ClinVar Miner

List of variants in gene LDB3 reported by Stanford Center for Inherited Cardiovascular Disease,Stanford University

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 9
Download table as spreadsheet
HGVS dbSNP
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) rs138251566
NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[1] (p.434_441APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.1381T>G (p.Tyr461Asp) rs145655904
NM_007078.3(LDB3):c.1910C>T (p.Ala637Val) rs141569007
NM_007078.3(LDB3):c.23C>A (p.Thr8Asn) rs1060501317
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) rs200596619
NM_007078.3(LDB3):c.550A>G (p.Lys184Glu) rs774886148
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) rs45487699
NM_007078.3(LDB3):c.656G>A (p.Arg219Gln) rs530979771

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.