ClinVar Miner

List of variants in gene combination LOC102724058, SCN1A reported by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 235
Download table as spreadsheet
HGVS dbSNP
NM_001165963.1(SCN1A):c.4002+1953_4221del
NM_001165963.1(SCN1A):c.4563_4581+39delGCCTATACCTCGACCAGGAGTAAGAAGTATCAAATGATATGGGGGAAAAATACAAAAA rs1559114202
NM_001165963.1(SCN1A):c.4853-110_4853-108delins129
NM_001165963.2(SCN1A):c.4003-11_4036del rs1559128532
NM_006920.6(SCN1A):c.3049del (p.Arg1017fs) rs1553540389
NM_006920.6(SCN1A):c.3068T>C (p.Ile1023Thr) rs121918818
NM_006920.6(SCN1A):c.3071_3077del (p.Gln1024fs)
NM_006920.6(SCN1A):c.3073C>T (p.Gln1025Ter) rs542420576
NM_006920.6(SCN1A):c.3106G>A (p.Glu1036Lys)
NM_006920.6(SCN1A):c.3128T>G (p.Leu1043Arg)
NM_006920.6(SCN1A):c.3132C>A (p.Asn1044Lys) rs797045939
NM_006920.6(SCN1A):c.3143A>T (p.Asp1048Val) rs779306054
NM_006920.6(SCN1A):c.3182A>G (p.Asp1061Gly) rs1553540263
NM_006920.6(SCN1A):c.3191A>G (p.Tyr1064Cys) rs1226603266
NM_006920.6(SCN1A):c.3196_3229dup (p.Thr1077fs)
NM_006920.6(SCN1A):c.3310_3311del (p.Val1104fs) rs1559193050
NM_006920.6(SCN1A):c.3335A>C (p.Asp1112Ala) rs1559192797
NM_006920.6(SCN1A):c.3368G>A (p.Ser1123Asn)
NM_006920.6(SCN1A):c.3398_3399del (p.Lys1133fs) rs1553534296
NM_006920.6(SCN1A):c.3421T>A (p.Ser1141Thr)
NM_006920.6(SCN1A):c.3448G>A (p.Ala1150Thr) rs201079458
NM_006920.6(SCN1A):c.3468C>T (p.Pro1156=) rs769635347
NM_006920.6(SCN1A):c.3488C>G (p.Thr1163Ser) rs121918799
NM_006920.6(SCN1A):c.3506G>T (p.Cys1169Phe) rs1444741563
NM_006920.6(SCN1A):c.3517+2T>C
NM_006920.6(SCN1A):c.3518-3C>T
NM_006920.6(SCN1A):c.3523G>T (p.Val1175Leu) rs780607306
NM_006920.6(SCN1A):c.3540T>C (p.Cys1180=) rs750943685
NM_006920.6(SCN1A):c.3546A>C (p.Gln1182His)
NM_006920.6(SCN1A):c.3564C>T (p.Gly1188=)
NM_006920.6(SCN1A):c.3578G>A (p.Trp1193Ter) rs1559149128
NM_006920.6(SCN1A):c.3587T>C (p.Leu1196Pro) rs121917963
NM_006920.6(SCN1A):c.3596C>T (p.Thr1199Met)
NM_006920.6(SCN1A):c.3598dup (p.Cys1200fs) rs1060502182
NM_006920.6(SCN1A):c.3602_3603delinsA (p.Phe1201fs)
NM_006920.6(SCN1A):c.3604C>T (p.Arg1202Ter) rs794726710
NM_006920.6(SCN1A):c.3611T>A (p.Val1204Asp) rs1559148930
NM_006920.6(SCN1A):c.3622T>A (p.Trp1208Arg) rs1553532599
NM_006920.6(SCN1A):c.3638T>C (p.Ile1213Thr) rs1553532551
NM_006920.6(SCN1A):c.3656T>C (p.Leu1219Pro)
NM_006920.6(SCN1A):c.3672+1G>T
NM_006920.6(SCN1A):c.3672+5G>A rs1060502189
NM_006920.6(SCN1A):c.3677T>C (p.Phe1226Ser) rs1553531410
NM_006920.6(SCN1A):c.3679G>C (p.Glu1227Gln) rs750364705
NM_006920.6(SCN1A):c.3681A>C (p.Glu1227Asp) rs121917973
NM_006920.6(SCN1A):c.3683_3684AT[6] (p.Asp1232fs) rs796053072
NM_006920.6(SCN1A):c.3685_3696del (p.Ile1229_Asp1232del)
NM_006920.6(SCN1A):c.3690T>C (p.Tyr1230=) rs36031496
NM_006920.6(SCN1A):c.3701G>A (p.Arg1234Gln) rs121917912
NM_006920.6(SCN1A):c.3716C>T (p.Thr1239Met) rs140731963
NM_006920.6(SCN1A):c.3719T>C (p.Met1240Thr) rs749638533
NM_006920.6(SCN1A):c.3719T>G (p.Met1240Arg)
NM_006920.6(SCN1A):c.3743T>C (p.Phe1248Ser) rs398123591
NM_006920.6(SCN1A):c.3750C>G (p.Tyr1250Ter)
NM_006920.6(SCN1A):c.3752_3764del (p.Ile1251fs)
NM_006920.6(SCN1A):c.3754T>C (p.Phe1252Leu) rs1559144956
NM_006920.6(SCN1A):c.3771T>C (p.Leu1257=) rs143980709
NM_006920.6(SCN1A):c.3779G>A (p.Trp1260Ter)
NM_006920.6(SCN1A):c.3789T>G (p.Tyr1263Ter) rs1060502188
NM_006920.6(SCN1A):c.3833T>C (p.Phe1278Ser) rs794727224
NM_006920.6(SCN1A):c.3846+9C>T rs570092799
NM_006920.6(SCN1A):c.3847-1G>T rs1559140855
NM_006920.6(SCN1A):c.3847-2A>G rs794726816
NM_006920.6(SCN1A):c.3853T>A (p.Leu1285Met) rs375896308
NM_006920.6(SCN1A):c.3853T>C (p.Leu1285=) rs375896308
NM_006920.6(SCN1A):c.3857T>G (p.Val1286Gly)
NM_006920.6(SCN1A):c.3866C>T (p.Thr1289Ile) rs146878122
NM_006920.6(SCN1A):c.3869C>T (p.Ala1290Val) rs1553529579
NM_006920.6(SCN1A):c.3891A>T (p.Glu1297Asp) rs121917910
NM_006920.6(SCN1A):c.3892C>G (p.Leu1298Val)
NM_006920.6(SCN1A):c.3896G>A (p.Gly1299Glu)
NM_006920.6(SCN1A):c.3910C>T (p.Leu1304Phe) rs1559140423
NM_006920.6(SCN1A):c.3915G>A (p.Arg1305=) rs149579028
NM_006920.6(SCN1A):c.3922A>G (p.Arg1308Gly)
NM_006920.6(SCN1A):c.3938dup (p.Arg1314fs) rs1559140306
NM_006920.6(SCN1A):c.3956T>C (p.Phe1319Ser) rs1559140205
NM_006920.6(SCN1A):c.3964del (p.Gly1321_Met1322insTer) rs1553529426
NM_006920.6(SCN1A):c.3969+2T>C rs1559140110
NM_006920.6(SCN1A):c.3994G>T (p.Ala1332Ser) rs796053006
NM_006920.6(SCN1A):c.4000C>T (p.Pro1334Ser)
NM_006920.6(SCN1A):c.4003T>C (p.Ser1335Pro) rs1553525337
NM_006920.6(SCN1A):c.4015G>C (p.Val1339Leu)
NM_006920.6(SCN1A):c.4019T>C (p.Leu1340Pro) rs1553525313
NM_006920.6(SCN1A):c.4024G>T (p.Val1342Phe)
NM_006920.6(SCN1A):c.4028G>T (p.Cys1343Phe) rs1057521537
NM_006920.6(SCN1A):c.4069T>G (p.Leu1357Val) rs1553525227
NM_006920.6(SCN1A):c.4076C>T (p.Ala1359Val) rs1553525210
NM_006920.6(SCN1A):c.4078G>T (p.Gly1360Cys)
NM_006920.6(SCN1A):c.4096A>G (p.Ile1366Val) rs762317674
NM_006920.6(SCN1A):c.4126A>G (p.Ile1376Val)
NM_006920.6(SCN1A):c.4128C>T (p.Ile1376=) rs761168283
NM_006920.6(SCN1A):c.4129G>A (p.Glu1377Lys) rs775820803
NM_006920.6(SCN1A):c.4134C>T (p.Asp1378=) rs376118833
NM_006920.6(SCN1A):c.4135G>A (p.Val1379Met) rs121917986
NM_006920.6(SCN1A):c.4138A>C (p.Asn1380His) rs1295072436
NM_006920.6(SCN1A):c.4141_4153del (p.Asn1381fs) rs1553525036
NM_006920.6(SCN1A):c.4144_4147delinsTG (p.His1382fs)
NM_006920.6(SCN1A):c.4146T>A (p.His1382Gln) rs772400574
NM_006920.6(SCN1A):c.4176T>C (p.Asn1392=) rs1176622466
NM_006920.6(SCN1A):c.4183G>A (p.Ala1395Thr) rs1559127505
NM_006920.6(SCN1A):c.4183G>T (p.Ala1395Ser) rs1559127505
NM_006920.6(SCN1A):c.4186C>T (p.Arg1396Ter) rs398123593
NM_006920.6(SCN1A):c.4201A>G (p.Lys1401Glu) rs1553524977
NM_006920.6(SCN1A):c.4203del (p.Lys1401_Val1402insTer) rs1060502183
NM_006920.6(SCN1A):c.4205T>A (p.Val1402Glu) rs1559127385
NM_006920.6(SCN1A):c.4234C>G (p.Leu1412Val) rs1060502190
NM_006920.6(SCN1A):c.4234_4235CT[1] (p.Ser1413fs)
NM_006920.6(SCN1A):c.4249G>T (p.Val1417Phe) rs878854263
NM_006920.6(SCN1A):c.4251+1G>T rs1553524865
NM_006920.6(SCN1A):c.4286C>T (p.Ala1429Val) rs1559122124
NM_006920.6(SCN1A):c.4288G>A (p.Ala1430Thr) rs121917974
NM_006920.6(SCN1A):c.4300A>T (p.Arg1434Ter) rs1553523142
NM_006920.6(SCN1A):c.4306-1G>A rs1553522517
NM_006920.6(SCN1A):c.4306G>C (p.Val1436Leu) rs1559119642
NM_006920.6(SCN1A):c.4319C>T (p.Pro1440Leu) rs121917945
NM_006920.6(SCN1A):c.4342A>G (p.Met1448Val) rs1553522451
NM_006920.6(SCN1A):c.4360A>G (p.Ile1454Val) rs138231868
NM_006920.6(SCN1A):c.4376G>A (p.Gly1459Glu)
NM_006920.6(SCN1A):c.4411dup (p.Ile1471fs)
NM_006920.6(SCN1A):c.4418A>C (p.Asp1473Ala) rs1553522339
NM_006920.6(SCN1A):c.4420A>G (p.Asn1474Asp) rs1553522331
NM_006920.6(SCN1A):c.4429del (p.Gln1477fs) rs1553522321
NM_006920.6(SCN1A):c.4444-1C>T rs1553521567
NM_006920.6(SCN1A):c.4479G>C (p.Gln1493His) rs1559114837
NM_006920.6(SCN1A):c.4479G>T (p.Gln1493His)
NM_006920.6(SCN1A):c.4508T>G (p.Leu1503Ter)
NM_006920.6(SCN1A):c.4514C>T (p.Ser1505Leu) rs139300715
NM_006920.6(SCN1A):c.4515G>A (p.Ser1505=) rs78041051
NM_006920.6(SCN1A):c.4518A>G (p.Lys1506=) rs374087499
NM_006920.6(SCN1A):c.4522C>A (p.Pro1508Thr) rs796053021
NM_006920.6(SCN1A):c.4523C>G (p.Pro1508Arg)
NM_006920.6(SCN1A):c.4524G>A (p.Pro1508=) rs368785509
NM_006920.6(SCN1A):c.4534A>G (p.Ile1512Val) rs1474960995
NM_006920.6(SCN1A):c.4541G>A (p.Arg1514Gln) rs1559114408
NM_006920.6(SCN1A):c.4548+5G>C rs1559114303
NM_006920.6(SCN1A):c.4549-3C>G rs747649993
NM_006920.6(SCN1A):c.4598A>G (p.Asp1533Gly)
NM_006920.6(SCN1A):c.4649A>G (p.Glu1550Gly)
NM_006920.6(SCN1A):c.4655_4659del (p.Asp1552fs) rs1559110846
NM_006920.6(SCN1A):c.4664G>A (p.Ser1555Asn)
NM_006920.6(SCN1A):c.4691G>A (p.Arg1564His) rs368834365
NM_006920.6(SCN1A):c.4698T>C (p.Asn1566=) rs145296488
NM_006920.6(SCN1A):c.4701G>A (p.Leu1567=)
NM_006920.6(SCN1A):c.4729T>C (p.Cys1577Arg) rs121917919
NM_006920.6(SCN1A):c.4730G>A (p.Cys1577Tyr) rs1553520982
NM_006920.6(SCN1A):c.4750C>A (p.Leu1584Ile)
NM_006920.6(SCN1A):c.4753C>T (p.Arg1585Cys) rs121917993
NM_006920.6(SCN1A):c.4754G>A (p.Arg1585His) rs575368466
NM_006920.6(SCN1A):c.4755C>T (p.Arg1585=) rs762836573
NM_006920.6(SCN1A):c.4760A>T (p.Tyr1587Phe) rs377325221
NM_006920.6(SCN1A):c.4768A>G (p.Thr1590Ala)
NM_006920.6(SCN1A):c.4774G>T (p.Gly1592Ter) rs761333438
NM_006920.6(SCN1A):c.4789G>T (p.Asp1597Tyr) rs121917915
NM_006920.6(SCN1A):c.4801G>A (p.Val1601Ile) rs121918808
NM_006920.6(SCN1A):c.4819+1G>T
NM_006920.6(SCN1A):c.4822A>G (p.Met1608Val) rs373967247
NM_006920.6(SCN1A):c.4839G>A (p.Leu1613=) rs142910512
NM_006920.6(SCN1A):c.4867C>G (p.Leu1623Val) rs1211903272
NM_006920.6(SCN1A):c.4873C>T (p.Arg1625Ter) rs199727342
NM_006920.6(SCN1A):c.4874G>A (p.Arg1625Gln) rs121917995
NM_006920.6(SCN1A):c.4892G>T (p.Arg1631Met)
NM_006920.6(SCN1A):c.4912C>T (p.Leu1638=) rs148546224
NM_006920.6(SCN1A):c.4922G>A (p.Gly1641Glu)
NM_006920.6(SCN1A):c.4931G>C (p.Gly1644Ala) rs1553520439
NM_006920.6(SCN1A):c.4940C>T (p.Thr1647Met) rs121917922
NM_006920.6(SCN1A):c.4943T>C (p.Leu1648Pro) rs1559105368
NM_006920.6(SCN1A):c.4945_4946CT[1] (p.Phe1650fs) rs1559105301
NM_006920.6(SCN1A):c.4958T>C (p.Met1653Thr) rs121918765
NM_006920.6(SCN1A):c.4977_4980del (p.Phe1660fs) rs794726754
NM_006920.6(SCN1A):c.5006T>A (p.Val1669Asp) rs1553520380
NM_006920.6(SCN1A):c.5048A>G (p.Tyr1683Cys) rs121918777
NM_006920.6(SCN1A):c.5071G>A (p.Asp1691Asn) rs748333147
NM_006920.6(SCN1A):c.5088T>A (p.Phe1696Leu) rs796053033
NM_006920.6(SCN1A):c.5092A>G (p.Thr1698Ala)
NM_006920.6(SCN1A):c.5098G>A (p.Gly1700Ser) rs796053098
NM_006920.6(SCN1A):c.5112C>G (p.Ile1704Met) rs1559104174
NM_006920.6(SCN1A):c.5134T>C (p.Ser1712Pro) rs1553520320
NM_006920.6(SCN1A):c.5138C>T (p.Ala1713Val) rs1553520319
NM_006920.6(SCN1A):c.5141G>A (p.Gly1714Asp) rs1553520318
NM_006920.6(SCN1A):c.5184C>T (p.Pro1728=) rs149315236
NM_006920.6(SCN1A):c.5189G>C (p.Cys1730Ser)
NM_006920.6(SCN1A):c.5192A>C (p.Asp1731Ala)
NM_006920.6(SCN1A):c.5230G>T (p.Asp1744Tyr) rs927722314
NM_006920.6(SCN1A):c.5234G>A (p.Cys1745Tyr) rs1559103294
NM_006920.6(SCN1A):c.5236G>C (p.Gly1746Arg) rs1553520227
NM_006920.6(SCN1A):c.5244A>C (p.Pro1748=) rs1044871344
NM_006920.6(SCN1A):c.5253A>G (p.Gly1751=) rs150570058
NM_006920.6(SCN1A):c.5255_5256delinsCCCATCTG (p.Ile1752delinsThrHisLeu)
NM_006920.6(SCN1A):c.5285C>A (p.Ser1762Tyr) rs121917951
NM_006920.6(SCN1A):c.5285C>T (p.Ser1762Phe) rs121917951
NM_006920.6(SCN1A):c.5350G>A (p.Glu1784Lys) rs121918813
NM_006920.6(SCN1A):c.5366del (p.Leu1789fs)
NM_006920.6(SCN1A):c.5385G>A (p.Glu1795=) rs140237315
NM_006920.6(SCN1A):c.5419G>A (p.Asp1807Asn)
NM_006920.6(SCN1A):c.5435T>C (p.Met1812Thr) rs1559101839
NM_006920.6(SCN1A):c.5462_5463insT (p.Ala1822fs) rs1559101585
NM_006920.6(SCN1A):c.5499_5502AAAC[1] (p.Lys1835fs) rs794726726
NM_006920.6(SCN1A):c.5535G>A (p.Met1845Ile) rs144691638
NM_006920.6(SCN1A):c.5538G>A (p.Val1846=) rs142019382
NM_006920.6(SCN1A):c.5564A>G (p.Asp1855Gly) rs1553520029
NM_006920.6(SCN1A):c.5587C>T (p.Arg1863Trp) rs796053043
NM_006920.6(SCN1A):c.5588G>A (p.Arg1863Gln) rs1060502186
NM_006920.6(SCN1A):c.5599_5601delinsAAT (p.Glu1867Asn)
NM_006920.6(SCN1A):c.5601G>A (p.Glu1867=) rs748090629
NM_006920.6(SCN1A):c.5606G>A (p.Gly1869Glu) rs201905405
NM_006920.6(SCN1A):c.5606G>C (p.Gly1869Ala)
NM_006920.6(SCN1A):c.5618C>T (p.Ala1873Val)
NM_006920.6(SCN1A):c.5623C>T (p.Arg1875Ter) rs779614747
NM_006920.6(SCN1A):c.5624G>A (p.Arg1875Gln) rs1559100385
NM_006920.6(SCN1A):c.5641C>T (p.Arg1881Ter) rs794726739
NM_006920.6(SCN1A):c.5669T>G (p.Val1890Gly) rs1559100042
NM_006920.6(SCN1A):c.5686_5688ACT[2] (p.Thr1898del) rs1553519902
NM_006920.6(SCN1A):c.5693C>T (p.Thr1898Ile) rs121918793
NM_006920.6(SCN1A):c.5702G>A (p.Arg1901Gln)
NM_006920.6(SCN1A):c.5721del (p.Ala1908fs) rs1553519872
NM_006920.6(SCN1A):c.5732T>G (p.Ile1911Ser) rs121917981
NM_006920.6(SCN1A):c.5734C>A (p.Gln1912Lys)
NM_006920.6(SCN1A):c.5744A>G (p.Tyr1915Cys) rs376669368
NM_006920.6(SCN1A):c.5749C>G (p.Arg1917Gly) rs121917956
NM_006920.6(SCN1A):c.5754C>G (p.His1918Gln) rs371253263
NM_006920.6(SCN1A):c.5764del (p.Arg1922fs) rs587780446
NM_006920.6(SCN1A):c.5765G>T (p.Arg1922Leu) rs556893466
NM_006920.6(SCN1A):c.5771T>C (p.Val1924Ala) rs1559099002
NM_006920.6(SCN1A):c.5776C>G (p.Gln1926Glu) rs1358776988
NM_006920.6(SCN1A):c.5780C>T (p.Ala1927Val) rs915676341
NM_006920.6(SCN1A):c.5790G>A (p.Thr1930=) rs754371368
NM_006920.6(SCN1A):c.5827C>T (p.Leu1943Phe)
NM_006920.6(SCN1A):c.5831T>C (p.Ile1944Thr) rs35735053
NM_006920.6(SCN1A):c.5837A>G (p.Glu1946Gly) rs121918802
NM_006920.6(SCN1A):c.5844G>T (p.Met1948Ile) rs763997333
NM_006920.6(SCN1A):c.5899T>A (p.Ser1967Thr) rs1553519733
NM_006920.6(SCN1A):c.5929C>T (p.Arg1977Trp)
NM_006920.6(SCN1A):c.5945T>C (p.Ile1982Thr)
NM_006920.6(SCN1A):c.5955A>C (p.Lys1985Asn) rs371243629
NM_006920.6(SCN1A):c.5957A>G (p.His1986Arg)

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.