ClinVar Miner

List of variants in gene MBD5 studied for Mental retardation, autosomal dominant 1

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 150
Download table as spreadsheet
HGVS dbSNP
MBD5, THR157GLNFSTER4
NC_000002.12:g.(?_148458739)_(148512961_?)dup
NM_018328.4(MBD5):c.1025dup (p.Ser343Phefs) rs1553518511
NM_018328.4(MBD5):c.1041G>T (p.Gln347His) rs746751148
NM_018328.4(MBD5):c.1111C>G (p.Gln371Glu) rs536900412
NM_018328.4(MBD5):c.1141T>C (p.Phe381Leu) rs768570356
NM_018328.4(MBD5):c.1198G>A (p.Val400Ile) rs377568191
NM_018328.4(MBD5):c.1234G>A (p.Val412Ile) rs761118931
NM_018328.4(MBD5):c.1249_1263delATGAATCATGGGAGT (p.Met417_Ser421del)
NM_018328.4(MBD5):c.1304C>T (p.Ser435Phe) rs768225923
NM_018328.4(MBD5):c.1327G>A (p.Val443Met) rs137977565
NM_018328.4(MBD5):c.1327G>T (p.Val443Leu) rs137977565
NM_018328.4(MBD5):c.1368G>T (p.Ser456=) rs146020786
NM_018328.4(MBD5):c.1382G>A (p.Arg461His) rs139964770
NM_018328.4(MBD5):c.150delT (p.Thr52Hisfs) rs398122412
NM_018328.4(MBD5):c.1510A>G (p.Met504Val) rs114251920
NM_018328.4(MBD5):c.1535C>T (p.Ser512Phe) rs201695275
NM_018328.4(MBD5):c.1536C>T (p.Ser512=) rs147908860
NM_018328.4(MBD5):c.1537G>A (p.Asp513Asn) rs1465733702
NM_018328.4(MBD5):c.1564C>T (p.Pro522Ser) rs1161083244
NM_018328.4(MBD5):c.156A>G (p.Thr52=) rs796958008
NM_018328.4(MBD5):c.1570C>T (p.Pro524Ser) rs727503998
NM_018328.4(MBD5):c.1589G>A (p.Ser530Asn) rs558138423
NM_018328.4(MBD5):c.1596A>G (p.Val532=) rs114611333
NM_018328.4(MBD5):c.1634C>G (p.Ser545Cys) rs1553518618
NM_018328.4(MBD5):c.1638C>T (p.Ala546=) rs116413446
NM_018328.4(MBD5):c.1837A>G (p.Asn613Asp) rs398124341
NM_018328.4(MBD5):c.1842T>C (p.Thr614=) rs1553518662
NM_018328.4(MBD5):c.1842_1865delTGAAGGACATAGCACTTTAAACAC (p.Glu615_Thr622del)
NM_018328.4(MBD5):c.1920T>C (p.Gly640=) rs1031744379
NM_018328.4(MBD5):c.1961A>T (p.Asp654Val) rs115495710
NM_018328.4(MBD5):c.1962C>A (p.Asp654Glu) rs139953766
NM_018328.4(MBD5):c.1962C>T (p.Asp654=) rs139953766
NM_018328.4(MBD5):c.1963G>A (p.Ala655Thr) rs576930680
NM_018328.4(MBD5):c.1987C>T (p.Pro663Ser) rs1057520996
NM_018328.4(MBD5):c.1999T>C (p.Leu667=) rs529715710
NM_018328.4(MBD5):c.2011A>G (p.Arg671Gly)
NM_018328.4(MBD5):c.2030G>A (p.Ser677Asn) rs114314967
NM_018328.4(MBD5):c.2108A>G (p.Gln703Arg) rs1553518707
NM_018328.4(MBD5):c.2162C>T (p.Pro721Leu) rs138639760
NM_018328.4(MBD5):c.2170G>A (p.Gly724Arg) rs1553518717
NM_018328.4(MBD5):c.2198C>T (p.Ser733Phe)
NM_018328.4(MBD5):c.2240G>C (p.Ser747Thr)
NM_018328.4(MBD5):c.2254A>G (p.Ile752Val) rs147455836
NM_018328.4(MBD5):c.2257C>A (p.Pro753Thr) rs370340010
NM_018328.4(MBD5):c.2275G>A (p.Val759Met) rs377604964
NM_018328.4(MBD5):c.2278C>T (p.His760Tyr) rs1060501150
NM_018328.4(MBD5):c.2279A>G (p.His760Arg) rs763275881
NM_018328.4(MBD5):c.2299_2302delAACT (p.Asn767Leufs) rs1060501153
NM_018328.4(MBD5):c.2314A>C (p.Asn772His) rs200151142
NM_018328.4(MBD5):c.2321delC (p.Pro774Glnfs) rs1553518752
NM_018328.4(MBD5):c.236G>A (p.Gly79Glu) rs34995577
NM_018328.4(MBD5):c.2384T>A (p.Met795Lys)
NM_018328.4(MBD5):c.2399G>A (p.Gly800Asp) rs201668347
NM_018328.4(MBD5):c.2402T>C (p.Met801Thr)
NM_018328.4(MBD5):c.2426C>G (p.Pro809Arg) rs1060501152
NM_018328.4(MBD5):c.247A>G (p.Lys83Glu)
NM_018328.4(MBD5):c.2495A>G (p.Tyr832Cys) rs954814725
NM_018328.4(MBD5):c.2502A>C (p.Gln834His) rs147272790
NM_018328.4(MBD5):c.2519-8C>T rs761957089
NM_018328.4(MBD5):c.2520C>T (p.Gly840=) rs201649831
NM_018328.4(MBD5):c.25G>C (p.Gly9Arg)
NM_018328.4(MBD5):c.2605G>A (p.Val869Ile) rs116207524
NM_018328.4(MBD5):c.2621C>A (p.Ala874Glu)
NM_018328.4(MBD5):c.2633delC (p.Pro878Hisfs) rs1553519853
NM_018328.4(MBD5):c.267T>C (p.Asp89=) rs143333632
NM_018328.4(MBD5):c.2689G>A (p.Ala897Thr) rs778516851
NM_018328.4(MBD5):c.268G>A (p.Val90Ile) rs1329667912
NM_018328.4(MBD5):c.274G>A (p.Ala92Thr) rs770801894
NM_018328.4(MBD5):c.2789A>C (p.Gln930Pro) rs564759063
NM_018328.4(MBD5):c.2828A>G (p.Gln943Arg) rs377062993
NM_018328.4(MBD5):c.2840G>A (p.Gly947Glu) rs114359726
NM_018328.4(MBD5):c.2865C>A (p.Asn955Lys)
NM_018328.4(MBD5):c.2884C>A (p.Gln962Lys)
NM_018328.4(MBD5):c.2903C>T (p.Ser968Leu) rs200985982
NM_018328.4(MBD5):c.2978A>C (p.Gln993Pro) rs761395486
NM_018328.4(MBD5):c.2979G>C (p.Gln993His) rs148321416
NM_018328.4(MBD5):c.297A>G (p.Leu99=) rs77213206
NM_018328.4(MBD5):c.3027C>T (p.Pro1009=) rs144464864
NM_018328.4(MBD5):c.302T>C (p.Ile101Thr)
NM_018328.4(MBD5):c.3035G>A (p.Cys1012Tyr)
NM_018328.4(MBD5):c.3044A>G (p.Gln1015Arg) rs143028540
NM_018328.4(MBD5):c.3055-9T>C rs370173652
NM_018328.4(MBD5):c.3063G>A (p.Met1021Ile)
NM_018328.4(MBD5):c.3067G>A (p.Glu1023Lys) rs1064796473
NM_018328.4(MBD5):c.3073G>T (p.Ala1025Ser) rs1553520432
NM_018328.4(MBD5):c.3087C>G (p.Asn1029Lys) rs771343592
NM_018328.4(MBD5):c.3094A>T (p.Ile1032Leu) rs774513612
NM_018328.4(MBD5):c.3104A>C (p.Gln1035Pro)
NM_018328.4(MBD5):c.3143C>T (p.Thr1048Ile) rs145475623
NM_018328.4(MBD5):c.3182C>T (p.Pro1061Leu) rs375158010
NM_018328.4(MBD5):c.3183G>A (p.Pro1061=) rs752275705
NM_018328.4(MBD5):c.321T>G (p.Ile107Met) rs1553517962
NM_018328.4(MBD5):c.3243T>A (p.Gly1081=) rs115816749
NM_018328.4(MBD5):c.3253G>A (p.Val1085Ile) rs199626531
NM_018328.4(MBD5):c.3266A>G (p.Tyr1089Cys)
NM_018328.4(MBD5):c.3279C>T (p.Val1093=) rs35692977
NM_018328.4(MBD5):c.3310A>G (p.Ile1104Val) rs115940994
NM_018328.4(MBD5):c.3355G>T (p.Ala1119Ser) rs373177231
NM_018328.4(MBD5):c.3385T>C (p.Ser1129Pro) rs200395037
NM_018328.4(MBD5):c.340_347delAAAAGCAT (p.Lys114Glyfs) rs794727928
NM_018328.4(MBD5):c.3436G>C (p.Gly1146Arg)
NM_018328.4(MBD5):c.3494G>A (p.Arg1165Gln) rs727503999
NM_018328.4(MBD5):c.3500C>T (p.Pro1167Leu) rs1057522316
NM_018328.4(MBD5):c.3539A>T (p.Asp1180Val) rs752035001
NM_018328.4(MBD5):c.3595G>A (p.Gly1199Arg) rs201334086
NM_018328.4(MBD5):c.3614G>T (p.Gly1205Val)
NM_018328.4(MBD5):c.3702C>T (p.Val1234=) rs144957555
NM_018328.4(MBD5):c.3739A>G (p.Ile1247Val) rs746105686
NM_018328.4(MBD5):c.379delA (p.Ser127Valfs) rs1553517984
NM_018328.4(MBD5):c.384C>T (p.Pro128=) rs753595652
NM_018328.4(MBD5):c.3867C>T (p.His1289=) rs1354346236
NM_018328.4(MBD5):c.3896G>A (p.Arg1299Gln) rs35934694
NM_018328.4(MBD5):c.3902T>C (p.Phe1301Ser) rs755983540
NM_018328.4(MBD5):c.397+1G>A rs1553517991
NM_018328.4(MBD5):c.3993A>C (p.Lys1331Asn) rs1553520621
NM_018328.4(MBD5):c.4032C>T (p.Ser1344=) rs777735514
NM_018328.4(MBD5):c.4033G>A (p.Val1345Ile) rs376249586
NM_018328.4(MBD5):c.4042T>C (p.Cys1348Arg)
NM_018328.4(MBD5):c.4101A>G (p.Pro1367=) rs1553520655
NM_018328.4(MBD5):c.4146G>A (p.Thr1382=) rs759890387
NM_018328.4(MBD5):c.4158C>T (p.Gly1386=) rs543329958
NM_018328.4(MBD5):c.4159G>A (p.Asp1387Asn) rs750381367
NM_018328.4(MBD5):c.4235C>A (p.Ser1412Ter)
NM_018328.4(MBD5):c.4236A>C (p.Ser1412=) rs149419174
NM_018328.4(MBD5):c.431C>T (p.Thr144Ile) rs1553518402
NM_018328.4(MBD5):c.440C>G (p.Ser147Ter) rs886041003
NM_018328.4(MBD5):c.4439G>A (p.Arg1480Lys)
NM_018328.4(MBD5):c.4455delC (p.Lys1486Asnfs) rs1060501151
NM_018328.4(MBD5):c.502T>C (p.Phe168Leu) rs1225184691
NM_018328.4(MBD5):c.55A>G (p.Ile19Val)
NM_018328.4(MBD5):c.599G>A (p.Arg200Gln) rs149278000
NM_018328.4(MBD5):c.606A>T (p.Arg202Ser) rs1553518446
NM_018328.4(MBD5):c.644G>A (p.Arg215His) rs771325235
NM_018328.4(MBD5):c.675G>A (p.Ala225=) rs775582219
NM_018328.4(MBD5):c.69G>A (p.Val23=) rs151204004
NM_018328.4(MBD5):c.718A>G (p.Arg240Gly) rs767317924
NM_018328.4(MBD5):c.763C>T (p.Pro255Ser) rs183855575
NM_018328.4(MBD5):c.796A>G (p.Ile266Val) rs568826753
NM_018328.4(MBD5):c.826C>T (p.Pro276Ser) rs376756158
NM_018328.4(MBD5):c.869C>G (p.Ala290Gly)
NM_018328.4(MBD5):c.884C>G (p.Thr295Ser) rs368339420
NM_018328.4(MBD5):c.890_891delTA (p.Ile297Thrfs) rs796052719
NM_018328.4(MBD5):c.924A>C (p.Pro308=) rs778385281
NM_018328.4(MBD5):c.935A>T (p.Lys312Ile) rs146031838
NM_018328.4(MBD5):c.961A>G (p.Met321Val) rs369869865
NM_018328.4(MBD5):c.974G>A (p.Arg325Gln) rs374866920
NM_018328.4(MBD5):c.980T>C (p.Met327Thr) rs776228346
NM_018328.4:c.2586_2667delATCTGTTCTTCAAGATGGCGTCATAGTCACCACTGCAGCTGGAAACCCACTGCAGAGTCAGCTACCCATTGGGAGTGATTTT
nsv513766

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.