ClinVar Miner

List of variants in gene MAP2K2 reported as benign

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 69
Download table as spreadsheet
HGVS dbSNP
NM_030662.3(MAP2K2):c.*19C>T rs145743390
NM_030662.3(MAP2K2):c.*24C>T rs6629
NM_030662.3(MAP2K2):c.*8C>T rs377675706
NM_030662.3(MAP2K2):c.-18_-16delCCG rs397517411
NM_030662.3(MAP2K2):c.-206G>T
NM_030662.3(MAP2K2):c.-269G>A
NM_030662.3(MAP2K2):c.-285G>T
NM_030662.3(MAP2K2):c.-366G>A
NM_030662.3(MAP2K2):c.1005C>T (p.Asn335=) rs587781028
NM_030662.3(MAP2K2):c.1020C>T (p.Pro340=) rs192389729
NM_030662.3(MAP2K2):c.1046+13G>A rs587781029
NM_030662.3(MAP2K2):c.1047-140_1047-139insG
NM_030662.3(MAP2K2):c.1047-279C>T
NM_030662.3(MAP2K2):c.1065G>A (p.Ala355=) rs374807671
NM_030662.3(MAP2K2):c.1074G>A (p.Ala358=) rs140896887
NM_030662.3(MAP2K2):c.1093-6T>C rs369681843
NM_030662.3(MAP2K2):c.1140C>T (p.Ala380=) rs146618055
NM_030662.3(MAP2K2):c.1162C>T (p.Arg388Trp) rs144383241
NM_030662.3(MAP2K2):c.1194C>T (p.Thr398=) rs144850779
NM_030662.3(MAP2K2):c.1198G>A (p.Val400Met) rs533247725
NM_030662.3(MAP2K2):c.141C>T (p.Asp47=) rs201526172
NM_030662.3(MAP2K2):c.14G>A (p.Arg5Lys) rs1555699412
NM_030662.3(MAP2K2):c.192C>T (p.Val64=) rs8157
NM_030662.3(MAP2K2):c.225C>T (p.Ile75=) rs561400866
NM_030662.3(MAP2K2):c.240G>A (p.Ala80=) rs543217722
NM_030662.3(MAP2K2):c.246C>T (p.Asn82=) rs150942310
NM_030662.3(MAP2K2):c.291C>A (p.Ile97=) rs200918323
NM_030662.3(MAP2K2):c.303+11C>T rs200405512
NM_030662.3(MAP2K2):c.303+127A>G
NM_030662.3(MAP2K2):c.303+12G>A rs376432107
NM_030662.3(MAP2K2):c.303+18G>A rs116988721
NM_030662.3(MAP2K2):c.303+8C>G rs199612401
NM_030662.3(MAP2K2):c.33G>A (p.Ala11=) rs368233443
NM_030662.3(MAP2K2):c.405G>C (p.Gly135=) rs10424722
NM_030662.3(MAP2K2):c.420C>T (p.Asp140=) rs369925884
NM_030662.3(MAP2K2):c.450+15G>T rs10424545
NM_030662.3(MAP2K2):c.450+99A>G
NM_030662.3(MAP2K2):c.453C>T (p.Asp151=) rs17851657
NM_030662.3(MAP2K2):c.498C>T (p.Pro166=) rs139404261
NM_030662.3(MAP2K2):c.525C>T (p.Ile175=) rs150833333
NM_030662.3(MAP2K2):c.528+20A>G rs73918030
NM_030662.3(MAP2K2):c.528+237T>C
NM_030662.3(MAP2K2):c.528+242T>G
NM_030662.3(MAP2K2):c.528+46C>T rs377101954
NM_030662.3(MAP2K2):c.529-12G>A rs375701469
NM_030662.3(MAP2K2):c.529-138G>A
NM_030662.3(MAP2K2):c.529-15C>T rs778783152
NM_030662.3(MAP2K2):c.546G>A (p.Ala182=) rs141402203
NM_030662.3(MAP2K2):c.580+6G>A rs201435249
NM_030662.3(MAP2K2):c.581-18G>A rs372759920
NM_030662.3(MAP2K2):c.603C>T (p.Leu201=) rs148291450
NM_030662.3(MAP2K2):c.621G>A (p.Glu207=) rs397517416
NM_030662.3(MAP2K2):c.660C>A (p.Ile220=) rs10250
NM_030662.3(MAP2K2):c.678C>T (p.Ser226=) rs200874968
NM_030662.3(MAP2K2):c.690G>A (p.Thr230=) rs201287884
NM_030662.3(MAP2K2):c.705+11G>C rs202086678
NM_030662.3(MAP2K2):c.705+179T>C
NM_030662.3(MAP2K2):c.813C>T (p.Asp271=) rs201726622
NM_030662.3(MAP2K2):c.823C>T (p.Leu275=) rs145934142
NM_030662.3(MAP2K2):c.825G>A (p.Leu275=) rs587781027
NM_030662.3(MAP2K2):c.844C>T (p.Pro282Ser) rs142307980
NM_030662.3(MAP2K2):c.846C>T (p.Pro282=) rs11539506
NM_030662.3(MAP2K2):c.893C>T (p.Pro298Leu) rs200371894
NM_030662.3(MAP2K2):c.919+12A>G rs350911
NM_030662.3(MAP2K2):c.919+252C>T
NM_030662.3(MAP2K2):c.92+212_92+237delGGGAGGACGGGGCAGGGGGCCCTCGG rs757105280
NM_030662.3(MAP2K2):c.93-20A>C rs189388604
NM_030662.3(MAP2K2):c.981C>T (p.Asn327=) rs143275018
NM_030662.3(MAP2K2):c.985-150C>G

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.