):c.55G>A (p.Gly19Arg)
NM_007078.3(LDB3):c.55G>T (p.Gly19Trp)
NM_007078.3(LDB3):c.560C>T (p.Pro187Leu) rs149218167
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) rs45487699
NM_007078.3(LDB3):c.576G>A (p.Pro192=) rs45543741
NM_007078.3(LDB3):c.576G>T (p.Pro192=) rs45543741
NM_007078.3(LDB3):c.592C>T (p.Pro198Ser) rs1060501318
NM_007078.3(LDB3):c.609G>A (p.Ser203=) rs45531131
NM_007078.3(LDB3):c.656G>A (p.Arg219Gln) rs530979771
NM_007078.3(LDB3):c.664G>A (p.Ala222Thr) rs139922045
NM_007078.3(LDB3):c.668C>T (p.Ser223Leu) rs375306400
NM_007078.3(LDB3):c.689+10G>A rs45563234
NM_007078.3(LDB3):c.689+9C>T rs727503124
NM_007078.3(LDB3):c.690-2A>G rs1060501315
NM_007078.3(LDB3):c.690-4A>G rs45529531
NM_007078.3(LDB3):c.714C>T (p.Ala238=) rs727503125
NM_007078.3(LDB3):c.72C>A (p.Asn24Lys) rs1323002546
NM_007078.3(LDB3):c.732C>T (p.Pro244=) rs144509718
NM_007078.3(LDB3):c.752A>G (p.Lys251Arg) rs34423165
NM_007078.3(LDB3):c.782A>C (p.Asp261Ala) rs1285921374
NM_007078.3(LDB3):c.793C>T (p.Arg265Cys) rs45521338
NM_007078.3(LDB3):c.80T>C (p.Leu27Pro) rs1057517864
NM_007078.3(LDB3):c.826C>T (p.Arg276Cys) rs397517226
NM_007078.3(LDB3):c.827G>A (p.Arg276His)
NM_007078.3(LDB3):c.858C>T (p.Phe286=) rs764056994
NM_007078.3(LDB3):c.886C>T (p.Arg296Ter) rs1060501316
NM_007078.3(LDB3):c.891G>T (p.Arg297Ser) rs374336814
NM_007078.3(LDB3):c.897-10G>A rs77304928
NM_007078.3(LDB3):c.91C>T (p.Arg31Trp) rs367792378
NM_007078.3(LDB3):c.92G>A (p.Arg31Gln)
NM_007078.3(LDB3):c.94-9T>C rs1282721488
NM_007078.3(LDB3):c.993G>A (p.Ala331=) rs140347820
NM_007078.3(LDB3):c.99dup (p.Pro34fs) rs1554849000

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.