List of variants in gene LDB3 reported as uncertain significance by Stanford Center for Inherited Cardiovascular Disease, Stanford University

Minimum submission review status:		Collection method:
Minimum conflict level: Report conflict between different conditions
Gene type: Distinguish antisense genes from sense genes
Show significances as they were submitted (without aggregation into standard terms)
		ClinVar version:

Total variants: 9

Download table as spreadsheet

HGVS	dbSNP	gnomAD frequency
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr)	rs200596619	0.00082
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu)	rs45487699	0.00049
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala)	rs138251566	0.00026
NM_007078.3(LDB3):c.1910C>T (p.Ala637Val)	rs141569007	0.00018
NM_007078.3(LDB3):c.1381T>G (p.Tyr461Asp)	rs145655904	0.00002
NM_007078.3(LDB3):c.656G>A (p.Arg219Gln)	rs530979771	0.00002
NM_007078.3(LDB3):c.550A>G (p.Lys184Glu)	rs774886148	0.00001
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1])	rs397517209
NM_007078.3(LDB3):c.23C>A (p.Thr8Asn)	rs1060501317

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.