ClinVar Miner

List of variants in gene MED12

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 425
Download table as spreadsheet
HGVS dbSNP
GRCh37/hg19 Xq13.1(chrX:70344802-70345036)x1
NC_000023.10:g.(?_70348964)_(70350064_?)dup
NC_000023.11:g.71118268G>A
NC_000023.11:g.71118549A>G
NC_000023.11:g.71119648C>T
NC_000023.11:g.71129143G>T
NC_000023.11:g.71132567T>C
NC_000023.11:g.71140611C>T
NM_005120.2(MED12):c.204+12_204+13delCT rs200301833
NM_005120.2(MED12):c.3355-16_3355-13delCTGT rs1556336608
NM_005120.2(MED12):c.3355-8dupT rs750373111
NM_005120.2(MED12):c.4416-20_4416-16delCTTCT rs56658066
NM_005120.2(MED12):c.4416-20_4416-16dupCTTCT rs56658066
NM_005120.2(MED12):c.4416-45_4416-16delCTTCTCTTCTCTTCTCTTCTCTTCTCTTCT rs56658066
NM_005120.2(MED12):c.6276_6278dup (p.Gln2115_His2116insGln) rs748394417
NM_005120.2(MED12):c.6300_6329del30 (p.Gln2106_Gln2115del) rs773480549
NM_005120.3(MED12):c.-28G>T rs373552360
NM_005120.3(MED12):c.-47A>T rs767078113
NM_005120.3(MED12):c.100-19C>T rs930154299
NM_005120.3(MED12):c.100-1_139del rs199469676
NM_005120.3(MED12):c.100-8T>A rs199469675
NM_005120.3(MED12):c.100_141del (p.Asp34_Asn47del) rs199469677
NM_005120.3(MED12):c.1028C>T (p.Ser343Leu) rs764107388
NM_005120.3(MED12):c.1030A>C (p.Thr344Pro) rs1556334571
NM_005120.3(MED12):c.1039A>G (p.Ser347Gly) rs752300879
NM_005120.3(MED12):c.103_138del (p.Glu35_Asn46del) rs199469678
NM_005120.3(MED12):c.1066C>A (p.Arg356=) rs763867883
NM_005120.3(MED12):c.107T>G (p.Leu36Arg) rs199469667
NM_005120.3(MED12):c.107_111delinsGC (p.Leu36_Thr37delinsArg) rs199469679
NM_005120.3(MED12):c.1101+18C>T rs200510424
NM_005120.3(MED12):c.1101+8_1101+9insCC rs1214824818
NM_005120.3(MED12):c.1102-136G>A
NM_005120.3(MED12):c.1113G>A (p.Leu371=)
NM_005120.3(MED12):c.111G>A (p.Thr37=) rs1057522480
NM_005120.3(MED12):c.111_155del (p.Ala38_Ser52del) rs199469681
NM_005120.3(MED12):c.113_121del (p.Ala38_Asn40del) rs199469682
NM_005120.3(MED12):c.1140C>T (p.His380=) rs753714929
NM_005120.3(MED12):c.1167G>A (p.Lys389=) rs374324656
NM_005120.3(MED12):c.117_122del (p.Asn40_Val41del) rs199469683
NM_005120.3(MED12):c.118_132del (p.Asn40_Gly44del) rs199469684
NM_005120.3(MED12):c.118_134delinsTA (p.Asn40_Phe45delinsTyr) rs199469680
NM_005120.3(MED12):c.118_146delinsTT (p.Asn40_Pro49delinsPhe) rs199469685
NM_005120.3(MED12):c.1203G>A (p.Pro401=)
NM_005120.3(MED12):c.1208A>G (p.Asn403Ser)
NM_005120.3(MED12):c.122_148del (p.Val41_Pro49del) rs199469686
NM_005120.3(MED12):c.122_163del (p.Val41_Asp54del) rs199469687
NM_005120.3(MED12):c.123_152del (p.Lys42_Val51del) rs199469688
NM_005120.3(MED12):c.1248+15T>C rs187377817
NM_005120.3(MED12):c.1253G>A (p.Arg418His) rs1431487428
NM_005120.3(MED12):c.1264C>T (p.Arg422Trp) rs368913305
NM_005120.3(MED12):c.1269G>A (p.Glu423=) rs758467351
NM_005120.3(MED12):c.126_131del (p.Lys42_Gly44delinsAsn) rs199469689
NM_005120.3(MED12):c.126_140del (p.Lys42_Asn46del) rs199469690
NM_005120.3(MED12):c.1273dup (p.Glu425fs) rs1556334780
NM_005120.3(MED12):c.128A>C (p.Gln43Pro) rs199469668
NM_005120.3(MED12):c.1290G>A (p.Glu430=) rs1556334791
NM_005120.3(MED12):c.129A>G (p.Gln43=) rs780634712
NM_005120.3(MED12):c.129_137del (p.Gln43_Asn46delinsHis) rs199469691
NM_005120.3(MED12):c.129_143del (p.Gly44_Gln48del) rs199469692
NM_005120.3(MED12):c.1300del (p.Ala434fs) rs1556334793
NM_005120.3(MED12):c.130G>A (p.Gly44Ser) rs199469669
NM_005120.3(MED12):c.130G>C (p.Gly44Arg) rs199469669
NM_005120.3(MED12):c.130G>T (p.Gly44Cys) rs199469669
NM_005120.3(MED12):c.1313G>A (p.Arg438His) rs587778439
NM_005120.3(MED12):c.131G>A (p.Gly44Asp) rs199469672
NM_005120.3(MED12):c.131G>C (p.Gly44Ala) rs199469672
NM_005120.3(MED12):c.131G>T (p.Gly44Val) rs199469672
NM_005120.3(MED12):c.1332C>T (p.Cys444=) rs746205041
NM_005120.3(MED12):c.133_144del (p.Phe45_Gln48del) rs199469693
NM_005120.3(MED12):c.1344T>G (p.Thr448=) rs375202766
NM_005120.3(MED12):c.1348+18G>A rs776024292
NM_005120.3(MED12):c.1349-11T>C rs775255445
NM_005120.3(MED12):c.1386G>T (p.Val462=) rs186153976
NM_005120.3(MED12):c.1416C>T (p.Asp472=) rs1569481100
NM_005120.3(MED12):c.1475A>G (p.Asp492Gly) rs1292888378
NM_005120.3(MED12):c.1485+5G>A
NM_005120.3(MED12):c.1485+6C>T rs565198403
NM_005120.3(MED12):c.1485+96A>G
NM_005120.3(MED12):c.149_163del (p.Ala50_Asp54del) rs199469694
NM_005120.3(MED12):c.1546C>T (p.Arg516Cys) rs1569481124
NM_005120.3(MED12):c.1547G>A (p.Arg516His) rs1556334969
NM_005120.3(MED12):c.1562G>A (p.Arg521His) rs875989806
NM_005120.3(MED12):c.1602G>A (p.Ala534=) rs1057523461
NM_005120.3(MED12):c.1618-8T>C rs1057522084
NM_005120.3(MED12):c.1619G>A (p.Arg540His)
NM_005120.3(MED12):c.1659C>T (p.Ile553=) rs763388314
NM_005120.3(MED12):c.1660G>A (p.Ala554Thr) rs863223709
NM_005120.3(MED12):c.1671C>T (p.Ser557=) rs1556335123
NM_005120.3(MED12):c.1682C>T (p.Pro561Leu) rs766485358
NM_005120.3(MED12):c.1695T>A (p.Ile565=) rs138984044
NM_005120.3(MED12):c.1732G>C (p.Ala578Pro) rs1131691350
NM_005120.3(MED12):c.1744+14C>T rs1263378137
NM_005120.3(MED12):c.1744+4C>T rs780750721
NM_005120.3(MED12):c.1744+51A>G
NM_005120.3(MED12):c.1744+5G>A rs368353373
NM_005120.3(MED12):c.1745-19C>T rs1057524262
NM_005120.3(MED12):c.1754G>A (p.Arg585Gln) rs747113641
NM_005120.3(MED12):c.1807C>T (p.Leu603=) rs797045696
NM_005120.3(MED12):c.183C>T (p.Asn61=) rs770411750
NM_005120.3(MED12):c.1849A>G (p.Thr617Ala) rs765417606
NM_005120.3(MED12):c.184G>A (p.Val62Ile) rs1039763693
NM_005120.3(MED12):c.1862G>A (p.Arg621Gln) rs1057519381
NM_005120.3(MED12):c.1892C>T (p.Pro631Leu) rs1057524167
NM_005120.3(MED12):c.1924G>A (p.Asp642Asn) rs1556335288
NM_005120.3(MED12):c.1929C>T (p.Asp643=) rs758195942
NM_005120.3(MED12):c.1956C>T (p.Ser652=) rs199873151
NM_005120.3(MED12):c.1963A>G (p.Ser655Gly) rs1569481250
NM_005120.3(MED12):c.1974+93G>C
NM_005120.3(MED12):c.1975-5C>T rs200891932
NM_005120.3(MED12):c.2023C>T (p.Leu675Phe) rs1307587368
NM_005120.3(MED12):c.204+13T>G rs901178143
NM_005120.3(MED12):c.205-38C>T rs12850852
NM_005120.3(MED12):c.2056-20C>T rs1057521831
NM_005120.3(MED12):c.2056-63G>T
NM_005120.3(MED12):c.2068A>G (p.Thr690Ala) rs878854752
NM_005120.3(MED12):c.2093G>A (p.Ser698Asn) rs863223710
NM_005120.3(MED12):c.2118C>T (p.Val706=) rs1346228842
NM_005120.3(MED12):c.2128G>A (p.Val710Met) rs797045697
NM_005120.3(MED12):c.2136C>T (p.Pro712=) rs377207665
NM_005120.3(MED12):c.2169G>A (p.Gly723=) rs1060504497
NM_005120.3(MED12):c.2220C>T (p.Ile740=) rs370195616
NM_005120.3(MED12):c.2227-4G>A
NM_005120.3(MED12):c.2252A>G (p.Asn751Ser) rs863223700
NM_005120.3(MED12):c.2259G>A (p.Arg753=) rs61752446
NM_005120.3(MED12):c.2271G>A (p.Leu757=)
NM_005120.3(MED12):c.2274T>C (p.Phe758=) rs779918145
NM_005120.3(MED12):c.2308G>A (p.Ala770Thr) rs199860580
NM_005120.3(MED12):c.2383C>T (p.Pro795Ser)
NM_005120.3(MED12):c.2422+120T>G
NM_005120.3(MED12):c.2422+30C>T rs2075790
NM_005120.3(MED12):c.2422+6T>G rs1569481413
NM_005120.3(MED12):c.2444G>A (p.Arg815Gln) rs762905361
NM_005120.3(MED12):c.2450G>A (p.Arg817His)
NM_005120.3(MED12):c.2545T>C (p.Ser849Pro) rs1135401775
NM_005120.3(MED12):c.2571G>A (p.Thr857=)
NM_005120.3(MED12):c.2571G>C (p.Thr857=) rs368090262
NM_005120.3(MED12):c.2613G>A (p.Gln871=) rs372344160
NM_005120.3(MED12):c.272G>T (p.Arg91Leu) rs1057524478
NM_005120.3(MED12):c.2748C>A (p.Gly916=) rs768686458
NM_005120.3(MED12):c.2750G>A (p.Ser917Asn) rs1556336129
NM_005120.3(MED12):c.27C>T (p.Tyr9=) rs376743527
NM_005120.3(MED12):c.281C>T (p.Pro94Leu)
NM_005120.3(MED12):c.2849+14C>T rs398124196
NM_005120.3(MED12):c.2850-7C>G rs1556336208
NM_005120.3(MED12):c.2867A>G (p.Lys956Arg) rs1569481527
NM_005120.3(MED12):c.2873G>A (p.Gly958Glu) rs397515554
NM_005120.3(MED12):c.2881C>T (p.Arg961Trp) rs80338758
NM_005120.3(MED12):c.2886C>T (p.Ser962=) rs34761462
NM_005120.3(MED12):c.2895C>T (p.Ser965=) rs1060504496
NM_005120.3(MED12):c.2981+13G>A rs73214870
NM_005120.3(MED12):c.2982C>T (p.Ser994=) rs886039139
NM_005120.3(MED12):c.2990G>A (p.Cys997Tyr) rs1556336381
NM_005120.3(MED12):c.3009C>A (p.Thr1003=) rs375493995
NM_005120.3(MED12):c.3020A>G (p.Asn1007Ser) rs80338759
NM_005120.3(MED12):c.3063C>A (p.Phe1021Leu) rs797045698
NM_005120.3(MED12):c.3063C>T (p.Phe1021=) rs797045698
NM_005120.3(MED12):c.3067A>G (p.Ile1023Val) rs879255526
NM_005120.3(MED12):c.3110C>T (p.Thr1037Met)
NM_005120.3(MED12):c.3125G>A (p.Ser1042Asn) rs1556336419
NM_005120.3(MED12):c.3204C>T (p.Pro1068=) rs201807437
NM_005120.3(MED12):c.3210-27C>T rs752463122
NM_005120.3(MED12):c.3210G>T (p.Arg1070Ser) rs863223704
NM_005120.3(MED12):c.3219C>T (p.Asp1073=) rs1266845318
NM_005120.3(MED12):c.3222C>T (p.Ile1074=) rs374156594
NM_005120.3(MED12):c.3231G>T (p.Leu1077=) rs1556336518
NM_005120.3(MED12):c.3303C>G (p.Cys1101Trp) rs1556336534
NM_005120.3(MED12):c.3354+26A>G rs749625903
NM_005120.3(MED12):c.3354+27G>C rs5030617
NM_005120.3(MED12):c.3354+54G>A
NM_005120.3(MED12):c.3354+6A>G rs770027742
NM_005120.3(MED12):c.3355-16C>G
NM_005120.3(MED12):c.3357C>T (p.Val1119=) rs773679943
NM_005120.3(MED12):c.3412C>A (p.Arg1138=) rs1057523906
NM_005120.3(MED12):c.3413G>A (p.Arg1138Gln) rs869312960
NM_005120.3(MED12):c.3443G>A (p.Arg1148His) rs387907360
NM_005120.3(MED12):c.3443G>T (p.Arg1148Leu) rs387907360
NM_005120.3(MED12):c.3456C>T (p.Ile1152=) rs1556336642
NM_005120.3(MED12):c.3493T>C (p.Ser1165Pro) rs387907361
NM_005120.3(MED12):c.3498G>A (p.Glu1166=) rs1556336751
NM_005120.3(MED12):c.3516C>A (p.Thr1172=) rs1057521581
NM_005120.3(MED12):c.3516C>G (p.Thr1172=) rs1057521581
NM_005120.3(MED12):c.3577+17T>G rs1057523979
NM_005120.3(MED12):c.3577+9C>A rs1556336775
NM_005120.3(MED12):c.3582G>A (p.Lys1194=) rs1060504499
NM_005120.3(MED12):c.3587C>A (p.Thr1196Lys) rs1556336812
NM_005120.3(MED12):c.3667G>A (p.Val1223Ile) rs1057524217
NM_005120.3(MED12):c.3670C>G (p.Leu1224Val) rs1057519912
NM_005120.3(MED12):c.3670C>T (p.Leu1224Phe) rs1057519912
NM_005120.3(MED12):c.3691+4C>T rs373381746
NM_005120.3(MED12):c.3693G>T (p.Gly1231=)
NM_005120.3(MED12):c.3699G>A (p.Ala1233=) rs184162709
NM_005120.3(MED12):c.369C>T (p.Thr123=)
NM_005120.3(MED12):c.3721A>G (p.Thr1241Ala)
NM_005120.3(MED12):c.3745C>T (p.Leu1249Phe) rs1422779785
NM_005120.3(MED12):c.3762_3764AGG[1] (p.Gly1257del)
NM_005120.3(MED12):c.3769G>A (p.Gly1257Ser)
NM_005120.3(MED12):c.3785G>A (p.Arg1262Lys) rs202120461
NM_005120.3(MED12):c.3796C>T (p.Arg1266Cys) rs1060502168
NM_005120.3(MED12):c.3797G>A (p.Arg1266His) rs587780391
NM_005120.3(MED12):c.3801C>T (p.Asn1267=) rs1057520418
NM_005120.3(MED12):c.380C>T (p.Thr127Met) rs775072642
NM_005120.3(MED12):c.381G>A (p.Thr127=) rs202125318
NM_005120.3(MED12):c.3843C>T (p.Tyr1281=) rs369268877
NM_005120.3(MED12):c.3844G>A (p.Val1282Met) rs398124197
NM_005120.3(MED12):c.3849G>T (p.Leu1283=) rs377409217
NM_005120.3(MED12):c.384A>G (p.Gln128=) rs201566660
NM_005120.3(MED12):c.3868-7T>A rs587780392
NM_005120.3(MED12):c.3883C>T (p.Arg1295Cys) rs863223706
NM_005120.3(MED12):c.3884G>A (p.Arg1295His) rs1556337063
NM_005120.3(MED12):c.3918C>T (p.Asp1306=)
NM_005120.3(MED12):c.3928_3930delinsTCC (p.Pro1310Ser) rs863223712
NM_005120.3(MED12):c.3930A>C (p.Pro1310=) rs5030619
NM_005120.3(MED12):c.3942T>C (p.Ser1314=) rs3810670
NM_005120.3(MED12):c.3948G>A (p.Gln1316=) rs1359267668
NM_005120.3(MED12):c.3968T>C (p.Leu1323Pro) rs1556337085
NM_005120.3(MED12):c.397-12A>G rs192515277
NM_005120.3(MED12):c.397-12A>T rs192515277
NM_005120.3(MED12):c.3979C>A (p.Pro1327Thr) rs1569481764
NM_005120.3(MED12):c.3989T>G (p.Leu1330Arg) rs797045699
NM_005120.3(MED12):c.4009G>A (p.Glu1337Lys) rs1057520129
NM_005120.3(MED12):c.4021C>T (p.Arg1341Trp) rs777250096
NM_005120.3(MED12):c.4028G>A (p.Arg1343His) rs201044355
NM_005120.3(MED12):c.4041T>C (p.Ile1347=) rs769884032
NM_005120.3(MED12):c.4047+14G>A rs774488297
NM_005120.3(MED12):c.4047+223A>G
NM_005120.3(MED12):c.4048-12C>T rs1556337459
NM_005120.3(MED12):c.4111C>T (p.Pro1371Ser) rs587778437
NM_005120.3(MED12):c.4115A>G (p.Asn1372Ser) rs202009066
NM_005120.3(MED12):c.4120-12C>T rs1556337617
NM_005120.3(MED12):c.4146C>T (p.Ile1382=) rs923552252
NM_005120.3(MED12):c.4147G>A (p.Ala1383Thr) rs863223696
NM_005120.3(MED12):c.4154C>T (p.Ala1385Val) rs771349148
NM_005120.3(MED12):c.4159A>G (p.Ile1387Val) rs1366165823
NM_005120.3(MED12):c.4161C>T (p.Ile1387=) rs776947543
NM_005120.3(MED12):c.4179A>C (p.Ser1393=) rs376058351
NM_005120.3(MED12):c.4231A>G (p.Ser1411Gly)
NM_005120.3(MED12):c.4238C>A (p.Thr1413Asn) rs759532414
NM_005120.3(MED12):c.4253+4G>A rs750162341
NM_005120.3(MED12):c.4265G>A (p.Arg1422His) rs1255849432
NM_005120.3(MED12):c.4299T>C (p.Ala1433=) rs763359998
NM_005120.3(MED12):c.4342G>A (p.Gly1448Arg) rs1057518921
NM_005120.3(MED12):c.4372G>C (p.Gly1458Arg) rs863223698
NM_005120.3(MED12):c.438A>G (p.Leu146=) rs35068602
NM_005120.3(MED12):c.4415+128A>G
NM_005120.3(MED12):c.4415+29T>C rs10521349
NM_005120.3(MED12):c.4416-43_4416-14del rs1556337864
NM_005120.3(MED12):c.4416-48T>C rs12849277
NM_005120.3(MED12):c.4416-77CTCTT[16] rs56658066
NM_005120.3(MED12):c.4416-77CTCTT[7] rs56658066
NM_005120.3(MED12):c.4416-77CTCTT[8] rs56658066
NM_005120.3(MED12):c.4425A>G (p.Leu1475=) rs370211858
NM_005120.3(MED12):c.4428G>A (p.Leu1476=)
NM_005120.3(MED12):c.4470A>G (p.Lys1490=) rs766138859
NM_005120.3(MED12):c.4488C>T (p.Arg1496=) rs531754497
NM_005120.3(MED12):c.4505C>G (p.Ser1502Cys) rs1369442321
NM_005120.3(MED12):c.4528-19T>C rs370859385
NM_005120.3(MED12):c.4620G>A (p.Val1540=) rs756385578
NM_005120.3(MED12):c.4650C>T (p.Ser1550=) rs886039075
NM_005120.3(MED12):c.4651A>G (p.Thr1551Ala)
NM_005120.3(MED12):c.4665G>A (p.Thr1555=) rs375001801
NM_005120.3(MED12):c.4669T>C (p.Trp1557Arg) rs794727576
NM_005120.3(MED12):c.4711G>A (p.Asp1571Asn)
NM_005120.3(MED12):c.4725C>A (p.Asn1575Lys) rs1556338296
NM_005120.3(MED12):c.473G>A (p.Trp158Ter) rs1556334114
NM_005120.3(MED12):c.4806G>T (p.Ser1602=) rs755218771
NM_005120.3(MED12):c.4831C>G (p.Arg1611Gly) rs727503868
NM_005120.3(MED12):c.4831C>T (p.Arg1611Cys) rs727503868
NM_005120.3(MED12):c.4832G>A (p.Arg1611His) rs1569482153
NM_005120.3(MED12):c.4851G>A (p.Ala1617=) rs377210068
NM_005120.3(MED12):c.4863+15C>T rs778076528
NM_005120.3(MED12):c.4864-6C>T rs1018026145
NM_005120.3(MED12):c.4870T>G (p.Leu1624Val) rs766406937
NM_005120.3(MED12):c.4880G>A (p.Arg1627His) rs759857680
NM_005120.3(MED12):c.492T>C (p.Cys164=) rs886039163
NM_005120.3(MED12):c.4950G>A (p.Thr1650=) rs756839501
NM_005120.3(MED12):c.4971T>C (p.Leu1657=) rs398124198
NM_005120.3(MED12):c.4974C>T (p.Ile1658=) rs376179450
NM_005120.3(MED12):c.5017_5019AAG[1] (p.Lys1674del)
NM_005120.3(MED12):c.5025+156_5025+157del
NM_005120.3(MED12):c.5026-12T>A rs1057520901
NM_005120.3(MED12):c.5026-17T>C rs1556338729
NM_005120.3(MED12):c.5026-189G>C
NM_005120.3(MED12):c.5026-249A>T
NM_005120.3(MED12):c.503C>T (p.Ala168Val)
NM_005120.3(MED12):c.5088G>A (p.Pro1696=) rs202167558
NM_005120.3(MED12):c.5092G>A (p.Ala1698Thr) rs1556338747
NM_005120.3(MED12):c.5103T>C (p.Ser1701=) rs762801267
NM_005120.3(MED12):c.5125C>T (p.Arg1709Ter) rs886041581
NM_005120.3(MED12):c.5135_5138dup (p.Val1714fs) rs1556338764
NM_005120.3(MED12):c.5185C>A (p.His1729Asn) rs387907362
NM_005120.3(MED12):c.5190G>C (p.Leu1730=) rs753355369
NM_005120.3(MED12):c.5192G>A (p.Arg1731Lys) rs1569482278
NM_005120.3(MED12):c.5205C>T (p.Arg1735=) rs747836622
NM_005120.3(MED12):c.5252C>T (p.Pro1751Leu) rs748064846
NM_005120.3(MED12):c.5253G>A (p.Pro1751=) rs770067057
NM_005120.3(MED12):c.5258C>T (p.Ala1753Val) rs1246253918
NM_005120.3(MED12):c.5266C>T (p.Leu1756=) rs1556338815
NM_005120.3(MED12):c.5267T>C (p.Leu1756Pro)
NM_005120.3(MED12):c.5316G>A (p.Pro1772=) rs398124199
NM_005120.3(MED12):c.5336C>T (p.Thr1779Ile) rs1556338856
NM_005120.3(MED12):c.5345G>A (p.Arg1782His) rs1060502167
NM_005120.3(MED12):c.5360C>G (p.Thr1787Ser)
NM_005120.3(MED12):c.5400+6C>T rs192656109
NM_005120.3(MED12):c.5400+7G>A rs201254124
NM_005120.3(MED12):c.5401-25C>T rs41298482
NM_005120.3(MED12):c.5401-87T>C
NM_005120.3(MED12):c.5418G>A (p.Pro1806=) rs770957462
NM_005120.3(MED12):c.5423G>A (p.Arg1808Gln)
NM_005120.3(MED12):c.5427C>T (p.Ser1809=) rs772462354
NM_005120.3(MED12):c.5442G>C (p.Val1814=) rs773540568
NM_005120.3(MED12):c.5476C>T (p.Pro1826Ser) rs867576281
NM_005120.3(MED12):c.5490A>C (p.Thr1830=) rs762466624
NM_005120.3(MED12):c.5510G>C (p.Gly1837Ala) rs200328506
NM_005120.3(MED12):c.553+12C>G rs1556334127
NM_005120.3(MED12):c.553+302C>G
NM_005120.3(MED12):c.5535C>T (p.Asn1845=) rs34784349
NM_005120.3(MED12):c.554-83A>G
NM_005120.3(MED12):c.5563G>A (p.Val1855Met) rs1085307774
NM_005120.3(MED12):c.5585G>A (p.Arg1862His) rs773713291
NM_005120.3(MED12):c.5593A>G (p.Met1865Val) rs587778438
NM_005120.3(MED12):c.5602C>G (p.Leu1868Val)
NM_005120.3(MED12):c.5616A>G (p.Pro1872=) rs750250372
NM_005120.3(MED12):c.5650G>A (p.Gly1884Ser) rs147354926
NM_005120.3(MED12):c.5653G>A (p.Val1885Ile)
NM_005120.3(MED12):c.5655C>T (p.Val1885=) rs1556339100
NM_005120.3(MED12):c.5659G>A (p.Gly1887Ser) rs758621985
NM_005120.3(MED12):c.568A>G (p.Ile190Val) rs374780236
NM_005120.3(MED12):c.5709T>A (p.Pro1903=)
NM_005120.3(MED12):c.5711C>T (p.Ala1904Val) rs200663107
NM_005120.3(MED12):c.5712G>A (p.Ala1904=) rs189962028
NM_005120.3(MED12):c.5748+16G>T rs199760183
NM_005120.3(MED12):c.5775A>G (p.Ser1925=) rs376753995
NM_005120.3(MED12):c.5779G>A (p.Val1927Ile) rs1556339193
NM_005120.3(MED12):c.5805C>T (p.Ser1935=) rs201608537
NM_005120.3(MED12):c.5898dup (p.Ser1967fs) rs879255527
NM_005120.3(MED12):c.5920C>T (p.Gln1974Ter) rs1569482431
NM_005120.3(MED12):c.5922G>T (p.Gln1974His) rs879255528
NM_005120.3(MED12):c.5957A>C (p.Asp1986Ala) rs1064796982
NM_005120.3(MED12):c.5980C>T (p.Arg1994Trp) rs1556339256
NM_005120.3(MED12):c.5989G>T (p.Gly1997Cys) rs1556339260
NM_005120.3(MED12):c.6017A>C (p.Tyr2006Ser) rs769232520
NM_005120.3(MED12):c.6044+16G>C rs367904425
NM_005120.3(MED12):c.6045-24C>T rs140083803
NM_005120.3(MED12):c.6072A>T (p.Thr2024=) rs200692655
NM_005120.3(MED12):c.6097A>G (p.Met2033Val) rs372606012
NM_005120.3(MED12):c.6103G>A (p.Ala2035Thr)
NM_005120.3(MED12):c.6121G>A (p.Gly2041Ser) rs901541873
NM_005120.3(MED12):c.6139A>G (p.Ile2047Val) rs748668603
NM_005120.3(MED12):c.6150_6152GCA[4] (p.Gln2075_Gln2076del) rs769857818
NM_005120.3(MED12):c.6150_6152GCA[7] (p.Gln2076dup)
NM_005120.3(MED12):c.6168A>G (p.Gln2056=) rs745565325
NM_005120.3(MED12):c.616C>G (p.Arg206Gly) rs1556334331
NM_005120.3(MED12):c.6177_6182ACAGCA[1] (p.Gln2075_Gln2076del)
NM_005120.3(MED12):c.6177_6182ACAGCA[3] (p.Gln2075_Gln2076dup) rs753370104
NM_005120.3(MED12):c.6177_6191del (p.Gln2072_Gln2076del) rs767827315
NM_005120.3(MED12):c.6177_6200ACAGCAACAGCAGCAGCAGCAGCA[1] (p.Gln2069_Gln2076del) rs773709991
NM_005120.3(MED12):c.6186_6188GCA[3] (p.Gln2075_Gln2076del) rs754533796
NM_005120.3(MED12):c.6186_6188GCA[6] (p.Gln2076dup) rs754533796
NM_005120.3(MED12):c.6201A>G (p.Gln2067=) rs375793297
NM_005120.3(MED12):c.6204G>A (p.Gln2068=) rs1283568825
NM_005120.3(MED12):c.6208_6210CAG[6] (p.Gln2076del) rs757160341
NM_005120.3(MED12):c.6208_6210CAG[8] (p.Gln2076dup) rs757160341
NM_005120.3(MED12):c.6208_6210CAG[9] (p.Gln2075_Gln2076dup) rs757160341
NM_005120.3(MED12):c.6235A>G (p.Ile2079Val) rs200820997
NM_005120.3(MED12):c.6239G>A (p.Arg2080Gln)
NM_005120.3(MED12):c.6241_6243CAG[5] (p.Gln2086del) rs786200971
NM_005120.3(MED12):c.6241_6243CAG[7] (p.Gln2086dup) rs786200971
NM_005120.3(MED12):c.6267+166G>A rs1247198443
NM_005120.3(MED12):c.6267+20T>C rs1032542640
NM_005120.3(MED12):c.6268-4A>G rs780580344
NM_005120.3(MED12):c.6273G>A (p.Gln2091=) rs1556340048
NM_005120.3(MED12):c.6273_6278dup (p.Gln2115_His2116insGlnGln)
NM_005120.3(MED12):c.6279A>G (p.Gln2093=) rs1050062166
NM_005120.3(MED12):c.6279_6284ACAGCA[3] (p.Gln2114_Gln2115dup) rs761195801
NM_005120.3(MED12):c.6285A>G (p.Gln2095=) rs794727673
NM_005120.3(MED12):c.6288_6290GCA[10] (p.Gln2113_Gln2115dup) rs766775649
NM_005120.3(MED12):c.6288_6290GCA[5] (p.Gln2114_Gln2115del) rs766775649
NM_005120.3(MED12):c.6288_6290GCA[6] (p.Gln2115del) rs766775649
NM_005120.3(MED12):c.6288_6290GCA[8] (p.Gln2115dup) rs766775649
NM_005120.3(MED12):c.6288_6290GCA[9] (p.Gln2114_Gln2115dup) rs766775649
NM_005120.3(MED12):c.628G>C (p.Ala210Pro) rs1379201163
NM_005120.3(MED12):c.6291G>A (p.Gln2097=) rs756285149
NM_005120.3(MED12):c.6294G>A (p.Gln2098=) rs1408739478
NM_005120.3(MED12):c.6297G>A (p.Gln2099=) rs1480313864
NM_005120.3(MED12):c.6300G>A (p.Gln2100=) rs1556340080
NM_005120.3(MED12):c.6303G>A (p.Gln2101=) rs1490399010
NM_005120.3(MED12):c.6309_6314ACAGCA[1] (p.Gln2114_Gln2115del) rs764789036
NM_005120.3(MED12):c.6309_6314ACAGCA[3] (p.Gln2114_Gln2115dup) rs764789036
NM_005120.3(MED12):c.6318_6320GCA[5] (p.Gln2115dup) rs1168018409
NM_005120.3(MED12):c.6321G>A (p.Gln2107=) rs778103349
NM_005120.3(MED12):c.6321_6335del (p.Gln2111_Gln2115del) rs727503869
NM_005120.3(MED12):c.6324G>A (p.Gln2108=) rs749807888
NM_005120.3(MED12):c.6326A>C (p.Gln2109Pro) rs755793630
NM_005120.3(MED12):c.6327G>A (p.Gln2109=) rs1333460909
NM_005120.3(MED12):c.6333G>A (p.Gln2111=) rs1556340108
NM_005120.3(MED12):c.6336_6362del (p.Gln2115_Gln2123del) rs1353930135
NM_005120.3(MED12):c.6339A>G (p.Gln2113=) rs757508922
NM_005120.3(MED12):c.6348_6359dup (p.His2116_Gln2119dup) rs398124200
NM_005120.3(MED12):c.6351G>A (p.Gln2117=) rs1175039083
NM_005120.3(MED12):c.6358C>T (p.Gln2120Ter) rs1556340124
NM_005120.3(MED12):c.6408+16C>T rs1057522248
NM_005120.3(MED12):c.6409-114T>C
NM_005120.3(MED12):c.6409-125T>C
NM_005120.3(MED12):c.6409-14C>A rs374791085
NM_005120.3(MED12):c.6422G>A (p.Gly2141Glu) rs1556340261
NM_005120.3(MED12):c.6443A>G (p.Gln2148Arg) rs1569482852
NM_005120.3(MED12):c.6476A>C (p.Gln2159Pro) rs1085307941
NM_005120.3(MED12):c.6491-58G>A
NM_005120.3(MED12):c.6526C>T (p.Arg2176Cys) rs777818556
NM_005120.3(MED12):c.653C>T (p.Thr218Met) rs369083173
NM_005120.3(MED12):c.701A>T (p.Asp234Val) rs927746681
NM_005120.3(MED12):c.708C>G (p.Thr236=) rs34668206
NM_005120.3(MED12):c.708C>T (p.Thr236=) rs34668206
NM_005120.3(MED12):c.727A>C (p.Met243Leu)
NM_005120.3(MED12):c.734A>G (p.Gln245Arg) rs1569480972
NM_005120.3(MED12):c.735+15A>G rs202206536
NM_005120.3(MED12):c.736-14C>G rs373707149
NM_005120.3(MED12):c.736-4A>G rs371311763
NM_005120.3(MED12):c.736-8A>C rs62609586
NM_005120.3(MED12):c.817C>T (p.Leu273Phe)
NM_005120.3(MED12):c.845G>A (p.Arg282Gln) rs1278775881
NM_005120.3(MED12):c.872C>A (p.Ala291Glu) rs754533515
NM_005120.3(MED12):c.887G>A (p.Arg296Gln) rs1556334519
NM_005120.3(MED12):c.934G>C (p.Val312Leu) rs377403264
NM_005120.3(MED12):c.93G>C (p.Gln31His) rs1057521988

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.