ClinVar Miner

List of variants in gene MAP2K2 reported as benign for not provided

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 31
Download table as spreadsheet
HGVS dbSNP
NM_030662.3(MAP2K2):c.-206G>T
NM_030662.3(MAP2K2):c.-269G>A
NM_030662.3(MAP2K2):c.-285G>T
NM_030662.3(MAP2K2):c.-366G>A
NM_030662.3(MAP2K2):c.1047-140_1047-139insG
NM_030662.3(MAP2K2):c.1047-279C>T
NM_030662.3(MAP2K2):c.1065G>A (p.Ala355=) rs374807671
NM_030662.3(MAP2K2):c.1093-6T>C rs369681843
NM_030662.3(MAP2K2):c.1162C>T (p.Arg388Trp) rs144383241
NM_030662.3(MAP2K2):c.1194C>T (p.Thr398=) rs144850779
NM_030662.3(MAP2K2):c.192C>T (p.Val64=) rs8157
NM_030662.3(MAP2K2):c.240G>A (p.Ala80=) rs543217722
NM_030662.3(MAP2K2):c.303+127A>G
NM_030662.3(MAP2K2):c.303+8C>G rs199612401
NM_030662.3(MAP2K2):c.405G>C (p.Gly135=) rs10424722
NM_030662.3(MAP2K2):c.420C>T (p.Asp140=) rs369925884
NM_030662.3(MAP2K2):c.450+99A>G
NM_030662.3(MAP2K2):c.528+237T>C
NM_030662.3(MAP2K2):c.528+242T>G
NM_030662.3(MAP2K2):c.529-138G>A
NM_030662.3(MAP2K2):c.690G>A (p.Thr230=) rs201287884
NM_030662.3(MAP2K2):c.705+179T>C
NM_030662.3(MAP2K2):c.813C>T (p.Asp271=) rs201726622
NM_030662.3(MAP2K2):c.825G>A (p.Leu275=) rs587781027
NM_030662.3(MAP2K2):c.844C>T (p.Pro282Ser) rs142307980
NM_030662.3(MAP2K2):c.846C>T (p.Pro282=) rs11539506
NM_030662.3(MAP2K2):c.893C>T (p.Pro298Leu) rs200371894
NM_030662.3(MAP2K2):c.919+252C>T
NM_030662.3(MAP2K2):c.92+212_92+237delGGGAGGACGGGGCAGGGGGCCCTCGG
NM_030662.3(MAP2K2):c.981C>T (p.Asn327=) rs143275018
NM_030662.3(MAP2K2):c.985-150C>G

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.