ClinVar Miner

List of variants in gene combination LOC102724058, SCN1A reported as likely pathogenic by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 17
Download table as spreadsheet
HGVS dbSNP
NM_001165963.1(SCN1A):c.4267C>G (p.Leu1423Val) rs1060502190
NM_001165963.1(SCN1A):c.4563_4581+39delGCCTATACCTCGACCAGGAGTAAGAAGTATCAAATGATATGGGGGAAAAATACAAAAA
NM_001165963.1(SCN1A):c.4991T>C (p.Met1664Thr) rs121918765
NM_001165963.1(SCN1A):c.5318C>A (p.Ser1773Tyr) rs121917951
NM_001165963.2(SCN1A):c.4052T>C (p.Leu1351Pro) rs1553525313
NM_001165963.2(SCN1A):c.4453A>G (p.Asn1485Asp) rs1553522331
NM_001165963.2(SCN1A):c.4807G>T (p.Gly1603Ter) rs761333438
NM_001165963.2(SCN1A):c.4964G>C (p.Gly1655Ala) rs1553520439
NM_001165963.2(SCN1A):c.5039T>A (p.Val1680Asp) rs1553520380
NM_001165963.2(SCN1A):c.5167T>C (p.Ser1723Pro) rs1553520320
NM_001165963.2(SCN1A):c.5174G>A (p.Gly1725Asp) rs1553520318
NM_001165963.2(SCN1A):c.5597A>G (p.Asp1866Gly) rs1553520029
NM_001165963.2(SCN1A):c.5725_5727del (p.Thr1909del) rs1553519902
NM_006920.4(SCN1A):c.3701G>A (p.Arg1234Gln) rs121917912
NM_006920.4(SCN1A):c.4874G>A (p.Arg1625Gln) rs121917995
NM_006920.4(SCN1A):c.5285C>T (p.Ser1762Phe) rs121917951
NM_006920.5(SCN1A):c.4789G>T (p.Asp1597Tyr) rs121917915

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.