ClinVar Miner

List of variants in gene MSH2

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 3185
Download table as spreadsheet
HGVS dbSNP
MSH2, 19.28-KB DEL
MSH2, 24-BP INS
MSH2, 3.5-KB DEL AND 15-BP INS
MSH2, 32-KB DEL, EX1-6
MSH2, DEL 50 CODONS
MSH2, EX1-6 DEL
NC_000002.11:g.(?_47630331)_(47643568_?)dup
NC_000002.11:g.(?_47641408)_(47710088_?)del
NC_000002.11:g.(?_47641519)_(47672796_?)del
NC_000002.11:g.(?_47702164)_(47710085_?)del
NC_000002.11:g.(?_47702164)_(47710088_?)del
NC_000002.12:g.(?_47403067)_(47403402_?)del
NC_000002.12:g.(?_47403067)_(47408555_?)del
NC_000002.12:g.(?_47403067)_(47483228_?)del
NC_000002.12:g.(?_47403182)_(47403412_?)del
NC_000002.12:g.(?_47403182)_(47408565_?)del
NC_000002.12:g.(?_47403182)_(47414428_?)del
NC_000002.12:g.(?_47403182)_(47416439_?)del
NC_000002.12:g.(?_47403186)_(47410378_?)del
NC_000002.12:g.(?_47403186)_(47429947_?)del
NC_000002.12:g.(?_47408391)_(47482959_?)dup
NC_000002.12:g.(?_47408395)_(47414424_?)del
NC_000002.12:g.(?_47408395)_(47429947_?)del
NC_000002.12:g.(?_47408395)_(47429947_?)dup
NC_000002.12:g.(?_47410088)_(47412566_?)del
NC_000002.12:g.(?_47412414)_(47483228_?)del
NC_000002.12:g.(?_47414259)_(47429951_?)dup
NC_000002.12:g.(?_47414263)_(47429947_?)dup
NC_000002.12:g.(?_47429736)_(47445663_?)del
NC_000002.12:g.(?_47429736)_(47466814_?)del
NC_000002.12:g.(?_47429736)_(47482955_?)dup
NC_000002.12:g.(?_47463025)_(47475276_?)del
NC_000002.12:g.(?_47470959)_(47482955_?)del
NC_000002.12:g.(?_47470965)_(47483228_?)dup
NC_000002.12:g.(?_47475019)_(47480877_?)del
NC_000002.12:g.(?_47478262)_(47478529_?)del
NC_000002.12:g.(?_47478262)_(47480881_?)del
NC_000002.12:g.(?_47478262)_(47482959_?)del
NC_000002.12:g.(?_47478266)_(47478525_?)del
NC_000002.12:g.(?_47478266)_(47482955_?)del
NC_000002.12:g.(?_47482779)_(47482949_?)del
NC_000002.12:g.47475254delG
NG_007110.2:g.114262C>T rs72888274
NG_007110.2:g.114271G>A rs116117580
NG_007110.2:g.114289A>G rs2303424
NM_000251.1(MSH2):c.(?_-68)_(*272_?)del
NM_000251.1(MSH2):c.-11844_1077-6021delins155
NM_000251.1(MSH2):c.-1753_645+922del
NM_000251.1(MSH2):c.-35298_1276+5697del
NM_000251.1(MSH2):c.-47156_1277-4980del
NM_000251.1(MSH2):c.-4729_367-353del
NM_000251.1(MSH2):c.-75398_1759+1708del
NM_000251.1(MSH2):c.-823_1076+5984del
NM_000251.1(MSH2):c.-956_1077-5607del
NM_000251.1(MSH2):c.11dupA (p.Pro5Alafs) rs730881775
NM_000251.1(MSH2):c.1276+232_1386+3798del
NM_000251.1(MSH2):c.1387-3976_1662-364del
NM_000251.1(MSH2):c.1662-374_2458+467del
NM_000251.1(MSH2):c.1759+305_2006-34del
NM_000251.1(MSH2):c.1760-361_2634+838del
NM_000251.1(MSH2):c.211+1566_1277-3954del
NM_000251.1(MSH2):c.2210+116_2562del
NM_000251.1(MSH2):c.367-371_646-513del
NM_000251.1(MSH2):c.367-452_646-722del
NM_000251.1(MSH2):c.367-681_646-956del
NM_000251.1(MSH2):c.645+539_1077-3451del
NM_000251.1(MSH2):c.645+791_1076+4894del
NM_000251.1(MSH2):c.645+967_1076+5075del
NM_000251.1(MSH2):c.792+8_943-450del
NM_000251.1(MSH2):c.943-926_1077-1449del
NM_000251.1(MSH2):c.972_973insNM_002133.2:c.737-1292_737-1109
NM_000251.2(MSH2):c.(1661+1_1662-1)_(*1_?)del
NM_000251.2(MSH2):c.(?_-1)_1076+?del
NM_000251.2(MSH2):c.(?_-68)_1076+?del
NM_000251.2(MSH2):c.(?_-68)_1076+?dup
NM_000251.2(MSH2):c.(?_-68)_1276+?del
NM_000251.2(MSH2):c.(?_-68)_1386+?del
NM_000251.2(MSH2):c.(?_-68)_1661+?del
NM_000251.2(MSH2):c.(?_-68)_1759+?del
NM_000251.2(MSH2):c.(?_-68)_211+?del
NM_000251.2(MSH2):c.(?_-68)_2634+?del
NM_000251.2(MSH2):c.(?_-68)_366+?del
NM_000251.2(MSH2):c.(?_-68)_645+?del
NM_000251.2(MSH2):c.(?_-68)_645+?dup
NM_000251.2(MSH2):c.(?_-68)_792+?del
NM_000251.2(MSH2):c.(?_-68)_942+?del
NM_000251.2(MSH2):c.*10_*12delGTA rs764232113
NM_000251.2(MSH2):c.*129T>C rs587779059
NM_000251.2(MSH2):c.*141T>G rs17225053
NM_000251.2(MSH2):c.*19T>C
NM_000251.2(MSH2):c.*221G>T rs587779060
NM_000251.2(MSH2):c.*226A>G rs17225060
NM_000251.2(MSH2):c.*251+2441A>C rs6544991
NM_000251.2(MSH2):c.*251+4080G>A rs6720549
NM_000251.2(MSH2):c.*387C>A rs104895028
NM_000251.2(MSH2):c.*392G>A rs104895029
NM_000251.2(MSH2):c.*4delA
NM_000251.2(MSH2):c.*52A>T rs886056138
NM_000251.2(MSH2):c.*61T>A rs104895027
NM_000251.2(MSH2):c.*7C>G rs886056137
NM_000251.2(MSH2):c.*95C>T rs587779062
NM_000251.2(MSH2):c.-10_-8delAGG rs1064795833
NM_000251.2(MSH2):c.-118T>C rs2303425
NM_000251.2(MSH2):c.-11G>A rs1057524512
NM_000251.2(MSH2):c.-11G>C rs1057524512
NM_000251.2(MSH2):c.-125_1076+?del
NM_000251.2(MSH2):c.-125_1076+?dup1201
NM_000251.2(MSH2):c.-125_645+?del
NM_000251.2(MSH2):c.-12G>A
NM_000251.2(MSH2):c.-13A>T rs1057524722
NM_000251.2(MSH2):c.-140G>T rs587781274
NM_000251.2(MSH2):c.-14G>C rs1064793750
NM_000251.2(MSH2):c.-15T>G rs1364049260
NM_000251.2(MSH2):c.-185C>A rs188036046
NM_000251.2(MSH2):c.-18A>G rs759730085
NM_000251.2(MSH2):c.-192A>C rs876660477
NM_000251.2(MSH2):c.-1C>T rs876658229
NM_000251.2(MSH2):c.-22C>T rs770870694
NM_000251.2(MSH2):c.-23C>G rs368949534
NM_000251.2(MSH2):c.-29C>T rs199841800
NM_000251.2(MSH2):c.-2A>C rs906564011
NM_000251.2(MSH2):c.-30delT rs766903439
NM_000251.2(MSH2):c.-34A>C rs1064795886
NM_000251.2(MSH2):c.-35C>T rs1288448348
NM_000251.2(MSH2):c.-36G>C rs771263105
NM_000251.2(MSH2):c.-37C>T rs1057521593
NM_000251.2(MSH2):c.-39C>T rs768044277
NM_000251.2(MSH2):c.-3G>C rs587779960
NM_000251.2(MSH2):c.-42G>A rs748885234
NM_000251.2(MSH2):c.-43G>C rs781492698
NM_000251.2(MSH2):c.-44G>A rs1064793507
NM_000251.2(MSH2):c.-48G>C rs751932753
NM_000251.2(MSH2):c.-4C>T rs1376741577
NM_000251.2(MSH2):c.-5T>G rs1553348652
NM_000251.2(MSH2):c.-68-101T>C rs112804395
NM_000251.2(MSH2):c.-68-105A>T rs786201917
NM_000251.2(MSH2):c.-68-108C>G rs786202309
NM_000251.2(MSH2):c.-68-10T>A rs876658616
NM_000251.2(MSH2):c.-68-111C>T rs17224094
NM_000251.2(MSH2):c.-68-113G>A rs786201698
NM_000251.2(MSH2):c.-68-114C>T rs876658327
NM_000251.2(MSH2):c.-68-118G>A rs786201695
NM_000251.2(MSH2):c.-68-121T>C rs587782154
NM_000251.2(MSH2):c.-68-122C>T rs587779115
NM_000251.2(MSH2):c.-68-124A>G rs876660477
NM_000251.2(MSH2):c.-68-125A>G rs587782642
NM_000251.2(MSH2):c.-68-128G>A rs587781999
NM_000251.2(MSH2):c.-68-140A>G rs786202450
NM_000251.2(MSH2):c.-68-145A>C rs550182227
NM_000251.2(MSH2):c.-68-145A>T rs550182227
NM_000251.2(MSH2):c.-68-147T>C rs786202625
NM_000251.2(MSH2):c.-68-148C>G rs587782171
NM_000251.2(MSH2):c.-68-14G>C rs866991159
NM_000251.2(MSH2):c.-68-157G>C rs138068023
NM_000251.2(MSH2):c.-68-15G>A rs571975131
NM_000251.2(MSH2):c.-68-162G>A rs587781551
NM_000251.2(MSH2):c.-68-162G>T rs587781551
NM_000251.2(MSH2):c.-68-172C>T rs786203333
NM_000251.2(MSH2):c.-68-173A>T rs876659469
NM_000251.2(MSH2):c.-68-17G>A rs876659065
NM_000251.2(MSH2):c.-68-186G>C rs755946724
NM_000251.2(MSH2):c.-68-187C>A rs532504901
NM_000251.2(MSH2):c.-68-18G>A rs876658679
NM_000251.2(MSH2):c.-68-191T>C rs876660544
NM_000251.2(MSH2):c.-68-193C>A rs764212255
NM_000251.2(MSH2):c.-68-194G>C rs763096037
NM_000251.2(MSH2):c.-68-194G>T rs763096037
NM_000251.2(MSH2):c.-68-195C>G rs876659014
NM_000251.2(MSH2):c.-68-197T>A rs876659385
NM_000251.2(MSH2):c.-68-209C>T rs876659759
NM_000251.2(MSH2):c.-68-211A>C rs876660739
NM_000251.2(MSH2):c.-68-213G>A rs876658399
NM_000251.2(MSH2):c.-68-218A>T rs786202645
NM_000251.2(MSH2):c.-68-221C>A rs876659733
NM_000251.2(MSH2):c.-68-228G>A rs550291148
NM_000251.2(MSH2):c.-68-231G>C rs786202723
NM_000251.2(MSH2):c.-68-240A>T rs876659032
NM_000251.2(MSH2):c.-68-242C>G rs786201048
NM_000251.2(MSH2):c.-68-245C>T rs561043699
NM_000251.2(MSH2):c.-68-246G>C rs542429591
NM_000251.2(MSH2):c.-68-248G>A rs786203978
NM_000251.2(MSH2):c.-68-250A>T rs527599397
NM_000251.2(MSH2):c.-68-26C>T rs786202841
NM_000251.2(MSH2):c.-68-28G>A rs56062561
NM_000251.2(MSH2):c.-68-30C>T rs777285149
NM_000251.2(MSH2):c.-68-32G>A rs876659929
NM_000251.2(MSH2):c.-68-33G>C rs876658524
NM_000251.2(MSH2):c.-68-34T>C rs17217709
NM_000251.2(MSH2):c.-68-365T>G rs1863332
NM_000251.2(MSH2):c.-68-38G>C rs786202882
NM_000251.2(MSH2):c.-68-39C>A rs587782649
NM_000251.2(MSH2):c.-68-44G>A rs553751848
NM_000251.2(MSH2):c.-68-46G>A rs786203146
NM_000251.2(MSH2):c.-68-48G>T rs587782786
NM_000251.2(MSH2):c.-68-5G>A rs552303079
NM_000251.2(MSH2):c.-68-63C>A rs876658758
NM_000251.2(MSH2):c.-68-64G>A rs876659124
NM_000251.2(MSH2):c.-68-67G>C rs587782145
NM_000251.2(MSH2):c.-68-6A>G rs786201938
NM_000251.2(MSH2):c.-68-73C>G rs786203729
NM_000251.2(MSH2):c.-68-75A>T rs786202735
NM_000251.2(MSH2):c.-68-77C>A rs876660689
NM_000251.2(MSH2):c.-68-80C>T rs577322036
NM_000251.2(MSH2):c.-68-86G>A rs876659372
NM_000251.2(MSH2):c.-68-8G>A rs34355730
NM_000251.2(MSH2):c.-68-90G>T rs876660222
NM_000251.2(MSH2):c.-68-93C>T rs17224101
NM_000251.2(MSH2):c.-68-94C>T rs876658668
NM_000251.2(MSH2):c.-68G>A rs576303132
NM_000251.2(MSH2):c.-78_-77del rs587779182
NM_000251.2(MSH2):c.-7T>A
NM_000251.2(MSH2):c.-81dupA rs587779187
NM_000251.2(MSH2):c.-8G>A rs1064795641
NM_000251.2(MSH2):c.-8G>T rs1064795641
NM_000251.2(MSH2):c.-94C>G rs786202841
NM_000251.2(MSH2):c.-9G>A rs547444746
NM_000251.2(MSH2):c.-9G>C rs547444746
NM_000251.2(MSH2):c.1000A>T (p.Lys334Ter) rs587779063
NM_000251.2(MSH2):c.1004C>G (p.Thr335Ser) rs63750602
NM_000251.2(MSH2):c.1004C>T (p.Thr335Ile) rs63750602
NM_000251.2(MSH2):c.1005C>T (p.Thr335=)
NM_000251.2(MSH2):c.1006C>A (p.Pro336Thr) rs63751062
NM_000251.2(MSH2):c.1006C>T (p.Pro336Ser) rs63751062
NM_000251.2(MSH2):c.1007delC (p.Pro336Leufs) rs587779064
NM_000251.2(MSH2):c.1007dup (p.Gln337Serfs) rs587779064
NM_000251.2(MSH2):c.1008delT (p.Gln337Lysfs) rs879253899
NM_000251.2(MSH2):c.1009C>G (p.Gln337Glu) rs63750778
NM_000251.2(MSH2):c.1009C>T (p.Gln337Ter) rs63750778
NM_000251.2(MSH2):c.100G>A (p.Val34Met) rs1064793541
NM_000251.2(MSH2):c.1010A>G (p.Gln337Arg) rs1553353190
NM_000251.2(MSH2):c.1011A>G (p.Gln337=) rs1553353192
NM_000251.2(MSH2):c.1012G>A (p.Gly338Arg) rs63751004
NM_000251.2(MSH2):c.1012G>C (p.Gly338Arg) rs63751004
NM_000251.2(MSH2):c.1013G>A (p.Gly338Glu) rs587779065
NM_000251.2(MSH2):c.1013G>C (p.Gly338Ala) rs587779065
NM_000251.2(MSH2):c.1013G>T (p.Gly338Val)
NM_000251.2(MSH2):c.1014A>C (p.Gly338=) rs774083607
NM_000251.2(MSH2):c.1014A>T (p.Gly338=) rs774083607
NM_000251.2(MSH2):c.1015C>T (p.Gln339Ter)
NM_000251.2(MSH2):c.1016A>C (p.Gln339Pro) rs1060502006
NM_000251.2(MSH2):c.1017A>G (p.Gln339=) rs876659238
NM_000251.2(MSH2):c.1017_1018delAA (p.Arg340Thrfs) rs63750703
NM_000251.2(MSH2):c.1018A>G (p.Arg340Gly) rs1553353205
NM_000251.2(MSH2):c.1018dupA (p.Arg340Lysfs) rs63750703
NM_000251.2(MSH2):c.1021C>G (p.Leu341Val) rs748115066
NM_000251.2(MSH2):c.1021C>T (p.Leu341Phe) rs748115066
NM_000251.2(MSH2):c.1022T>C (p.Leu341Pro) rs63751147
NM_000251.2(MSH2):c.1022T>G (p.Leu341Arg) rs63751147
NM_000251.2(MSH2):c.1023delT (p.Val342Leufs) rs864622340
NM_000251.2(MSH2):c.1024G>A (p.Val342Ile) rs63749879
NM_000251.2(MSH2):c.1027A>G (p.Asn343Asp) rs587779961
NM_000251.2(MSH2):c.1029C>A (p.Asn343Lys) rs1060501995
NM_000251.2(MSH2):c.1030C>A (p.Gln344Lys) rs63750245
NM_000251.2(MSH2):c.1030C>T (p.Gln344Ter) rs63750245
NM_000251.2(MSH2):c.1032G>A (p.Gln344=) rs375799148
NM_000251.2(MSH2):c.1032G>C (p.Gln344His) rs375799148
NM_000251.2(MSH2):c.1033T>G (p.Trp345Gly)
NM_000251.2(MSH2):c.1033_1034insTAT (p.Gln344_Trp345insLeu) rs587782374
NM_000251.2(MSH2):c.1034G>A (p.Trp345Ter) rs63751027
NM_000251.2(MSH2):c.1034_1045delGGATTAAGCAGC (p.Trp345_Pro349delinsSer) rs1553353226
NM_000251.2(MSH2):c.1035G>A (p.Trp345Ter) rs63750396
NM_000251.2(MSH2):c.1037_1038dupTT (p.Lys347Leufs) rs63751483
NM_000251.2(MSH2):c.103C>G (p.Arg35Gly) rs1060502034
NM_000251.2(MSH2):c.103C>T (p.Arg35Cys) rs1060502034
NM_000251.2(MSH2):c.1041G>C (p.Lys347Asn) rs1302487476
NM_000251.2(MSH2):c.1042C>G (p.Gln348Glu) rs979212552
NM_000251.2(MSH2):c.1042C>T (p.Gln348Ter) rs979212552
NM_000251.2(MSH2):c.1042del (p.Gln348Serfs) rs1553353233
NM_000251.2(MSH2):c.1043A>G (p.Gln348Arg) rs773177076
NM_000251.2(MSH2):c.1043del (p.Gln348Argfs) rs1114167809
NM_000251.2(MSH2):c.1045C>A (p.Pro349Thr) rs267607939
NM_000251.2(MSH2):c.1045C>G (p.Pro349Ala) rs267607939
NM_000251.2(MSH2):c.1045C>T (p.Pro349Ser) rs267607939
NM_000251.2(MSH2):c.1046C>G (p.Pro349Arg) rs587779067
NM_000251.2(MSH2):c.1046C>T (p.Pro349Leu) rs587779067
NM_000251.2(MSH2):c.1046_1047delCTinsGC (p.Pro349Arg)
NM_000251.2(MSH2):c.1048C>G (p.Leu350Val) rs771126636
NM_000251.2(MSH2):c.1048C>T (p.Leu350Phe) rs771126636
NM_000251.2(MSH2):c.104G>A (p.Arg35His) rs1060502012
NM_000251.2(MSH2):c.1050C>G (p.Leu350=)
NM_000251.2(MSH2):c.1051A>G (p.Met351Val) rs138026880
NM_000251.2(MSH2):c.1052T>C (p.Met351Thr) rs1553353246
NM_000251.2(MSH2):c.1052T>G (p.Met351Arg) rs1553353246
NM_000251.2(MSH2):c.1053G>C (p.Met351Ile) rs373122667
NM_000251.2(MSH2):c.1059delG (p.Asn354Thrfs) rs587779068
NM_000251.2(MSH2):c.105C>A (p.Arg35=) rs775554736
NM_000251.2(MSH2):c.1062C>T (p.Asn354=) rs876659861
NM_000251.2(MSH2):c.1064G>T (p.Arg355Ile) rs730881754
NM_000251.2(MSH2):c.1067T>A (p.Ile356Lys) rs753075410
NM_000251.2(MSH2):c.1067T>C (p.Ile356Thr) rs753075410
NM_000251.2(MSH2):c.1067T>G (p.Ile356Arg) rs753075410
NM_000251.2(MSH2):c.1068del (p.Ile356Metfs) rs1114167867
NM_000251.2(MSH2):c.1069G>C (p.Glu357Gln) rs587779069
NM_000251.2(MSH2):c.106C>G (p.Leu36Val) rs1553348786
NM_000251.2(MSH2):c.106_212-1229del
NM_000251.2(MSH2):c.1070A>C (p.Glu357Ala) rs150503781
NM_000251.2(MSH2):c.1071G>A (p.Glu357=)
NM_000251.2(MSH2):c.1071G>C (p.Glu357Asp) rs587781617
NM_000251.2(MSH2):c.1071_1072dup (p.Glu358Glyfs)
NM_000251.2(MSH2):c.1073A>C (p.Glu358Ala) rs587781775
NM_000251.2(MSH2):c.1074G>C (p.Glu358Asp) rs1477257356
NM_000251.2(MSH2):c.1075A>T (p.Arg359Ter) rs587779070
NM_000251.2(MSH2):c.1075_1076dup (p.Leu360Aspfs) rs1114167858
NM_000251.2(MSH2):c.1076+10T>C
NM_000251.2(MSH2):c.1076+11A>G rs749965644
NM_000251.2(MSH2):c.1076+12G>C rs755616171
NM_000251.2(MSH2):c.1076+16A>C rs527646904
NM_000251.2(MSH2):c.1076+176A>G rs104895023
NM_000251.2(MSH2):c.1076+17T>G rs587779071
NM_000251.2(MSH2):c.1076+1G>A rs267607940
NM_000251.2(MSH2):c.1076+1G>T rs267607940
NM_000251.2(MSH2):c.1076+20T>G rs376680457
NM_000251.2(MSH2):c.1076+23C>G rs377417056
NM_000251.2(MSH2):c.1076+3400C>T rs4952887
NM_000251.2(MSH2):c.1076+3A>T rs267607941
NM_000251.2(MSH2):c.1076+4134C>G rs187772681
NM_000251.2(MSH2):c.1076+4T>A rs764606343
NM_000251.2(MSH2):c.1076+4T>C rs764606343
NM_000251.2(MSH2):c.1076+5G>A rs1400610583
NM_000251.2(MSH2):c.1076G>A (p.Arg359Lys) rs63751604
NM_000251.2(MSH2):c.1076G>C (p.Arg359Thr) rs63751604
NM_000251.2(MSH2):c.1077-10T>C rs17224360
NM_000251.2(MSH2):c.1077-135_1276+119dup rs1553356484
NM_000251.2(MSH2):c.1077-15G>T rs753277524
NM_000251.2(MSH2):c.1077-17A>C
NM_000251.2(MSH2):c.1077-18C>G rs746526239
NM_000251.2(MSH2):c.1077-19T>G rs1428742393
NM_000251.2(MSH2):c.1077-1G>C rs267607944
NM_000251.2(MSH2):c.1077-1G>T rs267607944
NM_000251.2(MSH2):c.1077-2037G>T rs13425206
NM_000251.2(MSH2):c.1077-220_1276+6245del
NM_000251.2(MSH2):c.1077-2A>C rs267607943
NM_000251.2(MSH2):c.1077-2A>G rs267607943
NM_000251.2(MSH2):c.1077-2A>T rs267607943
NM_000251.2(MSH2):c.1077-35A>G rs267607942
NM_000251.2(MSH2):c.1077-3C>A rs758182607
NM_000251.2(MSH2):c.1077-3C>T rs758182607
NM_000251.2(MSH2):c.1077-66_1146del rs193922372
NM_000251.2(MSH2):c.1077-766A>G rs869312596
NM_000251.2(MSH2):c.1077-775C>T rs17217933
NM_000251.2(MSH2):c.1077-7A>G rs370807334
NM_000251.2(MSH2):c.1077-80G>A rs2347794
NM_000251.2(MSH2):c.1077-?_*(272_?)del
NM_000251.2(MSH2):c.1077-?_*279+?del
NM_000251.2(MSH2):c.1077-?_1276+?del
NM_000251.2(MSH2):c.1077-?_1276+?dup
NM_000251.2(MSH2):c.1077-?_1276+?dup200
NM_000251.2(MSH2):c.1077-?_1386+?del
NM_000251.2(MSH2):c.1077-?_1386+?dup310
NM_000251.2(MSH2):c.1077-?_1661+?del
NM_000251.2(MSH2):c.1077-?_2005+?del
NM_000251.2(MSH2):c.1077A>T (p.Arg359Ser) rs63751617
NM_000251.2(MSH2):c.1077_1078ins173 (p.?)
NM_000251.2(MSH2):c.1077_1276del200 (p.Leu360Lysfs) rs1553356518
NM_000251.2(MSH2):c.1079T>G (p.Leu360Trp)
NM_000251.2(MSH2):c.1082A>G (p.Asn361Ser) rs587779072
NM_000251.2(MSH2):c.1083T>C (p.Asn361=) rs864622544
NM_000251.2(MSH2):c.1083_1100del18insATCTTCTAC (p.Asn361_Val367delinsLysSerSerThr) rs1553356523
NM_000251.2(MSH2):c.1086A>T (p.Leu362Phe) rs63751699
NM_000251.2(MSH2):c.1087G>T (p.Val363Leu) rs377345366
NM_000251.2(MSH2):c.108T>C (p.Leu36=) rs876659034
NM_000251.2(MSH2):c.108T>G (p.Leu36=) rs876659034
NM_000251.2(MSH2):c.1090G>A (p.Glu364Lys)
NM_000251.2(MSH2):c.1090delG (p.Glu364Lysfs) rs863225385
NM_000251.2(MSH2):c.1091A>T (p.Glu364Val) rs1553356538
NM_000251.2(MSH2):c.1094C>A (p.Ala365Asp) rs1242235025
NM_000251.2(MSH2):c.1094C>G (p.Ala365Gly)
NM_000251.2(MSH2):c.1094C>T (p.Ala365Val) rs1242235025
NM_000251.2(MSH2):c.1097_1098insA (p.Phe366Leufs) rs267607693
NM_000251.2(MSH2):c.1099G>A (p.Val367Ile) rs80285180
NM_000251.2(MSH2):c.1099delG (p.Val367Terfs) rs587779073
NM_000251.2(MSH2):c.10C>A (p.Gln4Lys) rs878853797
NM_000251.2(MSH2):c.10C>T (p.Gln4Ter)
NM_000251.2(MSH2):c.1100T>C (p.Val367Ala)
NM_000251.2(MSH2):c.1103A>G (p.Glu368Gly) rs1553356552
NM_000251.2(MSH2):c.1103A>T (p.Glu368Val) rs1553356552
NM_000251.2(MSH2):c.1108G>A (p.Ala370Thr) rs1064794109
NM_000251.2(MSH2):c.1108delG (p.Ala370Glnfs) rs63749814
NM_000251.2(MSH2):c.110delT (p.Phe37Serfs) rs63751056
NM_000251.2(MSH2):c.1111G>A (p.Glu371Lys) rs1060501994
NM_000251.2(MSH2):c.1111G>C (p.Glu371Gln) rs1060501994
NM_000251.2(MSH2):c.1111G>T (p.Glu371Ter)
NM_000251.2(MSH2):c.1114T>C (p.Leu372=) rs770201760
NM_000251.2(MSH2):c.1114T>G (p.Leu372Val) rs770201760
NM_000251.2(MSH2):c.1117A>C (p.Arg373=) rs781061998
NM_000251.2(MSH2):c.1118G>A (p.Arg373Lys) rs864622254
NM_000251.2(MSH2):c.1119G>T (p.Arg373Ser) rs1553356567
NM_000251.2(MSH2):c.1119delG (p.Arg373Serfs) rs63750516
NM_000251.2(MSH2):c.111C>G (p.Phe37Leu) rs1433060674
NM_000251.2(MSH2):c.1120C>T (p.Gln374Ter) rs63750558
NM_000251.2(MSH2):c.1121A>G (p.Gln374Arg) rs749660228
NM_000251.2(MSH2):c.1122G>C (p.Gln374His) rs370378607
NM_000251.2(MSH2):c.1124C>G (p.Thr375Ser) rs774539871
NM_000251.2(MSH2):c.1124C>T (p.Thr375Ile) rs774539871
NM_000251.2(MSH2):c.1125T>G (p.Thr375=) rs1553356579
NM_000251.2(MSH2):c.1125_1126insAT (p.Leu376Ilefs) rs786203350
NM_000251.2(MSH2):c.1127_1128dupTA (p.Gln377Tyrfs) rs63751219
NM_000251.2(MSH2):c.1129C>T (p.Gln377Ter) rs63750267
NM_000251.2(MSH2):c.112G>T (p.Asp38Tyr) rs730881761
NM_000251.2(MSH2):c.1130A>G (p.Gln377Arg) rs776174711
NM_000251.2(MSH2):c.1131A>G (p.Gln377=) rs181852377
NM_000251.2(MSH2):c.1133A>C (p.Glu378Ala) rs876659404
NM_000251.2(MSH2):c.1138T>G (p.Leu380Val)
NM_000251.2(MSH2):c.1139T>C (p.Leu380Ser) rs730881755
NM_000251.2(MSH2):c.1139T>G (p.Leu380Ter) rs730881755
NM_000251.2(MSH2):c.1139delT (p.Leu380Tyrfs) rs63750039
NM_000251.2(MSH2):c.1143delT (p.Arg382Valfs) rs1553356594
NM_000251.2(MSH2):c.1144C>A (p.Arg382Ser)
NM_000251.2(MSH2):c.1144C>T (p.Arg382Cys) rs752373431
NM_000251.2(MSH2):c.1144delC (p.Arg382Valfs) rs1553356605
NM_000251.2(MSH2):c.1144dupC (p.Arg382Profs) rs63750496
NM_000251.2(MSH2):c.1145G>A (p.Arg382His) rs267607947
NM_000251.2(MSH2):c.1147C>T (p.Arg383Ter) rs63749849
NM_000251.2(MSH2):c.1148G>A (p.Arg383Gln) rs376934727
NM_000251.2(MSH2):c.1148G>C (p.Arg383Pro) rs376934727
NM_000251.2(MSH2):c.114C>G (p.Asp38Glu) rs587779074
NM_000251.2(MSH2):c.1152C>G (p.Phe384Leu) rs1553356612
NM_000251.2(MSH2):c.1153C>G (p.Pro385Ala) rs763985746
NM_000251.2(MSH2):c.1153C>T (p.Pro385Ser) rs763985746
NM_000251.2(MSH2):c.1154C>T (p.Pro385Leu) rs564736113
NM_000251.2(MSH2):c.1155A>G (p.Pro385=) rs1553356617
NM_000251.2(MSH2):c.1156G>A (p.Asp386Asn)
NM_000251.2(MSH2):c.1157A>G (p.Asp386Gly) rs1203515094
NM_000251.2(MSH2):c.1157dupA (p.Asp386Glufs) rs730881774
NM_000251.2(MSH2):c.1158T>C (p.Asp386=) rs1060504421
NM_000251.2(MSH2):c.1158_1167delTCTTAACCGA (p.Asn388Profs) rs1057517762
NM_000251.2(MSH2):c.1159C>G (p.Leu387Val) rs751249745
NM_000251.2(MSH2):c.1159C>T (p.Leu387Phe) rs751249745
NM_000251.2(MSH2):c.115C>A (p.Arg39=) rs786202334
NM_000251.2(MSH2):c.115C>T (p.Arg39Trp) rs786202334
NM_000251.2(MSH2):c.115_123del (p.Arg39_Asp41del) rs863224831
NM_000251.2(MSH2):c.115delC (p.Arg39Glyfs) rs1553348794
NM_000251.2(MSH2):c.1161T>C (p.Leu387=)
NM_000251.2(MSH2):c.1165C>T (p.Arg389Ter) rs587779075
NM_000251.2(MSH2):c.1166G>A (p.Arg389Gln) rs757276241
NM_000251.2(MSH2):c.1166G>T (p.Arg389Leu)
NM_000251.2(MSH2):c.1168C>G (p.Leu390Val) rs17224367
NM_000251.2(MSH2):c.1168C>T (p.Leu390Phe) rs17224367
NM_000251.2(MSH2):c.116G>C (p.Arg39Pro) rs587782759
NM_000251.2(MSH2):c.1171G>A (p.Ala391Thr) rs878853798
NM_000251.2(MSH2):c.1171G>C (p.Ala391Pro)
NM_000251.2(MSH2):c.1172C>A (p.Ala391Asp) rs864622674
NM_000251.2(MSH2):c.1172C>T (p.Ala391Val) rs864622674
NM_000251.2(MSH2):c.1175A>T (p.Lys392Met) rs61756465
NM_000251.2(MSH2):c.1176_1177delGA (p.Lys393Valfs) rs1553356643
NM_000251.2(MSH2):c.1177A>C (p.Lys393Gln) rs863225386
NM_000251.2(MSH2):c.1177A>T (p.Lys393Ter) rs863225386
NM_000251.2(MSH2):c.1178A>T (p.Lys393Met)
NM_000251.2(MSH2):c.1179G>A (p.Lys393=) rs1553356646
NM_000251.2(MSH2):c.1182T>G (p.Phe394Leu) rs374135434
NM_000251.2(MSH2):c.1183C>T (p.Gln395Ter) rs63750302
NM_000251.2(MSH2):c.1185A>G (p.Gln395=)
NM_000251.2(MSH2):c.1189C>G (p.Gln397Glu) rs63750611
NM_000251.2(MSH2):c.1189C>T (p.Gln397Ter) rs63750611
NM_000251.2(MSH2):c.118G>A (p.Gly40Ser) rs63751260
NM_000251.2(MSH2):c.1190A>G (p.Gln397Arg) rs1553356658
NM_000251.2(MSH2):c.1191A>G (p.Gln397=) rs768694189
NM_000251.2(MSH2):c.1191A>T (p.Gln397His) rs768694189
NM_000251.2(MSH2):c.1192G>A (p.Ala398Thr) rs988252817
NM_000251.2(MSH2):c.1192dupG (p.Ala398Glyfs) rs63751169
NM_000251.2(MSH2):c.1193C>T (p.Ala398Val) rs1060502019
NM_000251.2(MSH2):c.1194A>G (p.Ala398=) rs1060504412
NM_000251.2(MSH2):c.1196_1197dupCA (p.Asn400Glnfs) rs63749850
NM_000251.2(MSH2):c.119G>T (p.Gly40Val) rs876658719
NM_000251.2(MSH2):c.119delG (p.Gly40Alafs) rs63750984
NM_000251.2(MSH2):c.11A>C (p.Gln4Pro)
NM_000251.2(MSH2):c.11A>T (p.Gln4Leu) rs754562075
NM_000251.2(MSH2):c.11_12delAGinsC (p.Gln4Profs)
NM_000251.2(MSH2):c.11_12delAGinsCC (p.Gln4Pro) rs1553348689
NM_000251.2(MSH2):c.1200C>G (p.Asn400Lys) rs1301023135
NM_000251.2(MSH2):c.1201_1202dupTT (p.Leu401Phefs) rs869312768
NM_000251.2(MSH2):c.1201_1204delTTAC (p.Leu401Lysfs)
NM_000251.2(MSH2):c.1203dupA (p.Gln402Thrfs) rs63750586
NM_000251.2(MSH2):c.1204C>A (p.Gln402Lys) rs63751412
NM_000251.2(MSH2):c.1204C>G (p.Gln402Glu) rs63751412
NM_000251.2(MSH2):c.1204C>T (p.Gln402Ter) rs63751412
NM_000251.2(MSH2):c.1204delC (p.Gln402Lysfs) rs63751413
NM_000251.2(MSH2):c.1206A>G (p.Gln402=) rs1553356673
NM_000251.2(MSH2):c.1206A>T (p.Gln402His) rs1553356673
NM_000251.2(MSH2):c.1208delA (p.Asp403Valfs) rs1553356678
NM_000251.2(MSH2):c.1209T>C (p.Asp403=) rs1060504420
NM_000251.2(MSH2):c.1210del (p.Cys404Valfs) rs587782777
NM_000251.2(MSH2):c.1211G>T (p.Cys404Phe) rs1553356682
NM_000251.2(MSH2):c.1215C>A (p.Tyr405Ter) rs63751271
NM_000251.2(MSH2):c.1215C>G (p.Tyr405Ter) rs63751271
NM_000251.2(MSH2):c.1216C>T (p.Arg406Ter) rs63751108
NM_000251.2(MSH2):c.1216_1219dupCGAC (p.Leu407Profs) rs63751192
NM_000251.2(MSH2):c.1217G>A (p.Arg406Gln) rs146567853
NM_000251.2(MSH2):c.1217G>T (p.Arg406Leu) rs146567853
NM_000251.2(MSH2):c.121G>T (p.Asp41Tyr) rs878853799
NM_000251.2(MSH2):c.1221C>G (p.Leu407=) rs63750813
NM_000251.2(MSH2):c.1221C>T (p.Leu407=) rs63750813
NM_000251.2(MSH2):c.1221_1222delCT (p.Tyr408Serfs) rs587779076
NM_000251.2(MSH2):c.1222dupT (p.Tyr408Leufs) rs63751142
NM_000251.2(MSH2):c.1223A>G (p.Tyr408Cys) rs63750379
NM_000251.2(MSH2):c.1223A>T (p.Tyr408Phe) rs63750379
NM_000251.2(MSH2):c.1224T>C (p.Tyr408=) rs63750132
NM_000251.2(MSH2):c.1224T>G (p.Tyr408Ter) rs63750132
NM_000251.2(MSH2):c.1225C>A (p.Gln409Lys) rs151244108
NM_000251.2(MSH2):c.1225C>G (p.Gln409Glu) rs151244108
NM_000251.2(MSH2):c.1225C>T (p.Gln409Ter) rs151244108
NM_000251.2(MSH2):c.1226_1227delAG (p.Gln409Argfs) rs63750086
NM_000251.2(MSH2):c.1228G>T (p.Gly410Cys) rs587782242
NM_000251.2(MSH2):c.1229G>T (p.Gly410Val) rs1354753753
NM_000251.2(MSH2):c.1229delG (p.Gly410Valfs) rs1553356700
NM_000251.2(MSH2):c.1230T>C (p.Gly410=) rs1057522228
NM_000251.2(MSH2):c.1236_1268del33 (p.Asn412_Glu422del) rs587779077
NM_000251.2(MSH2):c.1237C>G (p.Gln413Glu) rs863225387
NM_000251.2(MSH2):c.1237C>T (p.Gln413Ter) rs863225387
NM_000251.2(MSH2):c.1238A>C (p.Gln413Pro) rs587779962
NM_000251.2(MSH2):c.123C>G (p.Asp41Glu) rs761960690
NM_000251.2(MSH2):c.123C>T (p.Asp41=) rs761960690
NM_000251.2(MSH2):c.123_124insTTCT (p.Tyr43Phefs) rs587782561
NM_000251.2(MSH2):c.1240C>T (p.Leu414=) rs908316909
NM_000251.2(MSH2):c.1241T>C (p.Leu414Pro) rs587779078
NM_000251.2(MSH2):c.1241T>G (p.Leu414Arg) rs587779078
NM_000251.2(MSH2):c.1242A>T (p.Leu414=) rs757250110
NM_000251.2(MSH2):c.1243C>G (p.Pro415Ala) rs35717997
NM_000251.2(MSH2):c.1243C>T (p.Pro415Ser) rs35717997
NM_000251.2(MSH2):c.1243_1246delCCTA (p.Pro415Metfs) rs63751206
NM_000251.2(MSH2):c.1247A>G (p.Asn416Ser) rs1386630417
NM_000251.2(MSH2):c.1247_1257dup (p.Ala420Metfs) rs1553356720
NM_000251.2(MSH2):c.1248T>C (p.Asn416=) rs786201156
NM_000251.2(MSH2):c.1249_1253delGTTAT (p.Val417Thrfs) rs587779079
NM_000251.2(MSH2):c.1249delG (p.Val417Leufs) rs63751059
NM_000251.2(MSH2):c.124T>C (p.Phe42Leu) rs1553348804
NM_000251.2(MSH2):c.1250T>G (p.Val417Gly) rs876659846
NM_000251.2(MSH2):c.1251T>C (p.Val417=) rs1553356731
NM_000251.2(MSH2):c.1251_1268del18insAGTT (p.Ile418Valfs) rs863225388
NM_000251.2(MSH2):c.1252A>G (p.Ile418Val)
NM_000251.2(MSH2):c.1252A>T (p.Ile418Leu) rs763600083
NM_000251.2(MSH2):c.1252dup (p.Ile418Asnfs) rs1114167830
NM_000251.2(MSH2):c.1253T>C (p.Ile418Thr) rs786202303
NM_000251.2(MSH2):c.1254A>G (p.Ile418Met) rs751431238
NM_000251.2(MSH2):c.1255C>A (p.Gln419Lys) rs63750006
NM_000251.2(MSH2):c.1255C>T (p.Gln419Ter) rs63750006
NM_000251.2(MSH2):c.1258G>C (p.Ala420Pro) rs767609290
NM_000251.2(MSH2):c.1261C>A (p.Leu421Met) rs63750228
NM_000251.2(MSH2):c.1262T>C (p.Leu421Pro) rs587779080
NM_000251.2(MSH2):c.1264G>A (p.Glu422Lys) rs63751712
NM_000251.2(MSH2):c.1264G>T (p.Glu422Ter) rs63751712
NM_000251.2(MSH2):c.1265_1269delAAAAAinsGAAAAG (p.Glu422Glyfs)
NM_000251.2(MSH2):c.1267A>G (p.Lys423Glu) rs201059765
NM_000251.2(MSH2):c.1269dupA (p.His424Thrfs) rs63751667
NM_000251.2(MSH2):c.126C>G (p.Phe42Leu) rs730881766
NM_000251.2(MSH2):c.1270C>T (p.His424Tyr) rs587782278
NM_000251.2(MSH2):c.1271A>G (p.His424Arg) rs200429136
NM_000251.2(MSH2):c.1271dupA (p.His424Glnfs) rs587783055
NM_000251.2(MSH2):c.1272T>G (p.His424Gln) rs1553356754
NM_000251.2(MSH2):c.1273G>A (p.Glu425Lys) rs1064795063
NM_000251.2(MSH2):c.1273G>T (p.Glu425Ter)
NM_000251.2(MSH2):c.1275A>G (p.Glu425=) rs63751650
NM_000251.2(MSH2):c.1276+10G>A rs374061707
NM_000251.2(MSH2):c.1276+11A>G rs189015988
NM_000251.2(MSH2):c.1276+16G>A rs368120695
NM_000251.2(MSH2):c.1276+16G>T rs368120695
NM_000251.2(MSH2):c.1276+17delT rs587779081
NM_000251.2(MSH2):c.1276+18T>G rs1057520924
NM_000251.2(MSH2):c.1276+1G>A rs267607950
NM_000251.2(MSH2):c.1276+1G>C rs267607950
NM_000251.2(MSH2):c.1276+1G>T rs267607950
NM_000251.2(MSH2):c.1276+20_1276+23delTTTT rs587779081
NM_000251.2(MSH2):c.1276+23dup rs587779081
NM_000251.2(MSH2):c.1276+2T>A rs267607953
NM_000251.2(MSH2):c.1276+2T>C rs267607953
NM_000251.2(MSH2):c.1276+47T>A rs148018406
NM_000251.2(MSH2):c.1276+4A>G rs1481785592
NM_000251.2(MSH2):c.1276+51C>A rs17217961
NM_000251.2(MSH2):c.1276+6765G>A rs3771274
NM_000251.2(MSH2):c.1276+6958A>T rs150952868
NM_000251.2(MSH2):c.1276+7A>G rs748554540
NM_000251.2(MSH2):c.1276G>A (p.Gly426Arg) rs879254234
NM_000251.2(MSH2):c.1277-118G>A rs1981929
NM_000251.2(MSH2):c.1277-11C>T
NM_000251.2(MSH2):c.1277-12A>C rs1181142850
NM_000251.2(MSH2):c.1277-12A>T rs1181142850
NM_000251.2(MSH2):c.1277-13T>A rs1553361114
NM_000251.2(MSH2):c.1277-14C>G rs267607951
NM_000251.2(MSH2):c.1277-15A>G rs1553361106
NM_000251.2(MSH2):c.1277-16T>C rs368653974
NM_000251.2(MSH2):c.1277-1G>A rs267607948
NM_000251.2(MSH2):c.1277-1G>C rs267607948
NM_000251.2(MSH2):c.1277-20_1277-17delGTTT rs1268840033
NM_000251.2(MSH2):c.1277-212T>A rs1981928
NM_000251.2(MSH2):c.1277-2433T>A rs186552003
NM_000251.2(MSH2):c.1277-2A>C rs267607949
NM_000251.2(MSH2):c.1277-2A>G rs267607949
NM_000251.2(MSH2):c.1277-2A>T
NM_000251.2(MSH2):c.1277-4076_1386+1819del
NM_000251.2(MSH2):c.1277-4T>C rs1057521428
NM_000251.2(MSH2):c.1277-572_1386+2326del
NM_000251.2(MSH2):c.1277-5849T>C rs17036577
NM_000251.2(MSH2):c.1277-6224_1386+4836del
NM_000251.2(MSH2):c.1277-6284_1386+4776del
NM_000251.2(MSH2):c.1277-6990T>G rs13408008
NM_000251.2(MSH2):c.1277-6T>C
NM_000251.2(MSH2):c.1277-7C>A rs375437307
NM_000251.2(MSH2):c.1277-7C>G rs375437307
NM_000251.2(MSH2):c.1277-8T>C rs145400590
NM_000251.2(MSH2):c.1277-945A>C rs7607312
NM_000251.2(MSH2):c.1277-?_*(272_?)del
NM_000251.2(MSH2):c.1277-?_*(272_?)inv
NM_000251.2(MSH2):c.1277-?_1386+?del
NM_000251.2(MSH2):c.1277-?_1386+?dup
NM_000251.2(MSH2):c.1277-?_1661+?del
NM_000251.2(MSH2):c.1277-?_1759+?del
NM_000251.2(MSH2):c.1277-?_2634+?del
NM_000251.2(MSH2):c.1278_1386+1del110 (p.Lys427Glyfs) rs1553361141
NM_000251.2(MSH2):c.127T>C (p.Tyr43His) rs786202731
NM_000251.2(MSH2):c.127T>G (p.Tyr43Asp)
NM_000251.2(MSH2):c.1281A>T (p.Lys427Asn) rs1553361147
NM_000251.2(MSH2):c.1282C>G (p.His428Asp) rs1421473851
NM_000251.2(MSH2):c.1284C>G (p.His428Gln) rs776034412
NM_000251.2(MSH2):c.1285C>T (p.Gln429Ter) rs63751693
NM_000251.2(MSH2):c.1285del (p.Gln429Argfs) rs1114167833
NM_000251.2(MSH2):c.1286A>C (p.Gln429Pro)
NM_000251.2(MSH2):c.1287dupG (p.Lys430Glufs) rs63751626
NM_000251.2(MSH2):c.1288A>T (p.Lys430Ter) rs63751646
NM_000251.2(MSH2):c.128A>G (p.Tyr43Cys) rs17217723
NM_000251.2(MSH2):c.128A>T (p.Tyr43Phe) rs17217723
NM_000251.2(MSH2):c.1290A>G (p.Lys430=)
NM_000251.2(MSH2):c.1292T>A (p.Leu431Ter) rs63751315
NM_000251.2(MSH2):c.1293_1294insA (p.Leu432Ilefs) rs1553361162
NM_000251.2(MSH2):c.1294T>C (p.Leu432=) rs937218360
NM_000251.2(MSH2):c.1296G>A (p.Leu432=) rs141295984
NM_000251.2(MSH2):c.129T>C (p.Tyr43=) rs63750894
NM_000251.2(MSH2):c.129T>G (p.Tyr43Ter) rs63750894
NM_000251.2(MSH2):c.12G>A (p.Gln4=) rs878853800
NM_000251.2(MSH2):c.12G>T (p.Gln4His)
NM_000251.2(MSH2):c.1301C>T (p.Ala434Val) rs768070717
NM_000251.2(MSH2):c.1302delA (p.Val435Phefs) rs863225389
NM_000251.2(MSH2):c.1303G>A (p.Val435Ile) rs876658240
NM_000251.2(MSH2):c.1303G>C (p.Val435Leu) rs876658240
NM_000251.2(MSH2):c.1307_1308dup (p.Val437Leufs) rs1060502035
NM_000251.2(MSH2):c.1308dupT (p.Val437Cysfs) rs1060502035
NM_000251.2(MSH2):c.1309G>C (p.Val437Leu) rs773956144
NM_000251.2(MSH2):c.1311G>T (p.Val437=) rs730881781
NM_000251.2(MSH2):c.1311_1334del24insNM_000251.1:c.1338_1361inv24 (p.Thr438_Ser445delinsPheSerLysPheGlnGluMetIle)
NM_000251.2(MSH2):c.1313C>T (p.Thr438Ile) rs1553361185
NM_000251.2(MSH2):c.1314T>C (p.Thr438=) rs761558457
NM_000251.2(MSH2):c.1315C>G (p.Pro439Ala) rs786203116
NM_000251.2(MSH2):c.1315C>T (p.Pro439Ser) rs786203116
NM_000251.2(MSH2):c.1316C>T (p.Pro439Leu) rs771789692
NM_000251.2(MSH2):c.1316_1318delCTC (p.Pro439del) rs587779082
NM_000251.2(MSH2):c.1318C>T (p.Leu440Phe) rs1553361201
NM_000251.2(MSH2):c.1318_1319delCT (p.Leu440Tyrfs) rs587779083
NM_000251.2(MSH2):c.1319T>C (p.Leu440Pro) rs587779084
NM_000251.2(MSH2):c.1319_1326delTTACTGATinsCC (p.Leu440_Asp442delinsPro) rs63749931
NM_000251.2(MSH2):c.131C>A (p.Thr44Lys) rs587779085
NM_000251.2(MSH2):c.131C>T (p.Thr44Met) rs587779085
NM_000251.2(MSH2):c.1321A>C (p.Thr441Pro) rs587779086
NM_000251.2(MSH2):c.1321dupA (p.Thr441Asnfs) rs63750807
NM_000251.2(MSH2):c.1322C>G (p.Thr441Ser) rs1553361210
NM_000251.2(MSH2):c.1326T>A (p.Asp442Glu) rs1204241808
NM_000251.2(MSH2):c.1327C>A (p.Leu443Ile) rs876659906
NM_000251.2(MSH2):c.1327C>G (p.Leu443Val) rs876659906
NM_000251.2(MSH2):c.1328T>C (p.Leu443Pro) rs1553361220
NM_000251.2(MSH2):c.1329T>G (p.Leu443=)
NM_000251.2(MSH2):c.132G>A (p.Thr44=) rs766856128
NM_000251.2(MSH2):c.132G>C (p.Thr44=) rs766856128
NM_000251.2(MSH2):c.132G>T (p.Thr44=)
NM_000251.2(MSH2):c.1331G>A (p.Arg444His) rs557339938
NM_000251.2(MSH2):c.1331G>T (p.Arg444Leu) rs557339938
NM_000251.2(MSH2):c.1333T>G (p.Ser445Ala) rs1553361224
NM_000251.2(MSH2):c.1334C>T (p.Ser445Phe) rs752067883
NM_000251.2(MSH2):c.1339T>G (p.Phe447Val) rs63751217
NM_000251.2(MSH2):c.1339_1340delTT (p.Phe447Leufs) rs1553361231
NM_000251.2(MSH2):c.1340_1341insGG (p.Phe447Leufs) rs267607696
NM_000251.2(MSH2):c.1341C>G (p.Phe447Leu) rs587781373
NM_000251.2(MSH2):c.1341C>T (p.Phe447=) rs587781373
NM_000251.2(MSH2):c.1343C>G (p.Ser448Cys) rs587782524
NM_000251.2(MSH2):c.1344C>T (p.Ser448=) rs1010360604
NM_000251.2(MSH2):c.1344del (p.Lys449Serfs) rs876658918
NM_000251.2(MSH2):c.1345A>T (p.Lys449Ter) rs63749920
NM_000251.2(MSH2):c.1345_1348delAAGT (p.Lys449Phefs) rs267607955
NM_000251.2(MSH2):c.1346A>G (p.Lys449Arg) rs879254064
NM_000251.2(MSH2):c.1347G>C (p.Lys449Asn) rs587781331
NM_000251.2(MSH2):c.134C>T (p.Ala45Val) rs63750285
NM_000251.2(MSH2):c.1350delT (p.Gln451Argfs) rs1553361261
NM_000251.2(MSH2):c.1351C>T (p.Gln451Ter) rs786201066
NM_000251.2(MSH2):c.1352A>G (p.Gln451Arg) rs878853801
NM_000251.2(MSH2):c.1352_1353delAG (p.Gln451Argfs) rs63750957
NM_000251.2(MSH2):c.1353G>A (p.Gln451=) rs1060504415
NM_000251.2(MSH2):c.1354G>A (p.Glu452Lys) rs267607954
NM_000251.2(MSH2):c.1354G>T (p.Glu452Ter) rs267607954
NM_000251.2(MSH2):c.1354_1355insT (p.Glu452Valfs) rs1114167850
NM_000251.2(MSH2):c.1355A>T (p.Glu452Val) rs1553361274
NM_000251.2(MSH2):c.1356A>G (p.Glu452=) rs63751212
NM_000251.2(MSH2):c.1357A>C (p.Met453Leu)
NM_000251.2(MSH2):c.1358T>A (p.Met453Lys) rs63750697
NM_000251.2(MSH2):c.135G>A (p.Ala45=) rs890172773
NM_000251.2(MSH2):c.135G>T (p.Ala45=) rs890172773
NM_000251.2(MSH2):c.1360A>G (p.Ile454Val) rs587781627
NM_000251.2(MSH2):c.1361T>C (p.Ile454Thr) rs1060502025
NM_000251.2(MSH2):c.1361T>G (p.Ile454Arg) rs1060502025
NM_000251.2(MSH2):c.1366A>G (p.Thr456Ala)
NM_000251.2(MSH2):c.1367C>T (p.Thr456Ile) rs777963115
NM_000251.2(MSH2):c.1369A>G (p.Thr457Ala) rs1445965781
NM_000251.2(MSH2):c.136C>T (p.His46Tyr) rs1553348821
NM_000251.2(MSH2):c.136_164del29 (p.His46Glyfs) rs63751482
NM_000251.2(MSH2):c.1373T>G (p.Leu458Ter) rs63750521
NM_000251.2(MSH2):c.1373delT (p.Leu458Terfs) rs1553361289
NM_000251.2(MSH2):c.1374A>G (p.Leu458=) rs767639853
NM_000251.2(MSH2):c.1375G>C (p.Asp459His) rs1553361295
NM_000251.2(MSH2):c.1377T>C (p.Asp459=) rs876658353
NM_000251.2(MSH2):c.1378A>G (p.Met460Val) rs575905950
NM_000251.2(MSH2):c.1379T>C (p.Met460Thr) rs1553361303
NM_000251.2(MSH2):c.137A>C (p.His46Pro) rs1553348822
NM_000251.2(MSH2):c.1380G>C (p.Met460Ile) rs757534022
NM_000251.2(MSH2):c.1382A>C (p.Asp461Ala) rs730881756
NM_000251.2(MSH2):c.1382A>G (p.Asp461Gly) rs730881756
NM_000251.2(MSH2):c.1383T>C (p.Asp461=) rs1114167881
NM_000251.2(MSH2):c.1384C>T (p.Gln462Ter) rs876657701
NM_000251.2(MSH2):c.1386+104C>T rs17224444
NM_000251.2(MSH2):c.1386+12A>C
NM_000251.2(MSH2):c.1386+149A>T rs869312599
NM_000251.2(MSH2):c.1386+18T>G rs1237549683
NM_000251.2(MSH2):c.1386+18delT rs1064795479
NM_000251.2(MSH2):c.1386+1G>A rs267607957
NM_000251.2(MSH2):c.1386+1G>C rs267607957
NM_000251.2(MSH2):c.1386+1G>T rs267607957
NM_000251.2(MSH2):c.1386+23T>G rs747646424
NM_000251.2(MSH2):c.1386+3A>G rs746390631
NM_000251.2(MSH2):c.1386+4512G>T rs75352573
NM_000251.2(MSH2):c.1386+5G>A rs1553361317
NM_000251.2(MSH2):c.1386+6500A>G rs76713374
NM_000251.2(MSH2):c.1386+73G>A rs267607958
NM_000251.2(MSH2):c.1386+7642A>G rs869312598
NM_000251.2(MSH2):c.1386+917T>A rs187069025
NM_000251.2(MSH2):c.1386G>A (p.Gln462=)
NM_000251.2(MSH2):c.1386G>C (p.Gln462His) rs587781997
NM_000251.2(MSH2):c.1387-10C>G rs1553365688
NM_000251.2(MSH2):c.1387-10_1396delins20
NM_000251.2(MSH2):c.1387-14_1387-11delTGTT rs370436680
NM_000251.2(MSH2):c.1387-15T>G rs764341831
NM_000251.2(MSH2):c.1387-16T>G rs1269674587
NM_000251.2(MSH2):c.1387-17C>G
NM_000251.2(MSH2):c.1387-18A>C rs1057521740
NM_000251.2(MSH2):c.1387-19C>G rs1553365681
NM_000251.2(MSH2):c.1387-1G>T rs267607956
NM_000251.2(MSH2):c.1387-20T>C
NM_000251.2(MSH2):c.1387-20T>G
NM_000251.2(MSH2):c.1387-2159A>G rs869312597
NM_000251.2(MSH2):c.1387-250G>A rs6741393
NM_000251.2(MSH2):c.1387-265A>G rs104895024
NM_000251.2(MSH2):c.1387-3C>T rs1553365696
NM_000251.2(MSH2):c.1387-4G>C rs376796243
NM_000251.2(MSH2):c.1387-5T>C rs757458333
NM_000251.2(MSH2):c.1387-6173G>T rs142227676
NM_000251.2(MSH2):c.1387-6187G>A rs17224514
NM_000251.2(MSH2):c.1387-8G>T rs187525243
NM_000251.2(MSH2):c.1387-9T>A rs587779087
NM_000251.2(MSH2):c.1387-9T>C
NM_000251.2(MSH2):c.1387-?_*(272_?)del
NM_000251.2(MSH2):c.1387-?_1510+?del
NM_000251.2(MSH2):c.1387-?_1661+?del
NM_000251.2(MSH2):c.1387-?_1661+?dup275
NM_000251.2(MSH2):c.1387-?_2458+?del
NM_000251.2(MSH2):c.1387G>A (p.Val463Met) rs1064793825
NM_000251.2(MSH2):c.1389G>T (p.Val463=) rs1553365702
NM_000251.2(MSH2):c.138C>G (p.His46Gln) rs33946261
NM_000251.2(MSH2):c.138C>T (p.His46=) rs33946261
NM_000251.2(MSH2):c.1390G>T (p.Glu464Ter) rs876658223
NM_000251.2(MSH2):c.1390delG (p.Glu464Lysfs) rs587779088
NM_000251.2(MSH2):c.1394A>G (p.Asn465Ser) rs1487094949
NM_000251.2(MSH2):c.1394del (p.Asn465Thrfs) rs863225390
NM_000251.2(MSH2):c.1394dupA (p.Asn465Lysfs) rs863225390
NM_000251.2(MSH2):c.1396C>T (p.His466Tyr) rs876658457
NM_000251.2(MSH2):c.1396delC (p.His466Metfs)
NM_000251.2(MSH2):c.1397A>G (p.His466Arg) rs544265737
NM_000251.2(MSH2):c.1399G>T (p.Glu467Ter) rs587779089
NM_000251.2(MSH2):c.139G>A (p.Gly47Ser) rs763573151
NM_000251.2(MSH2):c.1401A>G (p.Glu467=)
NM_000251.2(MSH2):c.1401delA (p.Glu467Aspfs) rs1553365711
NM_000251.2(MSH2):c.1404C>G (p.Phe468Leu) rs1255961940
NM_000251.2(MSH2):c.1404_1410delCCTTGTA (p.Phe468Leufs) rs878853802
NM_000251.2(MSH2):c.1405C>G (p.Leu469Val) rs780702096
NM_000251.2(MSH2):c.1405delC (p.Val470Terfs) rs1060502027
NM_000251.2(MSH2):c.1408G>A (p.Val470Ile) rs1391167729
NM_000251.2(MSH2):c.1408delG (p.Val470Terfs) rs63750384
NM_000251.2(MSH2):c.1409T>A (p.Val470Glu) rs267607959
NM_000251.2(MSH2):c.1410A>T (p.Val470=) rs757958558
NM_000251.2(MSH2):c.1413A>C (p.Lys471Asn) rs745874745
NM_000251.2(MSH2):c.1413A>G (p.Lys471=) rs745874745
NM_000251.2(MSH2):c.1413delA (p.Lys471Asnfs) rs1553365719
NM_000251.2(MSH2):c.1414C>G (p.Pro472Ala)
NM_000251.2(MSH2):c.1415C>T (p.Pro472Leu) rs1553365723
NM_000251.2(MSH2):c.1418C>G (p.Ser473Ter) rs63751403
NM_000251.2(MSH2):c.1418C>T (p.Ser473Leu) rs63751403
NM_000251.2(MSH2):c.141C>A (p.Gly47=) rs587779090
NM_000251.2(MSH2):c.141_154delCGAGGACGCGCTGC (p.Glu48Glyfs) rs863224481
NM_000251.2(MSH2):c.1424A>G (p.Asp475Gly) rs1349765126
NM_000251.2(MSH2):c.1424A>T (p.Asp475Val) rs1349765126
NM_000251.2(MSH2):c.1429A>C (p.Asn477His) rs587781346
NM_000251.2(MSH2):c.1429A>T (p.Asn477Tyr)
NM_000251.2(MSH2):c.142G>T (p.Glu48Ter) rs63750615
NM_000251.2(MSH2):c.1430A>G (p.Asn477Ser)
NM_000251.2(MSH2):c.1432C>T (p.Leu478Phe) rs1051194508
NM_000251.2(MSH2):c.1433_1434dupTC (p.Glu480Valfs) rs587779091
NM_000251.2(MSH2):c.1435A>C (p.Ser479Arg) rs770550720
NM_000251.2(MSH2):c.1439A>G (p.Glu480Gly)
NM_000251.2(MSH2):c.1440A>G (p.Glu480=) rs138049198
NM_000251.2(MSH2):c.1442T>A (p.Leu481Ter) rs786203036
NM_000251.2(MSH2):c.1442T>G (p.Leu481Ter) rs786203036
NM_000251.2(MSH2):c.1444A>T (p.Arg482Ter) rs587779092
NM_000251.2(MSH2):c.1444delA (p.Arg482Glufs) rs63750068
NM_000251.2(MSH2):c.1444dupA (p.Arg482Lysfs) rs63750068
NM_000251.2(MSH2):c.1445G>C (p.Arg482Thr) rs1553365747
NM_000251.2(MSH2):c.1445_1449delGAGAA (p.Arg482Asnfs) rs267607961
NM_000251.2(MSH2):c.1446A>C (p.Arg482Ser) rs1553365751
NM_000251.2(MSH2):c.1447G>T (p.Glu483Ter) rs63749947
NM_000251.2(MSH2):c.1447_1448delGA (p.Glu483Asnfs) rs63750161
NM_000251.2(MSH2):c.1453A>G (p.Met485Val) rs775377647
NM_000251.2(MSH2):c.1454T>C (p.Met485Thr) rs1553365763
NM_000251.2(MSH2):c.1455G>A (p.Met485Ile) rs876659702
NM_000251.2(MSH2):c.1457_1460delATGA (p.Asn486Thrfs) rs1114167806
NM_000251.2(MSH2):c.1457_1460dup (p.Asp487Glufs) rs1114167806
NM_000251.2(MSH2):c.1457delA (p.Asn486Metfs) rs63750986
NM_000251.2(MSH2):c.145_146delGA (p.Asp49Argfs) rs63750334
NM_000251.2(MSH2):c.145delG (p.Asp49Thrfs) rs63750644
NM_000251.2(MSH2):c.1461C>G (p.Asp487Glu) rs35107951
NM_000251.2(MSH2):c.1462T>G (p.Leu488Val) rs587781314
NM_000251.2(MSH2):c.1462_1463del (p.Leu488Glyfs) rs876658834
NM_000251.2(MSH2):c.1464G>A (p.Leu488=) rs1553365780
NM_000251.2(MSH2):c.1465G>A (p.Glu489Lys) rs876658187
NM_000251.2(MSH2):c.1465G>T (p.Glu489Ter) rs876658187
NM_000251.2(MSH2):c.1467A>C (p.Glu489Asp) rs1553365781
NM_000251.2(MSH2):c.1469A>G (p.Lys490Arg) rs1060502008
NM_000251.2(MSH2):c.146A>T (p.Asp49Val) rs63750335
NM_000251.2(MSH2):c.1470_1473delGAAGinsAAA (p.Met492Cysfs) rs1060502029
NM_000251.2(MSH2):c.1473G>T (p.Lys491Asn) rs1064795039
NM_000251.2(MSH2):c.1474A>T (p.Met492Leu) rs774419666
NM_000251.2(MSH2):c.1475T>C (p.Met492Thr) rs1357803103
NM_000251.2(MSH2):c.1476G>A (p.Met492Ile) rs1553365792
NM_000251.2(MSH2):c.1476_1477delGCinsCT (p.Met492_Gln493delinsIleTer) rs63750583
NM_000251.2(MSH2):c.1477C>T (p.Gln493Ter) rs63750936
NM_000251.2(MSH2):c.1478A>T (p.Gln493Leu) rs376990143
NM_000251.2(MSH2):c.1478delA (p.Gln493Argfs) rs1553365799
NM_000251.2(MSH2):c.147C>G (p.Asp49Glu) rs730881771
NM_000251.2(MSH2):c.1480T>C (p.Ser494Pro) rs55653533
NM_000251.2(MSH2):c.1481C>G (p.Ser494Ter) rs370970617
NM_000251.2(MSH2):c.1483A>G (p.Thr495Ala) rs730881757
NM_000251.2(MSH2):c.1484C>T (p.Thr495Ile) rs756516114
NM_000251.2(MSH2):c.1485A>G (p.Thr495=) rs767039383
NM_000251.2(MSH2):c.1487T>A (p.Leu496Ter) rs587779093
NM_000251.2(MSH2):c.1487T>C (p.Leu496Ser) rs587779093
NM_000251.2(MSH2):c.1488A>G (p.Leu496=) rs267607960
NM_000251.2(MSH2):c.1489A>G (p.Ile497Val) rs755501968
NM_000251.2(MSH2):c.1491A>G (p.Ile497Met)
NM_000251.2(MSH2):c.1491_1492insTT (p.Ser498Leufs)
NM_000251.2(MSH2):c.1493G>A (p.Ser498Asn) rs1553365810
NM_000251.2(MSH2):c.1494dupT (p.Ala499Cysfs) rs63750362
NM_000251.2(MSH2):c.1495G>C (p.Ala499Pro) rs1060502010
NM_000251.2(MSH2):c.1497A>G (p.Ala499=) rs1357985821
NM_000251.2(MSH2):c.1497delA (p.Ala500Profs) rs63749963
NM_000251.2(MSH2):c.149C>A (p.Ala50Glu) rs876658582
NM_000251.2(MSH2):c.149C>G (p.Ala50Gly) rs876658582
NM_000251.2(MSH2):c.14C>A (p.Pro5Gln) rs56170584
NM_000251.2(MSH2):c.14C>G (p.Pro5Arg) rs56170584
NM_000251.2(MSH2):c.14C>T (p.Pro5Leu) rs56170584
NM_000251.2(MSH2):c.1500dupC (p.Arg501Glnfs) rs587779094
NM_000251.2(MSH2):c.1505A>G (p.Asp502Gly) rs148192104
NM_000251.2(MSH2):c.1507C>G (p.Leu503Val)
NM_000251.2(MSH2):c.1507C>T (p.Leu503Phe) rs1553365825
NM_000251.2(MSH2):c.1508T>C (p.Leu503Pro) rs587779095
NM_000251.2(MSH2):c.1510+10G>A rs1553365836
NM_000251.2(MSH2):c.1510+11G>C rs370675562
NM_000251.2(MSH2):c.1510+19A>G
NM_000251.2(MSH2):c.1510+1G>A rs1114167852
NM_000251.2(MSH2):c.1510+2T>C rs1060502023
NM_000251.2(MSH2):c.1510+2_1510+50del
NM_000251.2(MSH2):c.1510+6_1510+7delAA rs1060502013
NM_000251.2(MSH2):c.1510+9G>A rs780895577
NM_000251.2(MSH2):c.1510G>C (p.Gly504Arg) rs63751600
NM_000251.2(MSH2):c.1511-10G>T rs587779096
NM_000251.2(MSH2):c.1511-10_1511-7delGATT rs864622529
NM_000251.2(MSH2):c.1511-12T>C
NM_000251.2(MSH2):c.1511-13_1511-9delCTTGAinsGT
NM_000251.2(MSH2):c.1511-1516C>T rs3771281
NM_000251.2(MSH2):c.1511-16C>T rs768540784
NM_000251.2(MSH2):c.1511-18_1511-14delTTCTT rs1553366489
NM_000251.2(MSH2):c.1511-18_1511-16delTTC rs1418866804
NM_000251.2(MSH2):c.1511-1G>A
NM_000251.2(MSH2):c.1511-2A>G rs267607962
NM_000251.2(MSH2):c.1511-41G>C rs202215396
NM_000251.2(MSH2):c.1511-4C>G rs1057523420
NM_000251.2(MSH2):c.1511-6A>G
NM_000251.2(MSH2):c.1511-91G>T rs3732182
NM_000251.2(MSH2):c.1511-9A>T rs12998837
NM_000251.2(MSH2):c.1511-?_2005+?del
NM_000251.2(MSH2):c.1511G>T (p.Gly504Val)
NM_000251.2(MSH2):c.1513T>C (p.Leu505=) rs1553366502
NM_000251.2(MSH2):c.1516G>T (p.Asp506Tyr) rs63750492
NM_000251.2(MSH2):c.1518C>A (p.Asp506Glu) rs1553366508
NM_000251.2(MSH2):c.1519C>A (p.Pro507Thr) rs1553366511
NM_000251.2(MSH2):c.1520delC (p.Pro507Leufs) rs1553366510
NM_000251.2(MSH2):c.1522G>A (p.Gly508Ser) rs267607968
NM_000251.2(MSH2):c.1523G>C (p.Gly508Ala) rs786202710
NM_000251.2(MSH2):c.1525A>T (p.Lys509Ter) rs730881758
NM_000251.2(MSH2):c.1527A>G (p.Lys509=) rs1212558633
NM_000251.2(MSH2):c.1528C>T (p.Gln510Ter) rs587779097
NM_000251.2(MSH2):c.1530G>A (p.Gln510=) rs587782355
NM_000251.2(MSH2):c.1530G>C (p.Gln510His) rs587782355
NM_000251.2(MSH2):c.1530G>T (p.Gln510His) rs587782355
NM_000251.2(MSH2):c.1533T>G (p.Ile511Met) rs1553366529
NM_000251.2(MSH2):c.1533del (p.Lys512Asnfs) rs1114167853
NM_000251.2(MSH2):c.1534_1543delAAACTGGATT (p.Lys512Profs) rs1553366522
NM_000251.2(MSH2):c.1537C>G (p.Leu513Val) rs1553366533
NM_000251.2(MSH2):c.1538_1539delTG (p.Leu513Argfs) rs863225391
NM_000251.2(MSH2):c.1539G>A (p.Leu513=) rs777195739
NM_000251.2(MSH2):c.153dup (p.Leu52Alafs) rs1553348842
NM_000251.2(MSH2):c.1545C>T (p.Ser515=) rs1553366537
NM_000251.2(MSH2):c.1546A>G (p.Ser516Gly) rs878853803
NM_000251.2(MSH2):c.1547G>A (p.Ser516Asn) rs373564353
NM_000251.2(MSH2):c.1547G>T (p.Ser516Ile) rs373564353
NM_000251.2(MSH2):c.1549G>A (p.Ala517Thr) rs1553366545
NM_000251.2(MSH2):c.154C>A (p.Leu52Met) rs786202335
NM_000251.2(MSH2):c.154C>G (p.Leu52Val) rs786202335
NM_000251.2(MSH2):c.154C>T (p.Leu52=) rs786202335
NM_000251.2(MSH2):c.154_155insG (p.Leu52Argfs) rs63750352
NM_000251.2(MSH2):c.1550C>T (p.Ala517Val) rs1060501997
NM_000251.2(MSH2):c.1552C>T (p.Gln518Ter) rs63750780
NM_000251.2(MSH2):c.1552_1553delCA (p.Gln518Valfs) rs63749930
NM_000251.2(MSH2):c.1553A>C (p.Gln518Pro) rs763323368
NM_000251.2(MSH2):c.1557delT (p.Phe519Leufs) rs1553366554
NM_000251.2(MSH2):c.1560A>G (p.Gly520=) rs63750820
NM_000251.2(MSH2):c.1560dup (p.Tyr521Ilefs) rs1553366561
NM_000251.2(MSH2):c.1561T>A (p.Tyr521Asn) rs1553366562
NM_000251.2(MSH2):c.1562A>T (p.Tyr521Phe) rs879254040
NM_000251.2(MSH2):c.1563T>A (p.Tyr521Ter) rs63750330
NM_000251.2(MSH2):c.1563T>C (p.Tyr521=) rs63750330
NM_000251.2(MSH2):c.1564T>C (p.Tyr522His) rs1553366567
NM_000251.2(MSH2):c.1565_1568delACTT (p.Tyr522Phefs) rs1064793561
NM_000251.2(MSH2):c.1566C>A (p.Tyr522Ter) rs63750224
NM_000251.2(MSH2):c.1566C>G (p.Tyr522Ter) rs63750224
NM_000251.2(MSH2):c.1567T>A (p.Phe523Ile) rs267607966
NM_000251.2(MSH2):c.1568T>C (p.Phe523Ser) rs587782587
NM_000251.2(MSH2):c.156G>A (p.Leu52=) rs750241099
NM_000251.2(MSH2):c.156G>C (p.Leu52=) rs750241099
NM_000251.2(MSH2):c.1570C>T (p.Arg524Cys) rs755818010
NM_000251.2(MSH2):c.1570delC (p.Arg524Valfs) rs1064795653
NM_000251.2(MSH2):c.1571G>A (p.Arg524His) rs63751207
NM_000251.2(MSH2):c.1571G>C (p.Arg524Pro) rs63751207
NM_000251.2(MSH2):c.1571G>T (p.Arg524Leu) rs63751207
NM_000251.2(MSH2):c.1573G>A (p.Val525Ile) rs1396878326
NM_000251.2(MSH2):c.1576delA (p.Thr526Profs) rs63750094
NM_000251.2(MSH2):c.1576dup (p.Thr526Asnfs) rs63750094
NM_000251.2(MSH2):c.1577C>A (p.Thr526Asn) rs1204369578
NM_000251.2(MSH2):c.1577C>T (p.Thr526Ile)
NM_000251.2(MSH2):c.1578C>G (p.Thr526=) rs1057520435
NM_000251.2(MSH2):c.1578delC (p.Cys527Valfs) rs63750738
NM_000251.2(MSH2):c.1579dup (p.Cys527Leufs) rs1553366583
NM_000251.2(MSH2):c.157G>A (p.Ala53Thr) rs755931648
NM_000251.2(MSH2):c.157G>T (p.Ala53Ser) rs755931648
NM_000251.2(MSH2):c.1580G>C (p.Cys527Ser) rs1553366585
NM_000251.2(MSH2):c.1581T>C (p.Cys527=) rs1249471315
NM_000251.2(MSH2):c.1582A>C (p.Lys528Gln) rs199744440
NM_000251.2(MSH2):c.1584G>A (p.Lys528=) rs1453387283
NM_000251.2(MSH2):c.1587A>G (p.Glu529=) rs1553366594
NM_000251.2(MSH2):c.1587_1597delAGAAAAAGTCCinsT (p.Glu529Aspfs) rs1114167820
NM_000251.2(MSH2):c.1587delA (p.Glu530Lysfs) rs63750845
NM_000251.2(MSH2):c.158C>G (p.Ala53Gly)
NM_000251.2(MSH2):c.1593A>C (p.Lys531Asn) rs1553366599
NM_000251.2(MSH2):c.1593_1613del21 (p.Lys531_Lys537del) rs63750510
NM_000251.2(MSH2):c.1594dupG (p.Val532Glyfs) rs63750104
NM_000251.2(MSH2):c.1595T>C (p.Val532Ala) rs754778750
NM_000251.2(MSH2):c.1596C>T (p.Val532=) rs1553366607
NM_000251.2(MSH2):c.1597C>G (p.Leu533Val) rs786202987
NM_000251.2(MSH2):c.159C>T (p.Ala53=) rs780178752
NM_000251.2(MSH2):c.15G>A (p.Pro5=) rs758054171
NM_000251.2(MSH2):c.15G>T (p.Pro5=) rs758054171
NM_000251.2(MSH2):c.1600C>T (p.Arg534Cys) rs63750029
NM_000251.2(MSH2):c.1601G>A (p.Arg534His) rs587778523
NM_000251.2(MSH2):c.1601G>C (p.Arg534Pro) rs587778523
NM_000251.2(MSH2):c.1601G>T (p.Arg534Leu) rs587778523
NM_000251.2(MSH2):c.1602T>A (p.Arg534=) rs267607965
NM_000251.2(MSH2):c.1605C>G (p.Asn535Lys) rs587779098
NM_000251.2(MSH2):c.1605C>T (p.Asn535=) rs587779098
NM_000251.2(MSH2):c.1607A>G (p.Asn536Ser)
NM_000251.2(MSH2):c.1607A>T (p.Asn536Ile) rs201722703
NM_000251.2(MSH2):c.160G>A (p.Ala54Thr) rs749212640
NM_000251.2(MSH2):c.160G>T (p.Ala54Ser) rs749212640
NM_000251.2(MSH2):c.160del (p.Ala54Profs) rs876660480
NM_000251.2(MSH2):c.1610A>G (p.Lys537Arg)
NM_000251.2(MSH2):c.1612A>G (p.Asn538Asp) rs1553366615
NM_000251.2(MSH2):c.1613A>T (p.Asn538Ile) rs1553366617
NM_000251.2(MSH2):c.1615T>C (p.Phe539Leu)
NM_000251.2(MSH2):c.1617T>A (p.Phe539Leu) rs730881759
NM_000251.2(MSH2):c.1617T>C (p.Phe539=) rs730881759
NM_000251.2(MSH2):c.1618A>C (p.Ser540Arg) rs1268933712
NM_000251.2(MSH2):c.1619G>A (p.Ser540Asn)
NM_000251.2(MSH2):c.1619G>C (p.Ser540Thr) rs1553366622
NM_000251.2(MSH2):c.161C>T (p.Ala54Val) rs768661914
NM_000251.2(MSH2):c.1620T>C (p.Ser540=) rs1057521172
NM_000251.2(MSH2):c.1622C>T (p.Thr541Ile) rs864622079
NM_000251.2(MSH2):c.1623T>G (p.Thr541=)
NM_000251.2(MSH2):c.1625T>C (p.Val542Ala) rs1553366630
NM_000251.2(MSH2):c.1626A>G (p.Val542=) rs1553366635
NM_000251.2(MSH2):c.1627delG (p.Asp543Ilefs) rs63750675
NM_000251.2(MSH2):c.1629T>G (p.Asp543Glu) rs1553366639
NM_000251.2(MSH2):c.162C>T (p.Ala54=) rs1045377929
NM_000251.2(MSH2):c.1631T>C (p.Ile544Thr) rs587778524
NM_000251.2(MSH2):c.1632C>G (p.Ile544Met)
NM_000251.2(MSH2):c.1637_1638insA (p.Asn547Glufs) rs1553366642
NM_000251.2(MSH2):c.1638G>A (p.Lys546=) rs372350768
NM_000251.2(MSH2):c.1638G>C (p.Lys546Asn) rs372350768
NM_000251.2(MSH2):c.1638_1639dupGA (p.Asn547Argfs) rs63750662
NM_000251.2(MSH2):c.163C>G (p.Arg55Gly) rs587782354
NM_000251.2(MSH2):c.163delC (p.Arg55Glyfs) rs63750337
NM_000251.2(MSH2):c.1640A>G (p.Asn547Ser) rs267607967
NM_000251.2(MSH2):c.1642G>T (p.Gly548Cys) rs63750538
NM_000251.2(MSH2):c.1645G>A (p.Val549Ile) rs876659905
NM_000251.2(MSH2):c.1645G>T (p.Val549Phe) rs876659905
NM_000251.2(MSH2):c.1647T>C (p.Val549=) rs763525239
NM_000251.2(MSH2):c.1648A>G (p.Lys550Glu)
NM_000251.2(MSH2):c.1648A>T (p.Lys550Ter)
NM_000251.2(MSH2):c.1649_1650del (p.Lys550Ilefs) rs1114167835
NM_000251.2(MSH2):c.164G>A (p.Arg55Gln) rs748196422
NM_000251.2(MSH2):c.1650A>C (p.Lys550Asn) rs1553366663
NM_000251.2(MSH2):c.1652T>A (p.Phe551Tyr) rs1114167849
NM_000251.2(MSH2):c.1653T>A (p.Phe551Leu) rs876660635
NM_000251.2(MSH2):c.1654A>C (p.Thr552Pro) rs63750838
NM_000251.2(MSH2):c.1654A>G (p.Thr552Ala) rs63750838
NM_000251.2(MSH2):c.1656C>T (p.Thr552=) rs876660600
NM_000251.2(MSH2):c.1656delC (p.Asn553Thrfs) rs1114167817
NM_000251.2(MSH2):c.1657A>G (p.Asn553Asp) rs772772789
NM_000251.2(MSH2):c.1657A>T (p.Asn553Tyr) rs772772789
NM_000251.2(MSH2):c.1659C>T (p.Asn553=) rs869312796
NM_000251.2(MSH2):c.165G>A (p.Arg55=) rs772201676
NM_000251.2(MSH2):c.165G>C (p.Arg55=) rs772201676
NM_000251.2(MSH2):c.1660A>C (p.Ser554Arg) rs63751656
NM_000251.2(MSH2):c.1660A>G (p.Ser554Gly) rs63751656
NM_000251.2(MSH2):c.1660A>T (p.Ser554Cys) rs63751656
NM_000251.2(MSH2):c.1661+10T>C rs1057522637
NM_000251.2(MSH2):c.1661+11C>T rs377154011
NM_000251.2(MSH2):c.1661+12G>A rs3732183
NM_000251.2(MSH2):c.1661+176A>G rs104895025
NM_000251.2(MSH2):c.1661+17T>G rs377461923
NM_000251.2(MSH2):c.1661+18A>G rs1057523193
NM_000251.2(MSH2):c.1661+19T>C rs910927543
NM_000251.2(MSH2):c.1661+1G>A rs267607969
NM_000251.2(MSH2):c.1661+1G>T rs267607969
NM_000251.2(MSH2):c.1661+25delT rs1553366691
NM_000251.2(MSH2):c.1661+2T>C rs1553366680
NM_000251.2(MSH2):c.1661+3T>C rs1064793688
NM_000251.2(MSH2):c.1661+5G>A rs267607972
NM_000251.2(MSH2):c.1661+5G>C rs267607972
NM_000251.2(MSH2):c.1661+5G>T rs267607972
NM_000251.2(MSH2):c.1661+6C>A rs267607973
NM_000251.2(MSH2):c.1661+6C>T rs267607973
NM_000251.2(MSH2):c.1661+6dupC rs863224832
NM_000251.2(MSH2):c.1661+73A>G rs180805863
NM_000251.2(MSH2):c.1661+7A>C rs753508952
NM_000251.2(MSH2):c.1661+90T>C rs10183143
NM_000251.2(MSH2):c.1661+9G>T rs1060504414
NM_000251.2(MSH2):c.1661G>A (p.Ser554Asn) rs63750597
NM_000251.2(MSH2):c.1661G>C (p.Ser554Thr) rs63750597
NM_000251.2(MSH2):c.1662-10C>T rs752606387
NM_000251.2(MSH2):c.1662-12_1677delTTCGATTTGCAGCAAATTGACTTCTTTA rs864622436
NM_000251.2(MSH2):c.1662-14A>G rs764784349
NM_000251.2(MSH2):c.1662-17G>C rs370327645
NM_000251.2(MSH2):c.1662-17G>T rs370327645
NM_000251.2(MSH2):c.1662-17_1662-16delGT rs1064794049
NM_000251.2(MSH2):c.1662-17dup rs587779099
NM_000251.2(MSH2):c.1662-18T>A rs376235435
NM_000251.2(MSH2):c.1662-18T>C rs376235435
NM_000251.2(MSH2):c.1662-18_1662-17delTGinsAT rs1553367553
NM_000251.2(MSH2):c.1662-1G>A rs267607970
NM_000251.2(MSH2):c.1662-23A>G rs56404027
NM_000251.2(MSH2):c.1662-2A>G rs267607971
NM_000251.2(MSH2):c.1662-3C>T rs878853804
NM_000251.2(MSH2):c.1662-7T>C
NM_000251.2(MSH2):c.1662-9G>A rs17218356
NM_000251.2(MSH2):c.1662-?_*(1_?)del
NM_000251.2(MSH2):c.1662-?_*(272_?)del
NM_000251.2(MSH2):c.1662-?_*(272_?)dup
NM_000251.2(MSH2):c.1662-?_1759+?del
NM_000251.2(MSH2):c.1662-?_1759+?dup98
NM_000251.2(MSH2):c.1662-?_2458+?del
NM_000251.2(MSH2):c.1662C>G (p.Ser554Arg)
NM_000251.2(MSH2):c.1662C>T (p.Ser554=) rs587778525
NM_000251.2(MSH2):c.1663A>C (p.Lys555Gln) rs1553367573
NM_000251.2(MSH2):c.1665delA (p.Lys555Asnfs) rs63751120
NM_000251.2(MSH2):c.1666T>C (p.Leu556=) rs61756466
NM_000251.2(MSH2):c.1666_1672delTTGACTT (p.Thr557Terfs) rs1064794071
NM_000251.2(MSH2):c.1667T>C (p.Leu556Ser) rs587779101
NM_000251.2(MSH2):c.1667T>G (p.Leu556Trp) rs587779101
NM_000251.2(MSH2):c.1667_1668insA (p.Thr557Aspfs) rs1553367587
NM_000251.2(MSH2):c.1667delT (p.Leu556Terfs) rs267607694
NM_000251.2(MSH2):c.1667dupT (p.Leu556Phefs) rs267607694
NM_000251.2(MSH2):c.1669A>C (p.Thr557Pro) rs63750432
NM_000251.2(MSH2):c.166G>A (p.Glu56Lys) rs587779102
NM_000251.2(MSH2):c.166G>C (p.Glu56Gln) rs587779102
NM_000251.2(MSH2):c.166G>T (p.Glu56Ter) rs587779102
NM_000251.2(MSH2):c.166delG (p.Glu56Argfs) rs63750087
NM_000251.2(MSH2):c.1670C>G (p.Thr557Ser) rs139920308
NM_000251.2(MSH2):c.1670C>T (p.Thr557Ile) rs139920308
NM_000251.2(MSH2):c.1673C>A (p.Ser558Tyr) rs1553367602
NM_000251.2(MSH2):c.1673C>T (p.Ser558Phe) rs1553367602
NM_000251.2(MSH2):c.1673_1675delCTT (p.Ser558del)
NM_000251.2(MSH2):c.1676delT (p.Leu559Terfs) rs63750633
NM_000251.2(MSH2):c.1677A>C (p.Leu559Phe)
NM_000251.2(MSH2):c.1679A>T (p.Asn560Ile) rs1429353441
NM_000251.2(MSH2):c.167A>T (p.Glu56Val) rs587782004
NM_000251.2(MSH2):c.167_184delAGGTGTTCAAGACCCAGG (p.Glu56_Gln61del) rs1553348867
NM_000251.2(MSH2):c.1680T>C (p.Asn560=) rs200056411
NM_000251.2(MSH2):c.1681G>A (p.Glu561Lys) rs63750328
NM_000251.2(MSH2):c.1681G>T (p.Glu561Ter) rs63750328
NM_000251.2(MSH2):c.1681_1682dup (p.Glu562Lysfs) rs1553367608
NM_000251.2(MSH2):c.1682_1685delAAGAinsTCTT (p.Glu561_Glu562delinsValLeu) rs1553367614
NM_000251.2(MSH2):c.1683delA (p.Glu562Serfs) rs63750406
NM_000251.2(MSH2):c.1684G>C (p.Glu562Gln) rs1114167816
NM_000251.2(MSH2):c.1684G>T (p.Glu562Ter) rs1114167816
NM_000251.2(MSH2):c.1685A>T (p.Glu562Val) rs63750997
NM_000251.2(MSH2):c.1686G>A (p.Glu562=) rs786203850
NM_000251.2(MSH2):c.1686G>C (p.Glu562Asp) rs786203850
NM_000251.2(MSH2):c.1687T>A (p.Tyr563Asn) rs1553367622
NM_000251.2(MSH2):c.1687dupT (p.Tyr563Leufs) rs587779103
NM_000251.2(MSH2):c.1688A>C (p.Tyr563Ser) rs63751054
NM_000251.2(MSH2):c.1689T>C (p.Tyr563=) rs1553367626
NM_000251.2(MSH2):c.1690A>G (p.Thr564Ala) rs55778204
NM_000251.2(MSH2):c.1691C>A (p.Thr564Asn) rs1553367632
NM_000251.2(MSH2):c.1691C>G (p.Thr564Ser) rs1553367632
NM_000251.2(MSH2):c.1692C>G (p.Thr564=) rs786203290
NM_000251.2(MSH2):c.1692_1693delCA (p.Asn566Terfs) rs1553367635
NM_000251.2(MSH2):c.1693A>T (p.Lys565Ter) rs587779104
NM_000251.2(MSH2):c.1696_1697delAA (p.Asn566Terfs) rs63750737
NM_000251.2(MSH2):c.1697_1709delATAAAACAGAATAinsTTCT (p.Asn566_Tyr570delinsIleLeu) rs1553367640
NM_000251.2(MSH2):c.1697del (p.Asn566Ilefs) rs63750737
NM_000251.2(MSH2):c.1699A>G (p.Lys567Glu) rs63751149
NM_000251.2(MSH2):c.1699A>T (p.Lys567Ter) rs63751149
NM_000251.2(MSH2):c.169G>A (p.Val57Met) rs267607913
NM_000251.2(MSH2):c.16A>G (p.Lys6Glu) rs777351049
NM_000251.2(MSH2):c.1700_1704delAAACA (p.Lys567Argfs) rs63750474
NM_000251.2(MSH2):c.1702dupA (p.Thr568Asnfs) rs587779105
NM_000251.2(MSH2):c.1703C>G (p.Thr568Arg) rs1285862035
NM_000251.2(MSH2):c.1703C>T (p.Thr568Ile) rs1285862035
NM_000251.2(MSH2):c.1705_1706delGA (p.Glu569Ilefs) rs63750393
NM_000251.2(MSH2):c.1705_1706dupGA (p.Tyr570Asnfs) rs63750393
NM_000251.2(MSH2):c.1705_1706insT (p.Glu569Valfs) rs587779106
NM_000251.2(MSH2):c.1706A>G (p.Glu569Gly) rs786201077
NM_000251.2(MSH2):c.1708T>C (p.Tyr570His) rs1553367656
NM_000251.2(MSH2):c.1708delT (p.Tyr570Metfs) rs1131692279
NM_000251.2(MSH2):c.1709A>G (p.Tyr570Cys) rs587779963
NM_000251.2(MSH2):c.170T>G (p.Val57Gly)
NM_000251.2(MSH2):c.1714_1715delGAinsAT (p.Glu572Ile)
NM_000251.2(MSH2):c.1717G>A (p.Ala573Thr) rs200766962
NM_000251.2(MSH2):c.1717delG (p.Ala573Profs) rs267607974
NM_000251.2(MSH2):c.1719C>T (p.Ala573=) rs1553367674
NM_000251.2(MSH2):c.1720C>T (p.Gln574Ter) rs63751298
NM_000251.2(MSH2):c.1720delC (p.Gln574Argfs) rs63751299
NM_000251.2(MSH2):c.1724A>G (p.Asp575Gly) rs370330868
NM_000251.2(MSH2):c.1726G>C (p.Ala576Pro) rs587779107
NM_000251.2(MSH2):c.1728C>T (p.Ala576=) rs1410386885
NM_000251.2(MSH2):c.1729A>G (p.Ile577Val) rs774985655
NM_000251.2(MSH2):c.172T>C (p.Phe58Leu)
NM_000251.2(MSH2):c.1730T>C (p.Ile577Thr) rs63749910
NM_000251.2(MSH2):c.1731T>C (p.Ile577=) rs876660581
NM_000251.2(MSH2):c.1737A>G (p.Lys579=) rs61756467
NM_000251.2(MSH2):c.1738G>T (p.Glu580Ter) rs63751411
NM_000251.2(MSH2):c.1738_1741delGAAA (p.Glu580Leufs) rs1057524910
NM_000251.2(MSH2):c.173T>C (p.Phe58Ser)
NM_000251.2(MSH2):c.1744delG (p.Val582Serfs) rs587779964
NM_000251.2(MSH2):c.1746C>A (p.Val582=) rs786201486
NM_000251.2(MSH2):c.1746C>T (p.Val582=) rs786201486
NM_000251.2(MSH2):c.1747_1748del (p.Asn583Tyrfs) rs1553367687
NM_000251.2(MSH2):c.1748A>C (p.Asn583Thr) rs201118107
NM_000251.2(MSH2):c.1748A>G (p.Asn583Ser) rs201118107
NM_000251.2(MSH2):c.1748A>T (p.Asn583Ile) rs201118107
NM_000251.2(MSH2):c.1749T>C (p.Asn583=) rs876659176
NM_000251.2(MSH2):c.174C>A (p.Phe58Leu) rs372189599
NM_000251.2(MSH2):c.174C>G (p.Phe58Leu) rs372189599
NM_000251.2(MSH2):c.174C>T (p.Phe58=) rs372189599
NM_000251.2(MSH2):c.1750A>G (p.Ile584Val)
NM_000251.2(MSH2):c.1754C>T (p.Ser585Phe)
NM_000251.2(MSH2):c.1755T>C (p.Ser585=) rs63750112
NM_000251.2(MSH2):c.1757C>G (p.Ser586Ter) rs1114167854
NM_000251.2(MSH2):c.1759+107A>G rs3764959
NM_000251.2(MSH2):c.1759+10A>G rs1553367706
NM_000251.2(MSH2):c.1759+11_1759+15delTAGAA rs878853805
NM_000251.2(MSH2):c.1759+1281G>A rs77300212
NM_000251.2(MSH2):c.1759+13G>T rs1057521236
NM_000251.2(MSH2):c.1759+13_1759+15delGAAinsATGTTCTAATAATT rs886039593
NM_000251.2(MSH2):c.1759+16C>G rs1057517573
NM_000251.2(MSH2):c.1759+183G>A rs3764960
NM_000251.2(MSH2):c.1759+1G>A rs587779108
NM_000251.2(MSH2):c.1759+1G>C rs587779108
NM_000251.2(MSH2):c.1759+1G>T
NM_000251.2(MSH2):c.1759+2T>A rs267607976
NM_000251.2(MSH2):c.1759+2T>C rs267607976
NM_000251.2(MSH2):c.1759+3A>T rs863224630
NM_000251.2(MSH2):c.1759+501A>G rs17036614
NM_000251.2(MSH2):c.1759+57G>T rs17218363
NM_000251.2(MSH2):c.1759+7T>G rs1350919914
NM_000251.2(MSH2):c.1759+9A>C rs994093288
NM_000251.2(MSH2):c.1759G>A (p.Gly587Ser) rs63751140
NM_000251.2(MSH2):c.1759G>C (p.Gly587Arg) rs63751140
NM_000251.2(MSH2):c.1759G>T (p.Gly587Cys) rs63751140
NM_000251.2(MSH2):c.175A>T (p.Lys59Ter) rs771255106
NM_000251.2(MSH2):c.1760-10T>A rs767536391
NM_000251.2(MSH2):c.1760-110_1760-108dup rs587779109
NM_000251.2(MSH2):c.1760-16T>G rs768370188
NM_000251.2(MSH2):c.1760-19delT rs1223758476
NM_000251.2(MSH2):c.1760-1G>A rs587779110
NM_000251.2(MSH2):c.1760-2_1783del26 rs1064795329
NM_000251.2(MSH2):c.1760-3C>G
NM_000251.2(MSH2):c.1760-3C>T rs786202843
NM_000251.2(MSH2):c.1760-4A>G rs1060504409
NM_000251.2(MSH2):c.1760-62G>A rs17218439
NM_000251.2(MSH2):c.1760-7T>C rs972129356
NM_000251.2(MSH2):c.1760-7delT rs754968844
NM_000251.2(MSH2):c.1760-?_*(272_?)del
NM_000251.2(MSH2):c.1760-?_2005+?del
NM_000251.2(MSH2):c.1760-?_2210+?del
NM_000251.2(MSH2):c.1760-?_2458+?del
NM_000251.2(MSH2):c.1760G>T (p.Gly587Val)
NM_000251.2(MSH2):c.1760delG (p.Gly587Alafs) rs63750103
NM_000251.2(MSH2):c.1761C>G (p.Gly587=) rs920449426
NM_000251.2(MSH2):c.1764T>C (p.Tyr588=) rs63750844
NM_000251.2(MSH2):c.1764T>G (p.Tyr588Ter) rs63750844
NM_000251.2(MSH2):c.1765G>A (p.Val589Ile) rs1064793981
NM_000251.2(MSH2):c.1770A>C (p.Glu590Asp) rs760619442
NM_000251.2(MSH2):c.1770A>G (p.Glu590=) rs760619442
NM_000251.2(MSH2):c.1771C>A (p.Pro591Thr) rs951988481
NM_000251.2(MSH2):c.1771_1772insA (p.Pro591Hisfs) rs267607977
NM_000251.2(MSH2):c.1772C>T (p.Pro591Leu) rs587782643
NM_000251.2(MSH2):c.1773A>G (p.Pro591=) rs786203894
NM_000251.2(MSH2):c.1774A>G (p.Met592Val) rs371614039
NM_000251.2(MSH2):c.1777C>G (p.Gln593Glu) rs63750200
NM_000251.2(MSH2):c.1777C>T (p.Gln593Ter) rs63750200
NM_000251.2(MSH2):c.1778A>T (p.Gln593Leu)
NM_000251.2(MSH2):c.1779G>C (p.Gln593His) rs1553368505
NM_000251.2(MSH2):c.1779_1782delGACA (p.Gln593Hisfs) rs63750113
NM_000251.2(MSH2):c.1781C>T (p.Thr594Ile) rs1553368510
NM_000251.2(MSH2):c.1781_1782insCT (p.Leu595Tyrfs) rs267607691
NM_000251.2(MSH2):c.1782A>G (p.Thr594=) rs1316152213
NM_000251.2(MSH2):c.1782dup (p.Leu595Thrfs) rs876658940
NM_000251.2(MSH2):c.1783C>G (p.Leu595Val) rs1553368514
NM_000251.2(MSH2):c.1783C>T (p.Leu595Phe) rs1553368514
NM_000251.2(MSH2):c.1784T>G (p.Leu595Arg) rs786201590
NM_000251.2(MSH2):c.1784dup (p.Asn596Glnfs) rs1553368518
NM_000251.2(MSH2):c.1785C>T (p.Leu595=) rs1553368520
NM_000251.2(MSH2):c.1786A>C (p.Asn596His) rs1064794906
NM_000251.2(MSH2):c.1786_1788delAAT (p.Asn596del) rs63749831
NM_000251.2(MSH2):c.1786_1790delAATGAinsGG (p.Asn596_Asp597delinsGly)
NM_000251.2(MSH2):c.1787A>G (p.Asn596Ser) rs41295288
NM_000251.2(MSH2):c.1787dupA (p.Asn596Lysfs) rs587779111
NM_000251.2(MSH2):c.1788_1789delTG (p.Asn596Lysfs) rs63750495
NM_000251.2(MSH2):c.1789G>A (p.Asp597Asn) rs765442101
NM_000251.2(MSH2):c.1790A>C (p.Asp597Ala) rs548407418
NM_000251.2(MSH2):c.1790A>G (p.Asp597Gly) rs548407418
NM_000251.2(MSH2):c.1790A>T (p.Asp597Val) rs548407418
NM_000251.2(MSH2):c.1791T>C (p.Asp597=) rs758742390
NM_000251.2(MSH2):c.1792G>A (p.Val598Met) rs778152746
NM_000251.2(MSH2):c.1793del (p.Val598Glyfs) rs786202790
NM_000251.2(MSH2):c.1794_1803del (p.Leu599Terfs) rs1553368540
NM_000251.2(MSH2):c.1796T>C (p.Leu599Ser) rs747504492
NM_000251.2(MSH2):c.1796delT (p.Leu599Terfs) rs1060502039
NM_000251.2(MSH2):c.1798G>T (p.Ala600Ser) rs587778526
NM_000251.2(MSH2):c.1799C>G (p.Ala600Gly) rs63751236
NM_000251.2(MSH2):c.1799C>T (p.Ala600Val) rs63751236
NM_000251.2(MSH2):c.1801C>T (p.Gln601Ter) rs63750047
NM_000251.2(MSH2):c.1802A>G (p.Gln601Arg) rs779447213
NM_000251.2(MSH2):c.1803G>A (p.Gln601=) rs1553368556
NM_000251.2(MSH2):c.1803G>C (p.Gln601His) rs1553368556
NM_000251.2(MSH2):c.1803G>T (p.Gln601His) rs1553368556
NM_000251.2(MSH2):c.1803dup (p.Leu602Alafs) rs786203704
NM_000251.2(MSH2):c.1804C>G (p.Leu602Val) rs748797209
NM_000251.2(MSH2):c.1805T>C (p.Leu602Pro) rs1553368561
NM_000251.2(MSH2):c.1807G>A (p.Asp603Asn) rs63750657
NM_000251.2(MSH2):c.1807G>C (p.Asp603His) rs63750657
NM_000251.2(MSH2):c.1808A>G (p.Asp603Gly) rs267607985
NM_000251.2(MSH2):c.1808A>T (p.Asp603Val) rs267607985
NM_000251.2(MSH2):c.1809delT (p.Asp603Glufs) rs63751129
NM_000251.2(MSH2):c.1809dup (p.Ala604Cysfs) rs1114167876
NM_000251.2(MSH2):c.180C>G (p.Thr60=) rs760058815
NM_000251.2(MSH2):c.1810G>A (p.Ala604Thr) rs1553368568
NM_000251.2(MSH2):c.1812_1819dup (p.Ser607Metfs) rs1553368570
NM_000251.2(MSH2):c.1813G>A (p.Val605Ile) rs730881777
NM_000251.2(MSH2):c.1813G>C (p.Val605Leu) rs730881777
NM_000251.2(MSH2):c.1813G>T (p.Val605Phe) rs730881777
NM_000251.2(MSH2):c.1814T>C (p.Val605Ala) rs1064794881
NM_000251.2(MSH2):c.1815_1817delTGT (p.Val606del) rs267607978
NM_000251.2(MSH2):c.1817T>A (p.Val606Asp) rs376044376
NM_000251.2(MSH2):c.1817T>C (p.Val606Ala) rs376044376
NM_000251.2(MSH2):c.1818_1877del60 (p.Ser607_Glu626del) rs1553368576
NM_000251.2(MSH2):c.1819A>G (p.Ser607Gly)
NM_000251.2(MSH2):c.181C>G (p.Gln61Glu) rs63750951
NM_000251.2(MSH2):c.181C>T (p.Gln61Ter) rs63750951
NM_000251.2(MSH2):c.1821C>T (p.Ser607=)
NM_000251.2(MSH2):c.1825G>C (p.Ala609Pro) rs150980616
NM_000251.2(MSH2):c.1825G>T (p.Ala609Ser) rs150980616
NM_000251.2(MSH2):c.1826C>G (p.Ala609Gly)
NM_000251.2(MSH2):c.1826C>T (p.Ala609Val) rs63750665
NM_000251.2(MSH2):c.1827delT (p.His610Thrfs) rs587779112
NM_000251.2(MSH2):c.1828C>A (p.His610Asn) rs267607980
NM_000251.2(MSH2):c.1828C>T (p.His610Tyr) rs267607980
NM_000251.2(MSH2):c.182A>C (p.Gln61Pro) rs587779113
NM_000251.2(MSH2):c.182delA (p.Gln61Argfs) rs1553348882
NM_000251.2(MSH2):c.1830C>G (p.His610Gln) rs766326295
NM_000251.2(MSH2):c.1830C>T (p.His610=) rs766326295
NM_000251.2(MSH2):c.1831G>A (p.Val611Met) rs369385048
NM_000251.2(MSH2):c.1831G>C (p.Val611Leu) rs369385048
NM_000251.2(MSH2):c.1832T>A (p.Val611Glu) rs1553368590
NM_000251.2(MSH2):c.1834del (p.Ser612Glnfs) rs1114167879
NM_000251.2(MSH2):c.1835C>G (p.Ser612Ter) rs63750493
NM_000251.2(MSH2):c.1837A>C (p.Asn613His) rs200147804
NM_000251.2(MSH2):c.1837A>T (p.Asn613Tyr) rs200147804
NM_000251.2(MSH2):c.1838A>T (p.Asn613Ile) rs1553368595
NM_000251.2(MSH2):c.1838dup (p.Asn613Lysfs) rs1114167815
NM_000251.2(MSH2):c.1839T>C (p.Asn613=) rs1114167868
NM_000251.2(MSH2):c.183G>C (p.Gln61His) rs751082926
NM_000251.2(MSH2):c.183G>T (p.Gln61His) rs751082926
NM_000251.2(MSH2):c.1842A>C (p.Gly614=) rs923770168
NM_000251.2(MSH2):c.1843G>C (p.Ala615Pro) rs1223047169
NM_000251.2(MSH2):c.1843_1844del (p.Ala615Thrfs) rs1114167856
NM_000251.2(MSH2):c.1844C>T (p.Ala615Val) rs765493709
NM_000251.2(MSH2):c.1846C>T (p.Pro616Ser) rs587782627
NM_000251.2(MSH2):c.1847C>G (p.Pro616Arg) rs587779965
NM_000251.2(MSH2):c.1849G>C (p.Val617Leu) rs1224364754
NM_000251.2(MSH2):c.184G>A (p.Gly62Arg) rs767140240
NM_000251.2(MSH2):c.184G>C (p.Gly62Arg) rs767140240
NM_000251.2(MSH2):c.1850T>C (p.Val617Ala)
NM_000251.2(MSH2):c.1853C>T (p.Pro618Leu) rs1486519909
NM_000251.2(MSH2):c.1853delC (p.Pro618Hisfs) rs267607984
NM_000251.2(MSH2):c.1854A>G (p.Pro618=) rs786203744
NM_000251.2(MSH2):c.1856A>G (p.Tyr619Cys) rs63749982
NM_000251.2(MSH2):c.1857T>G (p.Tyr619Ter) rs63750312
NM_000251.2(MSH2):c.1858_1859dupGT (p.Arg621Tyrfs) rs63750806
NM_000251.2(MSH2):c.185G>A (p.Gly62Glu) rs879254195
NM_000251.2(MSH2):c.185G>C (p.Gly62Ala) rs879254195
NM_000251.2(MSH2):c.1861C>G (p.Arg621Gly) rs63750508
NM_000251.2(MSH2):c.1861C>T (p.Arg621Ter) rs63750508
NM_000251.2(MSH2):c.1862G>A (p.Arg621Gln) rs759263820
NM_000251.2(MSH2):c.1862G>C (p.Arg621Pro) rs759263820
NM_000251.2(MSH2):c.1862G>T (p.Arg621Leu) rs759263820
NM_000251.2(MSH2):c.1863A>T (p.Arg621=) rs786203119
NM_000251.2(MSH2):c.1864C>A (p.Pro622Thr) rs63750280
NM_000251.2(MSH2):c.1864C>G (p.Pro622Ala) rs63750280
NM_000251.2(MSH2):c.1865C>A (p.Pro622Gln) rs28929483
NM_000251.2(MSH2):c.1865C>G (p.Pro622Arg) rs28929483
NM_000251.2(MSH2):c.1865C>T (p.Pro622Leu) rs28929483
NM_000251.2(MSH2):c.1866A>C (p.Pro622=) rs757766951
NM_000251.2(MSH2):c.1867G>T (p.Ala623Ser) rs1114167846
NM_000251.2(MSH2):c.1867delG (p.Ala623Profs) rs879254204
NM_000251.2(MSH2):c.1868C>T (p.Ala623Val) rs781698416
NM_000251.2(MSH2):c.1869C>G (p.Ala623=) rs1553368623
NM_000251.2(MSH2):c.1869C>T (p.Ala623=) rs1553368623
NM_000251.2(MSH2):c.186G>A (p.Gly62=) rs750058876
NM_000251.2(MSH2):c.186G>C (p.Gly62=) rs750058876
NM_000251.2(MSH2):c.186G>T (p.Gly62=) rs750058876
NM_000251.2(MSH2):c.186_187dupGG (p.Val63Glyfs) rs63750160
NM_000251.2(MSH2):c.1870A>G (p.Ile624Val) rs1553368626
NM_000251.2(MSH2):c.1871T>G (p.Ile624Ser) rs1114167870
NM_000251.2(MSH2):c.1873T>C (p.Leu625=) rs63750669
NM_000251.2(MSH2):c.1873T>G (p.Leu625Val) rs63750669
NM_000251.2(MSH2):c.1879A>G (p.Lys627Glu)
NM_000251.2(MSH2):c.187G>A (p.Val63Met) rs1553348889
NM_000251.2(MSH2):c.187G>T (p.Val63Leu) rs1553348889
NM_000251.2(MSH2):c.187delG (p.Val63Terfs) rs63750160
NM_000251.2(MSH2):c.187dupG (p.Val63Glyfs) rs63750160
NM_000251.2(MSH2):c.1881A>C (p.Lys627Asn) rs63750626
NM_000251.2(MSH2):c.1881A>G (p.Lys627=)
NM_000251.2(MSH2):c.1882G>C (p.Gly628Arg) rs371776176
NM_000251.2(MSH2):c.1882G>T (p.Gly628Ter) rs371776176
NM_000251.2(MSH2):c.1883G>A (p.Gly628Glu) rs879254044
NM_000251.2(MSH2):c.1883G>C (p.Gly628Ala) rs879254044
NM_000251.2(MSH2):c.1883G>T (p.Gly628Val) rs879254044
NM_000251.2(MSH2):c.1883delG (p.Gly628Aspfs) rs1064795127
NM_000251.2(MSH2):c.1884A>G (p.Gly628=) rs786202663
NM_000251.2(MSH2):c.1884A>T (p.Gly628=) rs786202663
NM_000251.2(MSH2):c.1885C>T (p.Gln629Ter) rs63750203
NM_000251.2(MSH2):c.1886A>G (p.Gln629Arg) rs61756468
NM_000251.2(MSH2):c.1888G>C (p.Gly630Arg) rs1114167866
NM_000251.2(MSH2):c.1888G>T (p.Gly630Ter) rs1114167866
NM_000251.2(MSH2):c.1889G>T (p.Gly630Val) rs866809097
NM_000251.2(MSH2):c.1889_1892delGAAG (p.Gly630Glufs) rs63750960
NM_000251.2(MSH2):c.188T>A (p.Val63Glu)
NM_000251.2(MSH2):c.1892G>A (p.Arg631Lys) rs1361816581
NM_000251.2(MSH2):c.1893A>T (p.Arg631Ser) rs747805096
NM_000251.2(MSH2):c.1894A>G (p.Ile632Val) rs1301770111
NM_000251.2(MSH2):c.1897A>G (p.Ile633Val) rs771695599
NM_000251.2(MSH2):c.1897dupA (p.Ile633Asnfs) rs587779114
NM_000251.2(MSH2):c.1898T>C (p.Ile633Thr) rs864622093
NM_000251.2(MSH2):c.18G>A (p.Lys6=) rs146017810
NM_000251.2(MSH2):c.1901T>G (p.Leu634Ter) rs1114167811
NM_000251.2(MSH2):c.1906G>C (p.Ala636Pro) rs63750875
NM_000251.2(MSH2):c.1907C>T (p.Ala636Val) rs63750279
NM_000251.2(MSH2):c.1908A>G (p.Ala636=) rs1553368652
NM_000251.2(MSH2):c.1910C>G (p.Ser637Cys) rs1064795992
NM_000251.2(MSH2):c.1911delC (p.Arg638Glyfs) rs63750893
NM_000251.2(MSH2):c.1912A>G (p.Arg638Gly) rs267607981
NM_000251.2(MSH2):c.1914G>A (p.Arg638=) rs1177447151
NM_000251.2(MSH2):c.1915C>T (p.His639Tyr) rs28929484
NM_000251.2(MSH2):c.1916A>G (p.His639Arg) rs587779116
NM_000251.2(MSH2):c.1916_1919delATGC (p.His639Leufs) rs730881776
NM_000251.2(MSH2):c.1917T>A (p.His639Gln) rs1800152
NM_000251.2(MSH2):c.1918G>T (p.Ala640Ser)
NM_000251.2(MSH2):c.1921T>G (p.Cys641Gly) rs63749946
NM_000251.2(MSH2):c.1922G>A (p.Cys641Tyr) rs786204110
NM_000251.2(MSH2):c.1924G>A (p.Val642Ile) rs776528054
NM_000251.2(MSH2):c.1924G>T (p.Val642Phe) rs776528054
NM_000251.2(MSH2):c.1924_1925delGT (p.Val642Terfs) rs587779117
NM_000251.2(MSH2):c.1924_1928delGTTGAinsTTTC (p.Val642Phefs) rs1114167882
NM_000251.2(MSH2):c.1927G>A (p.Glu643Lys) rs374840361
NM_000251.2(MSH2):c.192C>G (p.Ile64Met)
NM_000251.2(MSH2):c.192dup (p.Lys65Glnfs) rs1553348896
NM_000251.2(MSH2):c.1930del (p.Val644Phefs) rs1114167823
NM_000251.2(MSH2):c.1933C>G (p.Gln645Glu) rs267607982
NM_000251.2(MSH2):c.1933C>T (p.Gln645Ter) rs267607982
NM_000251.2(MSH2):c.1935A>C (p.Gln645His) rs587780684
NM_000251.2(MSH2):c.1935A>G (p.Gln645=) rs587780684
NM_000251.2(MSH2):c.1937A>C (p.Asp646Ala) rs41295290
NM_000251.2(MSH2):c.1937A>G (p.Asp646Gly) rs41295290
NM_000251.2(MSH2):c.1938T>C (p.Asp646=) rs775484022
NM_000251.2(MSH2):c.1939G>C (p.Glu647Gln) rs63750078
NM_000251.2(MSH2):c.193_194insTC (p.Lys65Ilefs) rs1553348898
NM_000251.2(MSH2):c.1942_1945delATTG (p.Ile648Hisfs) rs1553368675
NM_000251.2(MSH2):c.1943T>A (p.Ile648Asn) rs763100088
NM_000251.2(MSH2):c.1945G>A (p.Ala649Thr) rs786201822
NM_000251.2(MSH2):c.1946C>T (p.Ala649Val) rs876659816
NM_000251.2(MSH2):c.1946_1960delCATTTATTCCTAATG (p.Ala649_Asn653del) rs1064793455
NM_000251.2(MSH2):c.1950dup (p.Ile651Tyrfs) rs1114167844
NM_000251.2(MSH2):c.1951A>G (p.Ile651Val) rs878853806
NM_000251.2(MSH2):c.1954C>A (p.Pro652Thr) rs876660900
NM_000251.2(MSH2):c.1954C>G (p.Pro652Ala) rs876660900
NM_000251.2(MSH2):c.1955C>A (p.Pro652His) rs267607983
NM_000251.2(MSH2):c.1956T>C (p.Pro652=)
NM_000251.2(MSH2):c.1958_1965delATGACGTA (p.Asn653Ilefs)
NM_000251.2(MSH2):c.1962C>G (p.Asp654Glu) rs751939698
NM_000251.2(MSH2):c.1962C>T (p.Asp654=) rs751939698
NM_000251.2(MSH2):c.1963G>A (p.Val655Ile) rs549467183
NM_000251.2(MSH2):c.1963_1964delGT (p.Val655Ilefs) rs864622121
NM_000251.2(MSH2):c.1965A>C (p.Val655=) rs767941059
NM_000251.2(MSH2):c.1965A>G (p.Val655=)
NM_000251.2(MSH2):c.1967A>C (p.Tyr656Ser) rs185356145
NM_000251.2(MSH2):c.1967A>G (p.Tyr656Cys) rs185356145
NM_000251.2(MSH2):c.1967_1970dupACTT (p.Phe657Leufs) rs587779118
NM_000251.2(MSH2):c.1968C>A (p.Tyr656Ter) rs63751317
NM_000251.2(MSH2):c.1968C>G (p.Tyr656Ter) rs63751317
NM_000251.2(MSH2):c.1968C>T (p.Tyr656=) rs63751317
NM_000251.2(MSH2):c.1968del (p.Phe657Leufs) rs1114167805
NM_000251.2(MSH2):c.1972G>C (p.Glu658Gln)
NM_000251.2(MSH2):c.1973A>G (p.Glu658Gly) rs200827721
NM_000251.2(MSH2):c.1979A>G (p.Asp660Gly) rs1085308057
NM_000251.2(MSH2):c.1980T>A (p.Asp660Glu) rs1060501988
NM_000251.2(MSH2):c.1980_1981delTA (p.Asp660Glufs) rs587779119
NM_000251.2(MSH2):c.1981A>G (p.Lys661Glu) rs1553368707
NM_000251.2(MSH2):c.1982A>G (p.Lys661Arg)
NM_000251.2(MSH2):c.1982_1985delAACA (p.Lys661Argfs) rs587779120
NM_000251.2(MSH2):c.1984C>T (p.Gln662Ter) rs786204321
NM_000251.2(MSH2):c.1984_1985delCA (p.Gln662Aspfs) rs587779121
NM_000251.2(MSH2):c.1986G>A (p.Gln662=) rs587780685
NM_000251.2(MSH2):c.1986G>C (p.Gln662His) rs587780685
NM_000251.2(MSH2):c.1986_1987delGA (p.Gln662Hisfs) rs587779122
NM_000251.2(MSH2):c.1986delG (p.Met663Cysfs) rs63749929
NM_000251.2(MSH2):c.1987A>G (p.Met663Val) rs752241362
NM_000251.2(MSH2):c.1989G>A (p.Met663Ile) rs863224640
NM_000251.2(MSH2):c.198C>T (p.Tyr66=) rs730881784
NM_000251.2(MSH2):c.1992C>G (p.Phe664Leu) rs777450803
NM_000251.2(MSH2):c.1992C>T (p.Phe664=)
NM_000251.2(MSH2):c.1995C>T (p.His665=) rs1553368723
NM_000251.2(MSH2):c.1996_1997delAT (p.Ile666Hisfs) rs63751700
NM_000251.2(MSH2):c.1999A>G (p.Ile667Val) rs876660585
NM_000251.2(MSH2):c.199A>G (p.Met67Val) rs768824654
NM_000251.2(MSH2):c.19G>C (p.Glu7Gln) rs375561490
NM_000251.2(MSH2):c.1A>C (p.Met1Leu) rs267607911
NM_000251.2(MSH2):c.1A>G (p.Met1Val) rs267607911
NM_000251.2(MSH2):c.1A>T (p.Met1Leu) rs267607911
NM_000251.2(MSH2):c.2002A>C (p.Thr668Pro) rs1064794678
NM_000251.2(MSH2):c.2004T>A (p.Thr668=) rs1553368731
NM_000251.2(MSH2):c.2004delTinsCA (p.Gly669Argfs) rs876659961
NM_000251.2(MSH2):c.2005+10C>T
NM_000251.2(MSH2):c.2005+12G>A rs746829966
NM_000251.2(MSH2):c.2005+12G>C rs746829966
NM_000251.2(MSH2):c.2005+13G>C rs538675762
NM_000251.2(MSH2):c.2005+18T>G
NM_000251.2(MSH2):c.2005+1G>A rs267607986
NM_000251.2(MSH2):c.2005+1G>C rs267607986
NM_000251.2(MSH2):c.2005+1G>T rs267607986
NM_000251.2(MSH2):c.2005+20G>A rs1167634073
NM_000251.2(MSH2):c.2005+25T>G rs267607989
NM_000251.2(MSH2):c.2005+2T>C rs267607987
NM_000251.2(MSH2):c.2005+2_2005+12del rs587779123
NM_000251.2(MSH2):c.2005+2del rs587779124
NM_000251.2(MSH2):c.2005+2dupT rs541623924
NM_000251.2(MSH2):c.2005+3A>T rs1060502014
NM_000251.2(MSH2):c.2005+3_2005+14del12 rs587779125
NM_000251.2(MSH2):c.2005+479T>G rs869312595
NM_000251.2(MSH2):c.2005+4A>C rs1337550192
NM_000251.2(MSH2):c.2005+6A>C rs1060502018
NM_000251.2(MSH2):c.2005+8dupA rs267607992
NM_000251.2(MSH2):c.2005G>C (p.Gly669Arg) rs63751668
NM_000251.2(MSH2):c.2005G>T (p.Gly669Cys) rs63751668
NM_000251.2(MSH2):c.2006-15T>A rs1057524452
NM_000251.2(MSH2):c.2006-15T>C rs1057524452
NM_000251.2(MSH2):c.2006-15T>G rs1057524452
NM_000251.2(MSH2):c.2006-1G>C rs267607988
NM_000251.2(MSH2):c.2006-1G>T
NM_000251.2(MSH2):c.2006-265A>G rs2059520
NM_000251.2(MSH2):c.2006-26dup rs781614743
NM_000251.2(MSH2):c.2006-2A>G rs267607991
NM_000251.2(MSH2):c.2006-36_2006-33dup rs587779126
NM_000251.2(MSH2):c.2006-3T>G rs1553368975
NM_000251.2(MSH2):c.2006-4G>A rs369853630
NM_000251.2(MSH2):c.2006-5T>A rs267607990
NM_000251.2(MSH2):c.2006-5T>C rs267607990
NM_000251.2(MSH2):c.2006-6T>C rs2303428
NM_000251.2(MSH2):c.2006-6T>G rs2303428
NM_000251.2(MSH2):c.2006-8T>A rs1553368970
NM_000251.2(MSH2):c.2006-9G>A rs985337130
NM_000251.2(MSH2):c.2006-?_2210+?del
NM_000251.2(MSH2):c.2006G>A (p.Gly669Asp) rs63751640
NM_000251.2(MSH2):c.2006G>C (p.Gly669Ala) rs63751640
NM_000251.2(MSH2):c.2006G>T (p.Gly669Val) rs63751640
NM_000251.2(MSH2):c.2008C>T (p.Pro670Ser)
NM_000251.2(MSH2):c.2009C>A (p.Pro670His) rs41294982
NM_000251.2(MSH2):c.2009C>G (p.Pro670Arg) rs41294982
NM_000251.2(MSH2):c.2009C>T (p.Pro670Leu) rs41294982
NM_000251.2(MSH2):c.200T>A (p.Met67Lys) rs876660001
NM_000251.2(MSH2):c.2010C>T (p.Pro670=) rs766618212
NM_000251.2(MSH2):c.2010delC (p.Asn671Ilefs) rs63751123
NM_000251.2(MSH2):c.2011A>G (p.Asn671Asp) rs63751232
NM_000251.2(MSH2):c.2011A>T (p.Asn671Tyr) rs63751232
NM_000251.2(MSH2):c.2012A>G (p.Asn671Ser)
NM_000251.2(MSH2):c.2013T>A (p.Asn671Lys) rs587779127
NM_000251.2(MSH2):c.2013delT (p.Asn671Lysfs) rs1553368988
NM_000251.2(MSH2):c.2014A>G (p.Met672Val) rs763690339
NM_000251.2(MSH2):c.2015T>G (p.Met672Arg) rs786203126
NM_000251.2(MSH2):c.2015delT (p.Met672Argfs) rs63751161
NM_000251.2(MSH2):c.2017G>A (p.Gly673Arg)
NM_000251.2(MSH2):c.201G>C (p.Met67Ile) rs1442557180
NM_000251.2(MSH2):c.2020G>C (p.Gly674Arg) rs63750234
NM_000251.2(MSH2):c.2021G>A (p.Gly674Asp) rs267607996
NM_000251.2(MSH2):c.2021_2022delGT (p.Gly674Glufs) rs267608000
NM_000251.2(MSH2):c.2022T>C (p.Gly674=) rs786203120
NM_000251.2(MSH2):c.2023A>G (p.Lys675Glu) rs1060501990
NM_000251.2(MSH2):c.2023_2025delAAAinsGCC (p.Lys675Ala) rs587779128
NM_000251.2(MSH2):c.2026T>C (p.Ser676Pro) rs63751089
NM_000251.2(MSH2):c.2027C>G (p.Ser676Ter) rs1057520735
NM_000251.2(MSH2):c.2027C>T (p.Ser676Leu) rs1057520735
NM_000251.2(MSH2):c.2028A>C (p.Ser676=) rs1057522032
NM_000251.2(MSH2):c.2028A>G (p.Ser676=) rs1057522032
NM_000251.2(MSH2):c.2029A>G (p.Thr677Ala) rs1553369013
NM_000251.2(MSH2):c.2030C>G (p.Thr677Arg) rs876660711
NM_000251.2(MSH2):c.2031A>G (p.Thr677=) rs786203923
NM_000251.2(MSH2):c.2032T>C (p.Tyr678His) rs876659093
NM_000251.2(MSH2):c.2033A>G (p.Tyr678Cys) rs1553369025
NM_000251.2(MSH2):c.2034T>A (p.Tyr678Ter)
NM_000251.2(MSH2):c.2035_2036delAT (p.Ile679Serfs) rs587779129
NM_000251.2(MSH2):c.2038C>G (p.Arg680Gly) rs63749932
NM_000251.2(MSH2):c.2038C>T (p.Arg680Ter) rs63749932
NM_000251.2(MSH2):c.2039G>A (p.Arg680Gln)
NM_000251.2(MSH2):c.2039G>C (p.Arg680Pro) rs1203462814
NM_000251.2(MSH2):c.203G>C (p.Gly68Ala) rs1064795914
NM_000251.2(MSH2):c.2041C>G (p.Gln681Glu) rs730881762
NM_000251.2(MSH2):c.2041C>T (p.Gln681Ter) rs730881762
NM_000251.2(MSH2):c.2043A>G (p.Gln681=) rs730881763
NM_000251.2(MSH2):c.2043A>T (p.Gln681His) rs730881763
NM_000251.2(MSH2):c.2045C>T (p.Thr682Ile) rs587779130
NM_000251.2(MSH2):c.2045_2047delCTGinsTT (p.Thr682Ilefs) rs1553369034
NM_000251.2(MSH2):c.2046_2047delTG (p.Val684Aspfs) rs587779131
NM_000251.2(MSH2):c.2047G>A (p.Gly683Arg) rs267607995
NM_000251.2(MSH2):c.2047G>T (p.Gly683Trp) rs267607995
NM_000251.2(MSH2):c.2048G>A (p.Gly683Glu) rs755920849
NM_000251.2(MSH2):c.2048G>T (p.Gly683Val) rs755920849
NM_000251.2(MSH2):c.2048_2111dup (p.Ile704Metfs) rs1553369051
NM_000251.2(MSH2):c.204delG (p.Pro69Argfs) rs63750199
NM_000251.2(MSH2):c.2050G>T (p.Val684Leu) rs1060502041
NM_000251.2(MSH2):c.2053A>G (p.Ile685Val) rs1060499876
NM_000251.2(MSH2):c.2055A>G (p.Ile685Met) rs989001878
NM_000251.2(MSH2):c.2056_2082del27insTATATGTTGTGCCATGTGAATATA (p.Val686_Phe694delinsTyrMetLeuCysHisValAsnIle) rs587779132
NM_000251.2(MSH2):c.2060T>C (p.Leu687Pro) rs587779133
NM_000251.2(MSH2):c.2061C>G (p.Leu687=) rs63750032
NM_000251.2(MSH2):c.2061C>T (p.Leu687=) rs63750032
NM_000251.2(MSH2):c.2063T>G (p.Met688Arg) rs63749993
NM_000251.2(MSH2):c.2064G>A (p.Met688Ile) rs63750790
NM_000251.2(MSH2):c.2065G>C (p.Ala689Pro) rs914610419
NM_000251.2(MSH2):c.2066C>T (p.Ala689Val) rs1060502020
NM_000251.2(MSH2):c.2067C>G (p.Ala689=) rs1039052221
NM_000251.2(MSH2):c.2067C>T (p.Ala689=) rs1039052221
NM_000251.2(MSH2):c.2068C>G (p.Gln690Glu) rs587779134
NM_000251.2(MSH2):c.206C>T (p.Pro69Leu) rs983555044
NM_000251.2(MSH2):c.206delC (p.Pro69Argfs) rs1553348904
NM_000251.2(MSH2):c.2071dupA (p.Ile691Asnfs) rs63749878
NM_000251.2(MSH2):c.2072T>C (p.Ile691Thr) rs754824872
NM_000251.2(MSH2):c.2073T>G (p.Ile691Met) rs779101144
NM_000251.2(MSH2):c.2074G>A (p.Gly692Arg) rs63750232
NM_000251.2(MSH2):c.2074G>C (p.Gly692Arg) rs63750232
NM_000251.2(MSH2):c.2074G>T (p.Gly692Trp) rs63750232
NM_000251.2(MSH2):c.2074_2081delGGGTGTTT (p.Gly692Cysfs) rs587779135
NM_000251.2(MSH2):c.2075G>A (p.Gly692Glu) rs63751432
NM_000251.2(MSH2):c.2075G>T (p.Gly692Val) rs63751432
NM_000251.2(MSH2):c.2076G>A (p.Gly692=) rs1060504422
NM_000251.2(MSH2):c.2077T>C (p.Cys693Arg)
NM_000251.2(MSH2):c.2078G>A (p.Cys693Tyr) rs1057524909
NM_000251.2(MSH2):c.2079T>A (p.Cys693Ter) rs1553369089
NM_000251.2(MSH2):c.207G>A (p.Pro69=) rs1295445617
NM_000251.2(MSH2):c.207G>C (p.Pro69=)
NM_000251.2(MSH2):c.207_211+42del rs1553348901
NM_000251.2(MSH2):c.2081T>C (p.Phe694Ser) rs1114167857
NM_000251.2(MSH2):c.2082T>C (p.Phe694=) rs748210094
NM_000251.2(MSH2):c.2082delT (p.Phe694Leufs) rs63750689
NM_000251.2(MSH2):c.2083G>A (p.Val695Met)
NM_000251.2(MSH2):c.2083G>C (p.Val695Leu)
NM_000251.2(MSH2):c.2085dup (p.Pro696Alafs) rs1553369100
NM_000251.2(MSH2):c.2086C>G (p.Pro696Ala)
NM_000251.2(MSH2):c.2086C>T (p.Pro696Ser) rs546201898
NM_000251.2(MSH2):c.2087C>T (p.Pro696Leu) rs267607994
NM_000251.2(MSH2):c.2088A>G (p.Pro696=) rs878853807
NM_000251.2(MSH2):c.2089T>C (p.Cys697Arg) rs63750961
NM_000251.2(MSH2):c.208G>A (p.Ala70Thr) rs587778522
NM_000251.2(MSH2):c.2090G>A (p.Cys697Tyr) rs63750398
NM_000251.2(MSH2):c.2090G>T (p.Cys697Phe) rs63750398
NM_000251.2(MSH2):c.2091T>A (p.Cys697Ter) rs63750872
NM_000251.2(MSH2):c.2094G>A (p.Glu698=) rs773555449
NM_000251.2(MSH2):c.2095T>C (p.Ser699Pro)
NM_000251.2(MSH2):c.2095T>G (p.Ser699Ala)
NM_000251.2(MSH2):c.2096C>G (p.Ser699Ter) rs587779136
NM_000251.2(MSH2):c.2096C>T (p.Ser699Leu) rs587779136
NM_000251.2(MSH2):c.2097A>T (p.Ser699=) rs747170086
NM_000251.2(MSH2):c.2098_2100delGCAinsAAG (p.Ala700Lys)
NM_000251.2(MSH2):c.2099C>A (p.Ala700Glu) rs876658251
NM_000251.2(MSH2):c.209C>A (p.Ala70Glu) rs587782481
NM_000251.2(MSH2):c.209C>T (p.Ala70Val) rs587782481
NM_000251.2(MSH2):c.20A>C (p.Glu7Ala) rs530071578
NM_000251.2(MSH2):c.20A>G (p.Glu7Gly) rs530071578
NM_000251.2(MSH2):c.20delA (p.Glu7Glyfs) rs267607915
NM_000251.2(MSH2):c.2100A>G (p.Ala700=) rs771426077
NM_000251.2(MSH2):c.2100delA (p.Glu701Lysfs) rs1553369113
NM_000251.2(MSH2):c.2102A>C (p.Glu701Ala) rs876659187
NM_000251.2(MSH2):c.2105T>A (p.Val702Glu) rs587779137
NM_000251.2(MSH2):c.2105T>G (p.Val702Gly) rs587779137
NM_000251.2(MSH2):c.2106G>A (p.Val702=) rs786201108
NM_000251.2(MSH2):c.2108C>A (p.Ser703Tyr) rs267607999
NM_000251.2(MSH2):c.2108C>G (p.Ser703Cys) rs267607999
NM_000251.2(MSH2):c.210A>C (p.Ala70=) rs1230662279
NM_000251.2(MSH2):c.211+14C>T
NM_000251.2(MSH2):c.211+14dupC rs1553348925
NM_000251.2(MSH2):c.211+15G>T
NM_000251.2(MSH2):c.211+19C>T rs1477491085
NM_000251.2(MSH2):c.211+1G>T rs1114167883
NM_000251.2(MSH2):c.211+2T>C rs1060501993
NM_000251.2(MSH2):c.211+3G>T rs778940305
NM_000251.2(MSH2):c.211+4A>G rs1553348917
NM_000251.2(MSH2):c.211+5G>T rs1060501999
NM_000251.2(MSH2):c.211+6G>C
NM_000251.2(MSH2):c.211+8C>A rs267607916
NM_000251.2(MSH2):c.211+8C>G rs267607916
NM_000251.2(MSH2):c.211+8C>T rs267607916
NM_000251.2(MSH2):c.211+8_211+9delCCinsTG rs1553348920
NM_000251.2(MSH2):c.211+98T>C rs3815865
NM_000251.2(MSH2):c.211+9C>A rs2303426
NM_000251.2(MSH2):c.211+9C>G rs2303426
NM_000251.2(MSH2):c.211+9C>T rs2303426
NM_000251.2(MSH2):c.2110A>G (p.Ile704Val) rs730881764
NM_000251.2(MSH2):c.2111T>C (p.Ile704Thr) rs564657106
NM_000251.2(MSH2):c.2112T>C (p.Ile704=) rs1553369124
NM_000251.2(MSH2):c.2113G>A (p.Val705Met)
NM_000251.2(MSH2):c.2113G>C (p.Val705Leu) rs1553369128
NM_000251.2(MSH2):c.2113delG (p.Val705Trpfs) rs63749811
NM_000251.2(MSH2):c.2116delG (p.Asp706Thrfs) rs1553369131
NM_000251.2(MSH2):c.2118C>A (p.Asp706Glu) rs773949031
NM_000251.2(MSH2):c.2118C>T (p.Asp706=)
NM_000251.2(MSH2):c.2119T>G (p.Cys707Gly) rs1553369135
NM_000251.2(MSH2):c.211G>C (p.Gly71Arg) rs587782659
NM_000251.2(MSH2):c.212-17_212-15del
NM_000251.2(MSH2):c.212-1G>A rs267607914
NM_000251.2(MSH2):c.212-1_221delGGAGCAAAGAAinsCAC rs876660533
NM_000251.2(MSH2):c.212-2A>G rs267607917
NM_000251.2(MSH2):c.212-2delA rs1060502007
NM_000251.2(MSH2):c.212-3A>T rs879255341
NM_000251.2(MSH2):c.212-478T>G rs587779138
NM_000251.2(MSH2):c.212-4T>G
NM_000251.2(MSH2):c.212-4delT rs746333570
NM_000251.2(MSH2):c.212-4dup rs746333570
NM_000251.2(MSH2):c.212-6T>C
NM_000251.2(MSH2):c.212-?_1076+?del
NM_000251.2(MSH2):c.212-?_1276+?del
NM_000251.2(MSH2):c.212-?_1386+?del
NM_000251.2(MSH2):c.212-?_1510+?del
NM_000251.2(MSH2):c.212-?_2458+?del
NM_000251.2(MSH2):c.212-?_366+?del
NM_000251.2(MSH2):c.212-?_366+?dup
NM_000251.2(MSH2):c.212-?_645+?del
NM_000251.2(MSH2):c.2120G>A (p.Cys707Tyr) rs373226409
NM_000251.2(MSH2):c.2120G>C (p.Cys707Ser) rs373226409
NM_000251.2(MSH2):c.2121C>T (p.Cys707=) rs1553369139
NM_000251.2(MSH2):c.2122A>C (p.Ile708Leu) rs750084297
NM_000251.2(MSH2):c.2122A>G (p.Ile708Val) rs750084297
NM_000251.2(MSH2):c.2123T>A (p.Ile708Asn) rs63750108
NM_000251.2(MSH2):c.2123T>C (p.Ile708Thr) rs63750108
NM_000251.2(MSH2):c.2125T>G (p.Leu709Val) rs1060502030
NM_000251.2(MSH2):c.2128G>C (p.Ala710Pro)
NM_000251.2(MSH2):c.2128G>T (p.Ala710Ser)
NM_000251.2(MSH2):c.2128del (p.Ala710Profs) rs1114167864
NM_000251.2(MSH2):c.2129C>G (p.Ala710Gly) rs373717132
NM_000251.2(MSH2):c.2129C>T (p.Ala710Val) rs373717132
NM_000251.2(MSH2):c.212G>A (p.Gly71Glu) rs1064793802
NM_000251.2(MSH2):c.212_366del155 (p.Ala72Phefs) rs1553350052
NM_000251.2(MSH2):c.2131C>T (p.Arg711Ter) rs63750636
NM_000251.2(MSH2):c.2132G>A (p.Arg711Gln) rs138465383
NM_000251.2(MSH2):c.2132G>T (p.Arg711Leu) rs138465383
NM_000251.2(MSH2):c.2135dupT (p.Gly713Argfs) rs63751453
NM_000251.2(MSH2):c.2136A>G (p.Val712=) rs1553369157
NM_000251.2(MSH2):c.2139G>C (p.Gly713=) rs63750003
NM_000251.2(MSH2):c.2139G>T (p.Gly713=) rs63750003
NM_000251.2(MSH2):c.213A>G (p.Gly71=) rs878853808
NM_000251.2(MSH2):c.2141C>T (p.Ala714Val) rs63751224
NM_000251.2(MSH2):c.2141dupC (p.Gly715Trpfs) rs63750545
NM_000251.2(MSH2):c.2143G>C (p.Gly715Arg)
NM_000251.2(MSH2):c.2144G>C (p.Gly715Ala)
NM_000251.2(MSH2):c.2145delT (p.Asp716Thrfs) rs1553369164
NM_000251.2(MSH2):c.2148delC (p.Asp716Glufs) rs1553369165
NM_000251.2(MSH2):c.214G>A (p.Ala72Thr)
NM_000251.2(MSH2):c.2150G>A (p.Ser717Asn) rs752883472
NM_000251.2(MSH2):c.2150_2153delGTCA (p.Ser717Asnfs) rs878853809
NM_000251.2(MSH2):c.2152C>G (p.Gln718Glu) rs587779139
NM_000251.2(MSH2):c.2152C>T (p.Gln718Ter) rs587779139
NM_000251.2(MSH2):c.2154A>G (p.Gln718=) rs63750810
NM_000251.2(MSH2):c.2158A>G (p.Lys720Glu) rs747265823
NM_000251.2(MSH2):c.215C>G (p.Ala72Gly)
NM_000251.2(MSH2):c.2160_2163delAGGA (p.Gly721Serfs) rs63750722
NM_000251.2(MSH2):c.2161G>T (p.Gly721Ter) rs1060502032
NM_000251.2(MSH2):c.2164G>A (p.Val722Ile) rs587781996
NM_000251.2(MSH2):c.2164G>T (p.Val722Phe) rs587781996
NM_000251.2(MSH2):c.2166C>A (p.Val722=) rs1057520969
NM_000251.2(MSH2):c.2166C>G (p.Val722=) rs1057520969
NM_000251.2(MSH2):c.2166C>T (p.Val722=) rs1057520969
NM_000251.2(MSH2):c.2167dupT (p.Ser723Phefs) rs587779140
NM_000251.2(MSH2):c.2168C>G (p.Ser723Cys) rs63750794
NM_000251.2(MSH2):c.2168C>T (p.Ser723Phe) rs63750794
NM_000251.2(MSH2):c.216A>G (p.Ala72=) rs746298214
NM_000251.2(MSH2):c.2170A>G (p.Thr724Ala) rs879254203
NM_000251.2(MSH2):c.2171C>G (p.Thr724Arg) rs63751125
NM_000251.2(MSH2):c.2171C>T (p.Thr724Met) rs63751125
NM_000251.2(MSH2):c.2172G>A (p.Thr724=) rs370636719
NM_000251.2(MSH2):c.2172G>T (p.Thr724=) rs370636719
NM_000251.2(MSH2):c.2176A>C (p.Met726Leu) rs1114167847
NM_000251.2(MSH2):c.2176A>G (p.Met726Val) rs1114167847
NM_000251.2(MSH2):c.2176A>T (p.Met726Leu)
NM_000251.2(MSH2):c.2178G>A (p.Met726Ile) rs587782396
NM_000251.2(MSH2):c.2178G>C (p.Met726Ile) rs587782396
NM_000251.2(MSH2):c.2178G>T (p.Met726Ile) rs587782396
NM_000251.2(MSH2):c.2179G>C (p.Ala727Pro) rs104895026
NM_000251.2(MSH2):c.2179G>T (p.Ala727Ser) rs104895026
NM_000251.2(MSH2):c.217A>G (p.Lys73Glu) rs770110491
NM_000251.2(MSH2):c.217A>T (p.Lys73Ter) rs770110491
NM_000251.2(MSH2):c.217_227del (p.Lys73Glufs) rs1114167863
NM_000251.2(MSH2):c.2181T>C (p.Ala727=) rs763387694
NM_000251.2(MSH2):c.2182_2199del (p.Glu728_Ala733del) rs1553369194
NM_000251.2(MSH2):c.2185A>G (p.Met729Val)
NM_000251.2(MSH2):c.2187G>A (p.Met729Ile) rs587779141
NM_000251.2(MSH2):c.2187G>T (p.Met729Ile) rs587779141
NM_000251.2(MSH2):c.218A>G (p.Lys73Arg)
NM_000251.2(MSH2):c.2190G>A (p.Leu730=) rs864622370
NM_000251.2(MSH2):c.2191G>T (p.Glu731Ter) rs63749802
NM_000251.2(MSH2):c.2194_2196delACT (p.Thr732del) rs63750562
NM_000251.2(MSH2):c.2195C>G (p.Thr732Ser) rs730881765
NM_000251.2(MSH2):c.2195C>T (p.Thr732Ile) rs730881765
NM_000251.2(MSH2):c.2197G>A (p.Ala733Thr) rs772662439
NM_000251.2(MSH2):c.219G>A (p.Lys73=) rs1800150
NM_000251.2(MSH2):c.21G>A (p.Glu7=) rs1060504423
NM_000251.2(MSH2):c.21dupG (p.Thr8Aspfs) rs1553348668
NM_000251.2(MSH2):c.2201C>G (p.Ser734Cys) rs1553369204
NM_000251.2(MSH2):c.2203A>G (p.Ile735Val) rs2229061
NM_000251.2(MSH2):c.2204delT (p.Ile735Thrfs) rs63750572
NM_000251.2(MSH2):c.2205C>A (p.Ile735=) rs533553381
NM_000251.2(MSH2):c.2205C>T (p.Ile735=) rs533553381
NM_000251.2(MSH2):c.2206C>T (p.Leu736Phe) rs876658727
NM_000251.2(MSH2):c.2208C>T (p.Leu736=) rs541880457
NM_000251.2(MSH2):c.220A>C (p.Asn74His) rs150548839
NM_000251.2(MSH2):c.2210+11_2210+22delCTCCTAGTCCCT rs730881782
NM_000251.2(MSH2):c.2210+19C>A rs377412168
NM_000251.2(MSH2):c.2210+19C>T rs377412168
NM_000251.2(MSH2):c.2210+1G>A rs267608002
NM_000251.2(MSH2):c.2210+1G>C rs267608002
NM_000251.2(MSH2):c.2210+20C>T rs757536720
NM_000251.2(MSH2):c.2210+274T>G rs4608577
NM_000251.2(MSH2):c.2210+317G>C rs4638843
NM_000251.2(MSH2):c.2210+5G>C rs143873719
NM_000251.2(MSH2):c.2210+77T>A rs267608005
NM_000251.2(MSH2):c.2210+7G>A rs374675118
NM_000251.2(MSH2):c.2210+7G>T rs374675118
NM_000251.2(MSH2):c.2210+8C>T rs778020437
NM_000251.2(MSH2):c.2210+8dupC rs267608004
NM_000251.2(MSH2):c.2210+9A>G rs878853810
NM_000251.2(MSH2):c.2210_2210+1delGGinsTA rs1114167890
NM_000251.2(MSH2):c.2211-10T>A rs267608006
NM_000251.2(MSH2):c.2211-19A>G rs770675668
NM_000251.2(MSH2):c.2211-1G>A
NM_000251.2(MSH2):c.2211-1G>T rs267607979
NM_000251.2(MSH2):c.2211-2A>C rs267608001
NM_000251.2(MSH2):c.2211-2A>G rs267608001
NM_000251.2(MSH2):c.2211-2A>T rs267608001
NM_000251.2(MSH2):c.2211-5T>G rs368596736
NM_000251.2(MSH2):c.2211-6C>A rs267608003
NM_000251.2(MSH2):c.2211-7G>A rs764972956
NM_000251.2(MSH2):c.2211-?_2458+?del
NM_000251.2(MSH2):c.2215G>C (p.Ala739Pro) rs1553369624
NM_000251.2(MSH2):c.2218A>G (p.Thr740Ala) rs1553369627
NM_000251.2(MSH2):c.2219C>G (p.Thr740Ser) rs1553369628
NM_000251.2(MSH2):c.221A>T (p.Asn74Ile) rs1114167869
NM_000251.2(MSH2):c.2224G>A (p.Asp742Asn) rs879254183
NM_000251.2(MSH2):c.2228C>A (p.Ser743Ter) rs63751155
NM_000251.2(MSH2):c.2228C>G (p.Ser743Ter) rs63751155
NM_000251.2(MSH2):c.2228C>T (p.Ser743Leu) rs63751155
NM_000251.2(MSH2):c.2228_2231delCATT (p.Ser743Terfs) rs63751156
NM_000251.2(MSH2):c.222T>A (p.Asn74Lys) rs1553350075
NM_000251.2(MSH2):c.2231T>G (p.Leu744Ter) rs63750403
NM_000251.2(MSH2):c.2235_2237del (p.Ile747del) rs267607690
NM_000251.2(MSH2):c.2235_2237dupAAT (p.Ile747_Asp748insIle) rs267607690
NM_000251.2(MSH2):c.2236_2241delATCATA (p.Ile746_Ile747del) rs587779142
NM_000251.2(MSH2):c.2236dupA (p.Ile746Asnfs) rs863225392
NM_000251.2(MSH2):c.2237_2238insA (p.Ile747Hisfs) rs1553369641
NM_000251.2(MSH2):c.2239A>G (p.Ile747Val) rs1553369652
NM_000251.2(MSH2):c.223_224delCT (p.Leu75Alafs) rs63750712
NM_000251.2(MSH2):c.2240_2241delTA (p.Ile747Argfs) rs63751036
NM_000251.2(MSH2):c.2241A>T (p.Ile747=) rs1060504411
NM_000251.2(MSH2):c.2242G>A (p.Asp748Asn) rs267608007
NM_000251.2(MSH2):c.2242G>C (p.Asp748His) rs267608007
NM_000251.2(MSH2):c.2242G>T (p.Asp748Tyr) rs267608007
NM_000251.2(MSH2):c.2243A>T (p.Asp748Val)
NM_000251.2(MSH2):c.2245G>A (p.Glu749Lys) rs63751477
NM_000251.2(MSH2):c.2246_2250delAATTG (p.Glu749Glyfs) rs1553369665
NM_000251.2(MSH2):c.2247A>G (p.Glu749=) rs1553369670
NM_000251.2(MSH2):c.2248T>C (p.Leu750=) rs527725593
NM_000251.2(MSH2):c.2251G>A (p.Gly751Arg) rs63751119
NM_000251.2(MSH2):c.2251G>C (p.Gly751Arg) rs63751119
NM_000251.2(MSH2):c.2260A>G (p.Thr754Ala) rs757268664
NM_000251.2(MSH2):c.2260A>T (p.Thr754Ser) rs757268664
NM_000251.2(MSH2):c.2261C>T (p.Thr754Ile) rs1553369680
NM_000251.2(MSH2):c.2261delC (p.Thr754Ilefs) rs267608009
NM_000251.2(MSH2):c.2266A>G (p.Thr756Ala) rs750646335
NM_000251.2(MSH2):c.2266A>T (p.Thr756Ser) rs750646335
NM_000251.2(MSH2):c.2266_2267insAGA (p.Ser755_Thr756insLys) rs1553369686
NM_000251.2(MSH2):c.2267C>G (p.Thr756Ser) rs372383829
NM_000251.2(MSH2):c.2267_2268insGTAG (p.Tyr757Terfs)
NM_000251.2(MSH2):c.2268C>G (p.Thr756=)
NM_000251.2(MSH2):c.2269T>G (p.Tyr757Asp) rs1553369693
NM_000251.2(MSH2):c.2269dup (p.Tyr757Leufs) rs1114167824
NM_000251.2(MSH2):c.226C>T (p.Gln76Ter) rs63750042
NM_000251.2(MSH2):c.2270A>G (p.Tyr757Cys)
NM_000251.2(MSH2):c.2271C>T (p.Tyr757=) rs56076152
NM_000251.2(MSH2):c.2272G>A (p.Asp758Asn) rs876658254
NM_000251.2(MSH2):c.2272G>T (p.Asp758Tyr) rs876658254
NM_000251.2(MSH2):c.2275G>T (p.Gly759Ter) rs63749854
NM_000251.2(MSH2):c.2276G>A (p.Gly759Glu) rs386833406
NM_000251.2(MSH2):c.2277A>G (p.Gly759=) rs1057520316
NM_000251.2(MSH2):c.2281G>A (p.Gly761Arg) rs1060502038
NM_000251.2(MSH2):c.2281G>C (p.Gly761Arg) rs1060502038
NM_000251.2(MSH2):c.2281delG (p.Leu762Terfs) rs786204050
NM_000251.2(MSH2):c.2282G>C (p.Gly761Ala) rs876659937
NM_000251.2(MSH2):c.2282G>T (p.Gly761Val) rs876659937
NM_000251.2(MSH2):c.2283G>A (p.Gly761=) rs755548149
NM_000251.2(MSH2):c.2285T>C (p.Leu762Ser)
NM_000251.2(MSH2):c.2288C>T (p.Ala763Val) rs144412585
NM_000251.2(MSH2):c.2289A>G (p.Ala763=) rs1553369710
NM_000251.2(MSH2):c.228G>C (p.Gln76His) rs587782857
NM_000251.2(MSH2):c.228G>T (p.Gln76His) rs587782857
NM_000251.2(MSH2):c.2290T>C (p.Trp764Arg) rs879254058
NM_000251.2(MSH2):c.2290T>G (p.Trp764Gly) rs879254058
NM_000251.2(MSH2):c.2290delT (p.Trp764Glyfs) rs63749913
NM_000251.2(MSH2):c.2291G>A (p.Trp764Ter) rs587779143
NM_000251.2(MSH2):c.2292G>A (p.Trp764Ter) rs63751105
NM_000251.2(MSH2):c.2292G>C (p.Trp764Cys) rs63751105
NM_000251.2(MSH2):c.2293G>A (p.Ala765Thr) rs63750368
NM_000251.2(MSH2):c.2294C>T (p.Ala765Val) rs1261458082
NM_000251.2(MSH2):c.2294delC (p.Ala765Valfs) rs63750346
NM_000251.2(MSH2):c.2295T>A (p.Ala765=) rs786202925
NM_000251.2(MSH2):c.2295_2296insTA (p.Ile766Terfs) rs863225393
NM_000251.2(MSH2):c.2295delT (p.Ile766Tyrfs) rs63751143
NM_000251.2(MSH2):c.2296A>G (p.Ile766Val) rs374399939
NM_000251.2(MSH2):c.2297delT (p.Ile766Asnfs) rs863225394
NM_000251.2(MSH2):c.2298A>G (p.Ile766Met) rs1064795116
NM_000251.2(MSH2):c.229_230delAG (p.Ser77Cysfs) rs63749848
NM_000251.2(MSH2):c.22A>T (p.Thr8Ser) rs876660332
NM_000251.2(MSH2):c.2300C>G (p.Ser767Ter) rs863225395
NM_000251.2(MSH2):c.2300_2305del (p.Ser767_Glu768del) rs1114167861
NM_000251.2(MSH2):c.2303A>T (p.Glu768Val) rs1553369720
NM_000251.2(MSH2):c.2304delA (p.Glu768Aspfs) rs587783053
NM_000251.2(MSH2):c.2305T>C (p.Tyr769His) rs1114167859
NM_000251.2(MSH2):c.2305delT (p.Tyr769Thrfs) rs63750896
NM_000251.2(MSH2):c.2308A>G (p.Ile770Val) rs63750684
NM_000251.2(MSH2):c.2309T>C (p.Ile770Thr) rs371718349
NM_000251.2(MSH2):c.2310T>C (p.Ile770=) rs1195669050
NM_000251.2(MSH2):c.2314del (p.Thr772Glnfs) rs1114167862
NM_000251.2(MSH2):c.2315C>G (p.Thr772Arg) rs1263286428
NM_000251.2(MSH2):c.2317A>G (p.Lys773Glu)
NM_000251.2(MSH2):c.2319G>C (p.Lys773Asn) rs745528772
NM_000251.2(MSH2):c.231T>G (p.Ser77Arg) rs1553350080
NM_000251.2(MSH2):c.2320A>G (p.Ile774Val) rs775464903
NM_000251.2(MSH2):c.2321T>C (p.Ile774Thr) rs878853811
NM_000251.2(MSH2):c.2321T>G (p.Ile774Ser) rs878853811
NM_000251.2(MSH2):c.2322T>C (p.Ile774=) rs56397910
NM_000251.2(MSH2):c.2326G>A (p.Ala776Thr)
NM_000251.2(MSH2):c.232G>A (p.Val78Ile) rs772779997
NM_000251.2(MSH2):c.2333_2334delGCinsT (p.Cys778Leufs) rs1114167872
NM_000251.2(MSH2):c.2334C>A (p.Cys778Ter) rs63750618
NM_000251.2(MSH2):c.2335A>C (p.Met779Leu) rs1114167843
NM_000251.2(MSH2):c.2335A>G (p.Met779Val) rs1114167843
NM_000251.2(MSH2):c.2335dupA (p.Met779Asnfs) rs63750149
NM_000251.2(MSH2):c.2337G>A (p.Met779Ile) rs41295292
NM_000251.2(MSH2):c.2338T>G (p.Phe780Val) rs1553369737
NM_000251.2(MSH2):c.2341G>A (p.Ala781Thr) rs1553369742
NM_000251.2(MSH2):c.2343A>C (p.Ala781=) rs1057523777
NM_000251.2(MSH2):c.2346C>A (p.Thr782=) rs1467953225
NM_000251.2(MSH2):c.2346C>T (p.Thr782=)
NM_000251.2(MSH2):c.2347C>G (p.His783Asp) rs1553369748
NM_000251.2(MSH2):c.2347C>T (p.His783Tyr) rs1553369748
NM_000251.2(MSH2):c.2347delC (p.His783Ilefs) rs63750233
NM_000251.2(MSH2):c.2348A>G (p.His783Arg) rs587781594
NM_000251.2(MSH2):c.234T>G (p.Val78=) rs786202437
NM_000251.2(MSH2):c.2350T>C (p.Phe784Leu) rs1553369750
NM_000251.2(MSH2):c.2351T>G (p.Phe784Cys) rs1553369756
NM_000251.2(MSH2):c.2352T>G (p.Phe784Leu)
NM_000251.2(MSH2):c.2353C>T (p.His785Tyr) rs1553369759
NM_000251.2(MSH2):c.2354A>C (p.His785Pro) rs200252727
NM_000251.2(MSH2):c.2354A>G (p.His785Arg) rs200252727
NM_000251.2(MSH2):c.2355T>C (p.His785=) rs1114167840
NM_000251.2(MSH2):c.2359C>G (p.Leu787Val)
NM_000251.2(MSH2):c.2360T>G (p.Leu787Arg)
NM_000251.2(MSH2):c.2360_2361dupTT (p.Thr788Leufs) rs63750803
NM_000251.2(MSH2):c.2361dupT (p.Thr788Tyrfs) rs63750803
NM_000251.2(MSH2):c.2362A>C (p.Thr788Pro) rs774440277
NM_000251.2(MSH2):c.2362dupA (p.Thr788Asnfs) rs63750463
NM_000251.2(MSH2):c.2363_2364delCT (p.Thr788Serfs) rs63750937
NM_000251.2(MSH2):c.2365G>T (p.Ala789Ser) rs1553369769
NM_000251.2(MSH2):c.2366C>G (p.Ala789Gly)
NM_000251.2(MSH2):c.2366C>T (p.Ala789Val) rs876660292
NM_000251.2(MSH2):c.2367C>T (p.Ala789=) rs786202414
NM_000251.2(MSH2):c.2369delT (p.Leu790Trpfs)
NM_000251.2(MSH2):c.2372C>T (p.Ala791Val)
NM_000251.2(MSH2):c.2375A>G (p.Asn792Ser) rs587782891
NM_000251.2(MSH2):c.2375A>T (p.Asn792Ile) rs587782891
NM_000251.2(MSH2):c.2376T>A (p.Asn792Lys) rs1281667531
NM_000251.2(MSH2):c.2377C>A (p.Gln793Lys) rs730881769
NM_000251.2(MSH2):c.2377C>G (p.Gln793Glu) rs730881769
NM_000251.2(MSH2):c.2378A>C (p.Gln793Pro) rs876660291
NM_000251.2(MSH2):c.2378A>G (p.Gln793Arg) rs876660291
NM_000251.2(MSH2):c.2379G>T (p.Gln793His) rs767520406
NM_000251.2(MSH2):c.237G>T (p.Val79=) rs786202203
NM_000251.2(MSH2):c.2380A>T (p.Ile794Leu) rs1553369778
NM_000251.2(MSH2):c.2381T>A (p.Ile794Lys) rs1553369781
NM_000251.2(MSH2):c.2381_2385dup (p.Thr796Tyrfs) rs1114167832
NM_000251.2(MSH2):c.2382del (p.Pro795Glnfs)
NM_000251.2(MSH2):c.2384C>A (p.Pro795Gln)
NM_000251.2(MSH2):c.2386A>C (p.Thr796Pro)
NM_000251.2(MSH2):c.2386A>T (p.Thr796Ser) rs876660738
NM_000251.2(MSH2):c.2387C>T (p.Thr796Ile) rs863224641
NM_000251.2(MSH2):c.2388delT (p.Val797Leufs) rs63749983
NM_000251.2(MSH2):c.2392A>G (p.Asn798Asp) rs786203105
NM_000251.2(MSH2):c.2393A>C (p.Asn798Thr) rs786204073
NM_000251.2(MSH2):c.2393A>G (p.Asn798Ser) rs786204073
NM_000251.2(MSH2):c.2393_2396del (p.Asn798Ilefs) rs1114167826
NM_000251.2(MSH2):c.2397T>C (p.Asn799=) rs368988823
NM_000251.2(MSH2):c.2398C>T (p.Leu800=) rs766586857
NM_000251.2(MSH2):c.23C>G (p.Thr8Arg) rs17217716
NM_000251.2(MSH2):c.23C>T (p.Thr8Met) rs17217716
NM_000251.2(MSH2):c.2400A>G (p.Leu800=) rs201298777
NM_000251.2(MSH2):c.2402A>C (p.His801Pro) rs1114167875
NM_000251.2(MSH2):c.2402A>T (p.His801Leu) rs1114167875
NM_000251.2(MSH2):c.2403T>C (p.His801=) rs1060504410
NM_000251.2(MSH2):c.2407A>G (p.Thr803Ala) rs63751168
NM_000251.2(MSH2):c.2408C>T (p.Thr803Ile) rs786202362
NM_000251.2(MSH2):c.2408_2409delCA (p.Thr803Serfs) rs63750060
NM_000251.2(MSH2):c.2410G>A (p.Ala804Thr) rs1060502005
NM_000251.2(MSH2):c.2412A>G (p.Ala804=) rs141523959
NM_000251.2(MSH2):c.2413C>T (p.Leu805Phe) rs779182536
NM_000251.2(MSH2):c.2413dup (p.Leu805Profs) rs1114167837
NM_000251.2(MSH2):c.2415C>T (p.Leu805=) rs139317211
NM_000251.2(MSH2):c.2417C>T (p.Thr806Ile) rs758889557
NM_000251.2(MSH2):c.2418C>T (p.Thr806=) rs876660451
NM_000251.2(MSH2):c.2418dupC (p.Thr807Hisfs) rs587779144
NM_000251.2(MSH2):c.2420C>G (p.Thr807Ser) rs41295294
NM_000251.2(MSH2):c.2420C>T (p.Thr807Ile) rs41295294
NM_000251.2(MSH2):c.2421_2422delTGinsCT (p.Glu808Ter) rs1553369812
NM_000251.2(MSH2):c.2422G>T (p.Glu808Ter) rs34986638
NM_000251.2(MSH2):c.2424A>G (p.Glu808=) rs876660231
NM_000251.2(MSH2):c.2425G>A (p.Glu809Lys) rs202145681
NM_000251.2(MSH2):c.2425G>T (p.Glu809Ter) rs202145681
NM_000251.2(MSH2):c.2427dupG (p.Thr810Aspfs) rs63751079
NM_000251.2(MSH2):c.242G>C (p.Ser81Thr)
NM_000251.2(MSH2):c.242G>T (p.Ser81Ile) rs1064793491
NM_000251.2(MSH2):c.2432T>G (p.Leu811Ter) rs63751018
NM_000251.2(MSH2):c.2435C>G (p.Thr812Ser) rs1553369826
NM_000251.2(MSH2):c.2437A>G (p.Met813Val) rs63749841
NM_000251.2(MSH2):c.2439G>A (p.Met813Ile) rs587781678
NM_000251.2(MSH2):c.2439G>C (p.Met813Ile)
NM_000251.2(MSH2):c.243_273delinsCTGACAAGCGCCTATAGCACTCGAATAATTCTTCTCACCCTAACAGGTCAGCCTCGCTTCCCAGCCCTCACTAACATTAACGAAAACAACCCACCCACTAAACCCCATTAAACGCCTAACAATCGGAAGCCTATTTTGCAGGGTTTCTCCATCACCAACAGCATTCTCCCCACATCCACCCCCCAAATGACAATCCCACTTTACTTAAAACTCACAG (p.Lys82_Glu425delinsTer)
NM_000251.2(MSH2):c.2442T>G (p.Leu814=) rs1114167838
NM_000251.2(MSH2):c.2446C>T (p.Gln816Ter) rs63749917
NM_000251.2(MSH2):c.2447A>G (p.Gln816Arg) rs768572053
NM_000251.2(MSH2):c.2449G>A (p.Val817Met) rs1334775360
NM_000251.2(MSH2):c.244A>T (p.Lys82Ter) rs587779145
NM_000251.2(MSH2):c.2455A>G (p.Lys819Glu) rs1369739730
NM_000251.2(MSH2):c.2457A>G (p.Lys819=) rs774152293
NM_000251.2(MSH2):c.2458+10A>G rs1269379998
NM_000251.2(MSH2):c.2458+10_2458+13dupATTG rs1553369839
NM_000251.2(MSH2):c.2458+12T>C rs1553369841
NM_000251.2(MSH2):c.2458+16G>A rs373624698
NM_000251.2(MSH2):c.2458+17T>C rs1057523144
NM_000251.2(MSH2):c.2458+19C>A rs1057521677
NM_000251.2(MSH2):c.2458+1G>A rs267608010
NM_000251.2(MSH2):c.2458+1G>T rs267608010
NM_000251.2(MSH2):c.2458+2T>C
NM_000251.2(MSH2):c.2458+3A>C rs761709497
NM_000251.2(MSH2):c.2458+4T>C rs1038735071
NM_000251.2(MSH2):c.2458+4T>G
NM_000251.2(MSH2):c.2458+6T>C
NM_000251.2(MSH2):c.2458+8C>G rs189025757
NM_000251.2(MSH2):c.2458+9T>C rs864622575
NM_000251.2(MSH2):c.2459-1055A>G rs553886398
NM_000251.2(MSH2):c.2459-11A>T rs1553370287
NM_000251.2(MSH2):c.2459-12A>C rs267608012
NM_000251.2(MSH2):c.2459-12A>G rs267608012
NM_000251.2(MSH2):c.2459-13A>G rs1553370285
NM_000251.2(MSH2):c.2459-18delT rs762688684
NM_000251.2(MSH2):c.2459-19T>C
NM_000251.2(MSH2):c.2459-1G>A rs1060501991
NM_000251.2(MSH2):c.2459-1G>C
NM_000251.2(MSH2):c.2459-20C>A rs1553370283
NM_000251.2(MSH2):c.2459-2A>G rs267608011
NM_000251.2(MSH2):c.2459-312A>G rs796612837
NM_000251.2(MSH2):c.2459-3T>C rs587781988
NM_000251.2(MSH2):c.2459-3T>G rs587781988
NM_000251.2(MSH2):c.2459-5T>A rs1060504417
NM_000251.2(MSH2):c.2459-5T>C rs1060504417
NM_000251.2(MSH2):c.2459-6_2459-2delTTATA rs1114167841
NM_000251.2(MSH2):c.2459-9T>C rs776644342
NM_000251.2(MSH2):c.2459-?_*(272_?)del
NM_000251.2(MSH2):c.2459-?_2634+?del
NM_000251.2(MSH2):c.2459-?_2634+?dup176
NM_000251.2(MSH2):c.2459G>A (p.Gly820Asp) rs794729229
NM_000251.2(MSH2):c.2461_2462delGT (p.Val821Leufs) rs1114167828
NM_000251.2(MSH2):c.2463C>T (p.Val821=) rs886056136
NM_000251.2(MSH2):c.2466T>A (p.Cys822Ter) rs63749846
NM_000251.2(MSH2):c.2466_2467delTG (p.Cys822Terfs) rs63751621
NM_000251.2(MSH2):c.246A>T (p.Lys82Asn) rs1553350100
NM_000251.2(MSH2):c.2470C>G (p.Gln824Glu) rs63750623
NM_000251.2(MSH2):c.2470C>T (p.Gln824Ter) rs63750623
NM_000251.2(MSH2):c.2472A>G (p.Gln824=) rs1553370311
NM_000251.2(MSH2):c.2472_2473delAA (p.Ser825Phefs) rs1553370310
NM_000251.2(MSH2):c.2473A>G (p.Ser825Gly) rs1553370314
NM_000251.2(MSH2):c.2479G>C (p.Gly827Arg)
NM_000251.2(MSH2):c.247A>G (p.Met83Val) rs766196837
NM_000251.2(MSH2):c.2483T>G (p.Ile828Ser) rs753067992
NM_000251.2(MSH2):c.2484dup (p.His829Serfs) rs1553370324
NM_000251.2(MSH2):c.2485_2498dupCATGTTGCAGAGCT (p.Ala834Metfs) rs587779146
NM_000251.2(MSH2):c.2485delC (p.His829Metfs) rs63751117
NM_000251.2(MSH2):c.2486A>T (p.His829Leu) rs1180659446
NM_000251.2(MSH2):c.2487T>G (p.His829Gln) rs989510855
NM_000251.2(MSH2):c.2489T>C (p.Val830Ala) rs1553370328
NM_000251.2(MSH2):c.2494G>A (p.Glu832Lys) rs863225396
NM_000251.2(MSH2):c.2494G>T (p.Glu832Ter) rs863225396
NM_000251.2(MSH2):c.2495A>T (p.Glu832Val) rs1553370334
NM_000251.2(MSH2):c.2496G>T (p.Glu832Asp)
NM_000251.2(MSH2):c.24G>T (p.Thr8=) rs1166025357
NM_000251.2(MSH2):c.2500G>A (p.Ala834Thr) rs63750757
NM_000251.2(MSH2):c.2502_2508delTAATTTC (p.Asn835Leufs) rs63751447
NM_000251.2(MSH2):c.2503A>C (p.Asn835His) rs41295296
NM_000251.2(MSH2):c.2503A>G (p.Asn835Asp) rs41295296
NM_000251.2(MSH2):c.2504A>G (p.Asn835Ser) rs779729016
NM_000251.2(MSH2):c.2506T>A (p.Phe836Ile) rs1553370345
NM_000251.2(MSH2):c.2507delT (p.Phe836Serfs) rs63750008
NM_000251.2(MSH2):c.2508C>T (p.Phe836=) rs965790911
NM_000251.2(MSH2):c.2509C>T (p.Pro837Ser) rs1198289499
NM_000251.2(MSH2):c.2515C>G (p.His839Asp) rs876659466
NM_000251.2(MSH2):c.2516A>G (p.His839Arg) rs63750027
NM_000251.2(MSH2):c.2517T>A (p.His839Gln) rs267608016
NM_000251.2(MSH2):c.2518G>A (p.Val840Ile) rs878853812
NM_000251.2(MSH2):c.2519T>C (p.Val840Ala) rs1064794561
NM_000251.2(MSH2):c.251del (p.Asn84Ilefs) rs786202037
NM_000251.2(MSH2):c.2520A>C (p.Val840=) rs1057522090
NM_000251.2(MSH2):c.2520A>G (p.Val840=) rs1057522090
NM_000251.2(MSH2):c.2520_2521delAAinsT (p.Ile841Terfs) rs587779147
NM_000251.2(MSH2):c.2521delA (p.Ile841Terfs) rs587779147
NM_000251.2(MSH2):c.2522T>C (p.Ile841Thr) rs1275767178
NM_000251.2(MSH2):c.2523dup (p.Glu842Argfs) rs1553370366
NM_000251.2(MSH2):c.2525A>T (p.Glu842Val) rs373393954
NM_000251.2(MSH2):c.2525_2526delAG (p.Glu842Valfs) rs587779148
NM_000251.2(MSH2):c.2528G>A (p.Cys843Tyr) rs747700106
NM_000251.2(MSH2):c.2528G>C (p.Cys843Ser) rs747700106
NM_000251.2(MSH2):c.2529_2530delTG (p.Ala844Terfs) rs63749975
NM_000251.2(MSH2):c.2532dup (p.Lys845Terfs) rs1553370371
NM_000251.2(MSH2):c.2533A>G (p.Lys845Glu) rs63750571
NM_000251.2(MSH2):c.2536C>T (p.Gln846Ter) rs63750857
NM_000251.2(MSH2):c.2536_2541delCAGAAA (p.Gln846_Lys847del) rs879254133
NM_000251.2(MSH2):c.2537A>G (p.Gln846Arg) rs140754514
NM_000251.2(MSH2):c.2542G>A (p.Ala848Thr) rs746972142
NM_000251.2(MSH2):c.2542G>T (p.Ala848Ser) rs746972142
NM_000251.2(MSH2):c.2545C>G (p.Leu849Val) rs587778527
NM_000251.2(MSH2):c.2545C>T (p.Leu849=) rs587778527
NM_000251.2(MSH2):c.2545delC (p.Leu849Trpfs) rs587779149
NM_000251.2(MSH2):c.2551C>A (p.Leu851Ile) rs267608015
NM_000251.2(MSH2):c.2551C>G (p.Leu851Val) rs267608015
NM_000251.2(MSH2):c.2551_2552insCA (p.Leu851Profs) rs1553370381
NM_000251.2(MSH2):c.2554G>A (p.Glu852Lys) rs587779966
NM_000251.2(MSH2):c.2554G>C (p.Glu852Gln) rs587779966
NM_000251.2(MSH2):c.2556G>C (p.Glu852Asp) rs587781453
NM_000251.2(MSH2):c.2557G>T (p.Glu853Ter) rs1553370397
NM_000251.2(MSH2):c.2557_2559delGAG (p.Glu853del) rs766906365
NM_000251.2(MSH2):c.2558A>C (p.Glu853Ala) rs63750797
NM_000251.2(MSH2):c.2558A>G (p.Glu853Gly) rs63750797
NM_000251.2(MSH2):c.2559G>A (p.Glu853=) rs1057522891
NM_000251.2(MSH2):c.255_256delTG (p.Phe85Leufs) rs267607921
NM_000251.2(MSH2):c.255dupT (p.Glu86Terfs) rs63751158
NM_000251.2(MSH2):c.2562T>C (p.Phe854=) rs1553370401
NM_000251.2(MSH2):c.2562del (p.Gln855Serfs) rs1114167836
NM_000251.2(MSH2):c.2563C>G (p.Gln855Glu) rs1553370404
NM_000251.2(MSH2):c.2563C>T (p.Gln855Ter) rs1553370404
NM_000251.2(MSH2):c.2564A>G (p.Gln855Arg) rs587782256
NM_000251.2(MSH2):c.2565G>T (p.Gln855His) rs1553370408
NM_000251.2(MSH2):c.2566T>C (p.Tyr856His) rs786203818
NM_000251.2(MSH2):c.2567A>G (p.Tyr856Cys) rs587779150
NM_000251.2(MSH2):c.2567A>T (p.Tyr856Phe) rs587779150
NM_000251.2(MSH2):c.2569A>G (p.Ile857Val) rs753459308
NM_000251.2(MSH2):c.2571T>G (p.Ile857Met) rs1400051085
NM_000251.2(MSH2):c.2572G>A (p.Gly858Arg) rs754533481
NM_000251.2(MSH2):c.2574A>G (p.Gly858=) rs1553370416
NM_000251.2(MSH2):c.2575G>A (p.Glu859Lys) rs63749830
NM_000251.2(MSH2):c.2575G>T (p.Glu859Ter) rs63749830
NM_000251.2(MSH2):c.2576A>C (p.Glu859Ala) rs1553370422
NM_000251.2(MSH2):c.2576_2584delAATCGCAAG (p.Glu859_Gln861del) rs587781278
NM_000251.2(MSH2):c.2579C>A (p.Ser860Ter) rs63750849
NM_000251.2(MSH2):c.2579C>T (p.Ser860Leu) rs63750849
NM_000251.2(MSH2):c.2580G>A (p.Ser860=) rs752428475
NM_000251.2(MSH2):c.2580G>T (p.Ser860=) rs752428475
NM_000251.2(MSH2):c.2581C>G (p.Gln861Glu)
NM_000251.2(MSH2):c.2581C>T (p.Gln861Ter) rs63750291
NM_000251.2(MSH2):c.2582A>C (p.Gln861Pro) rs1313098392
NM_000251.2(MSH2):c.2582A>T (p.Gln861Leu) rs1313098392
NM_000251.2(MSH2):c.2583A>G (p.Gln861=) rs63751093
NM_000251.2(MSH2):c.2584G>A (p.Gly862Arg) rs876660297
NM_000251.2(MSH2):c.2585G>T (p.Gly862Val) rs1216558739
NM_000251.2(MSH2):c.2585dup (p.Tyr863Ilefs) rs1553370431
NM_000251.2(MSH2):c.2586A>G (p.Gly862=) rs1060502024
NM_000251.2(MSH2):c.2588dup (p.Tyr863Terfs) rs1553370435
NM_000251.2(MSH2):c.2590G>A (p.Asp864Asn) rs1553370439
NM_000251.2(MSH2):c.2590G>T (p.Asp864Tyr) rs1553370439
NM_000251.2(MSH2):c.2591A>C (p.Asp864Ala) rs863224642
NM_000251.2(MSH2):c.2593_2597delATCAT (p.Ile865Glyfs) rs587779151
NM_000251.2(MSH2):c.2593dup (p.Ile865Asnfs) rs1553370443
NM_000251.2(MSH2):c.2594T>C (p.Ile865Thr) rs549759248
NM_000251.2(MSH2):c.2595C>A (p.Ile865=) rs547695133
NM_000251.2(MSH2):c.2595C>T (p.Ile865=) rs547695133
NM_000251.2(MSH2):c.2595_2597delCAT (p.Ile865del) rs759912716
NM_000251.2(MSH2):c.2596A>G (p.Met866Val) rs1553370453
NM_000251.2(MSH2):c.2598G>A (p.Met866Ile) rs1064795368
NM_000251.2(MSH2):c.2602C>G (p.Pro868Ala) rs63751400
NM_000251.2(MSH2):c.2606C>A (p.Ala869Glu) rs730881772
NM_000251.2(MSH2):c.2606C>T (p.Ala869Val)
NM_000251.2(MSH2):c.2607A>G (p.Ala869=) rs876658574
NM_000251.2(MSH2):c.2608G>T (p.Ala870Ser) rs1553370462
NM_000251.2(MSH2):c.2608_2609delGCinsTT (p.Ala870Leu) rs1553370464
NM_000251.2(MSH2):c.2609C>G (p.Ala870Gly) rs63750709
NM_000251.2(MSH2):c.260C>A (p.Ser87Tyr) rs587781447
NM_000251.2(MSH2):c.260C>G (p.Ser87Cys) rs587781447
NM_000251.2(MSH2):c.260_261insT (p.Val89Cysfs) rs267607920
NM_000251.2(MSH2):c.2612A>G (p.Lys871Arg) rs587782214
NM_000251.2(MSH2):c.2615A>C (p.Lys872Thr) rs587780686
NM_000251.2(MSH2):c.2615A>G (p.Lys872Arg) rs587780686
NM_000251.2(MSH2):c.2617T>G (p.Cys873Gly) rs63750795
NM_000251.2(MSH2):c.2618G>C (p.Cys873Ser)
NM_000251.2(MSH2):c.261T>C (p.Ser87=) rs1553350114
NM_000251.2(MSH2):c.2620T>G (p.Tyr874Asp) rs879254152
NM_000251.2(MSH2):c.2620_2621ins115 (p.?)
NM_000251.2(MSH2):c.2621A>G (p.Tyr874Cys) rs775390721
NM_000251.2(MSH2):c.2622T>A (p.Tyr874Ter) rs587779152
NM_000251.2(MSH2):c.2627A>G (p.Glu876Gly) rs1553370474
NM_000251.2(MSH2):c.2629delA (p.Arg877Glufs) rs886041613
NM_000251.2(MSH2):c.2633_2634delAG (p.Glu878Alafs) rs63751618
NM_000251.2(MSH2):c.2634+12T>C rs372907481
NM_000251.2(MSH2):c.2634+17_2634+25delTCATAGTTT rs1064794507
NM_000251.2(MSH2):c.2634+18C>T rs1553370495
NM_000251.2(MSH2):c.2634+19A>G
NM_000251.2(MSH2):c.2634+1G>A rs267608019
NM_000251.2(MSH2):c.2634+1G>T rs267608019
NM_000251.2(MSH2):c.2634+20T>C
NM_000251.2(MSH2):c.2634+2T>C
NM_000251.2(MSH2):c.2634+2T>G rs876660546
NM_000251.2(MSH2):c.2634+30delT rs267608021
NM_000251.2(MSH2):c.2634+4T>C rs1553370486
NM_000251.2(MSH2):c.2634+5G>C rs267608017
NM_000251.2(MSH2):c.2634+5G>T rs267608017
NM_000251.2(MSH2):c.2634+7C>G rs905179122
NM_000251.2(MSH2):c.2634+7C>T
NM_000251.2(MSH2):c.2634+8A>G rs1060502004
NM_000251.2(MSH2):c.2634+8_2634+9delAGinsCA rs1064794857
NM_000251.2(MSH2):c.2634+8delA rs1064794655
NM_000251.2(MSH2):c.2634+9G>T rs1553370493
NM_000251.2(MSH2):c.2634+9_2634+10del
NM_000251.2(MSH2):c.2634G>A (p.Glu878=) rs63751624
NM_000251.2(MSH2):c.2634G>C (p.Glu878Asp) rs63751624
NM_000251.2(MSH2):c.2635-11A>G rs201291595
NM_000251.2(MSH2):c.2635-11A>T rs201291595
NM_000251.2(MSH2):c.2635-12C>T rs1436357692
NM_000251.2(MSH2):c.2635-13A>G rs1553370816
NM_000251.2(MSH2):c.2635-15del rs1553370813
NM_000251.2(MSH2):c.2635-1G>A rs267608020
NM_000251.2(MSH2):c.2635-1G>C rs267608020
NM_000251.2(MSH2):c.2635-1G>T rs267608020
NM_000251.2(MSH2):c.2635-214T>C rs2042649
NM_000251.2(MSH2):c.2635-2A>C rs1114167818
NM_000251.2(MSH2):c.2635-2A>G
NM_000251.2(MSH2):c.2635-2A>T rs1114167818
NM_000251.2(MSH2):c.2635-320A>G rs77681063
NM_000251.2(MSH2):c.2635-325C>T rs116279697
NM_000251.2(MSH2):c.2635-3C>G rs587779153
NM_000251.2(MSH2):c.2635-5_2635-3inv
NM_000251.2(MSH2):c.2635-9G>A rs1553370824
NM_000251.2(MSH2):c.2635-?_*(272_?)del
NM_000251.2(MSH2):c.2635C>T (p.Gln879Ter) rs63751469
NM_000251.2(MSH2):c.2636A>C (p.Gln879Pro) rs1064793822
NM_000251.2(MSH2):c.2637A>G (p.Gln879=) rs1553370836
NM_000251.2(MSH2):c.263_264delTT (p.Phe88Cysfs) rs267607920
NM_000251.2(MSH2):c.2640T>C (p.Gly880=) rs1368565489
NM_000251.2(MSH2):c.2640_2656delTGAAAAAATTATTCAGG (p.Glu881Valfs) rs1064792951
NM_000251.2(MSH2):c.2641G>A (p.Glu881Lys) rs876660450
NM_000251.2(MSH2):c.2641G>C (p.Glu881Gln) rs876660450
NM_000251.2(MSH2):c.2645A>C (p.Lys882Thr)
NM_000251.2(MSH2):c.2647delA (p.Ile883Leufs) rs63750084
NM_000251.2(MSH2):c.2647dupA (p.Ile883Asnfs) rs63750084
NM_000251.2(MSH2):c.2648T>C (p.Ile883Thr) rs1064796682
NM_000251.2(MSH2):c.2649T>G (p.Ile883Met) rs768983827
NM_000251.2(MSH2):c.2650A>T (p.Ile884Phe) rs774732579
NM_000251.2(MSH2):c.2651T>C (p.Ile884Thr) rs63750409
NM_000251.2(MSH2):c.2651T>G (p.Ile884Ser) rs63750409
NM_000251.2(MSH2):c.2653C>T (p.Gln885Ter) rs63750808
NM_000251.2(MSH2):c.2655G>A (p.Gln885=) rs1057521018
NM_000251.2(MSH2):c.2655G>T (p.Gln885His) rs1057521018
NM_000251.2(MSH2):c.2656G>T (p.Glu886Ter) rs1230083633
NM_000251.2(MSH2):c.2657A>G (p.Glu886Gly) rs63750350
NM_000251.2(MSH2):c.265G>A (p.Val89Ile) rs587782586
NM_000251.2(MSH2):c.265G>C (p.Val89Leu) rs587782586
NM_000251.2(MSH2):c.2661C>G (p.Phe887Leu) rs1290935051
NM_000251.2(MSH2):c.2662delC (p.Leu888Cysfs) rs63751007
NM_000251.2(MSH2):c.2664G>C (p.Leu888=)
NM_000251.2(MSH2):c.2666C>T (p.Ser889Phe) rs1553370845
NM_000251.2(MSH2):c.2667C>G (p.Ser889=) rs561680100
NM_000251.2(MSH2):c.2668A>T (p.Lys890Ter) rs1114167880
NM_000251.2(MSH2):c.266T>C (p.Val89Ala) rs876659747
NM_000251.2(MSH2):c.2672T>G (p.Val891Gly) rs1239791741
NM_000251.2(MSH2):c.267A>C (p.Val89=) rs876658718
NM_000251.2(MSH2):c.267A>G (p.Val89=) rs876658718
NM_000251.2(MSH2):c.2680A>T (p.Met894Leu)
NM_000251.2(MSH2):c.2680dupA (p.Met894Asnfs) rs876658211
NM_000251.2(MSH2):c.2681T>C (p.Met894Thr)
NM_000251.2(MSH2):c.2681T>G (p.Met894Arg)
NM_000251.2(MSH2):c.2684C>G (p.Pro895Arg) rs786203553
NM_000251.2(MSH2):c.2684C>T (p.Pro895Leu) rs786203553
NM_000251.2(MSH2):c.2685C>A (p.Pro895=)
NM_000251.2(MSH2):c.2686T>G (p.Phe896Val)
NM_000251.2(MSH2):c.2688T>A (p.Phe896Leu)
NM_000251.2(MSH2):c.2691T>C (p.Thr897=) rs148653184
NM_000251.2(MSH2):c.2693A>C (p.Glu898Ala) rs1060502037
NM_000251.2(MSH2):c.2694A>C (p.Glu898Asp) rs890670494
NM_000251.2(MSH2):c.2697G>T (p.Met899Ile) rs878853813
NM_000251.2(MSH2):c.2699C>G (p.Ser900Ter) rs878853814
NM_000251.2(MSH2):c.269_290dup22 (p.Tyr98Argfs) rs1553350126
NM_000251.2(MSH2):c.2700A>G (p.Ser900=) rs786202996
NM_000251.2(MSH2):c.2705A>G (p.Glu902Gly) rs1553370856
NM_000251.2(MSH2):c.2706A>C (p.Glu902Asp) rs876660824
NM_000251.2(MSH2):c.2708A>G (p.Asn903Ser) rs876658389
NM_000251.2(MSH2):c.2714C>G (p.Thr905Arg) rs267608022
NM_000251.2(MSH2):c.2714C>T (p.Thr905Ile) rs267608022
NM_000251.2(MSH2):c.2716A>G (p.Ile906Val) rs876658598
NM_000251.2(MSH2):c.2717T>C (p.Ile906Thr) rs587780687
NM_000251.2(MSH2):c.2717T>G (p.Ile906Arg) rs587780687
NM_000251.2(MSH2):c.2718A>G (p.Ile906Met) rs876659835
NM_000251.2(MSH2):c.271G>C (p.Asp91His)
NM_000251.2(MSH2):c.2721G>A (p.Lys907=) rs1553370869
NM_000251.2(MSH2):c.2722T>A (p.Leu908Ile) rs1085308059
NM_000251.2(MSH2):c.2725A>C (p.Lys909Gln) rs879254253
NM_000251.2(MSH2):c.2725A>G (p.Lys909Glu)
NM_000251.2(MSH2):c.2726A>G (p.Lys909Arg) rs34319539
NM_000251.2(MSH2):c.2726A>T (p.Lys909Ile) rs34319539
NM_000251.2(MSH2):c.2728C>A (p.Gln910Lys) rs775130557
NM_000251.2(MSH2):c.2729A>G (p.Gln910Arg) rs1553370878
NM_000251.2(MSH2):c.272A>T (p.Asp91Val) rs876660914
NM_000251.2(MSH2):c.2730delG (p.Gln910Hisfs) rs1553370880
NM_000251.2(MSH2):c.2732T>C (p.Leu911Pro) rs41295182
NM_000251.2(MSH2):c.2732T>G (p.Leu911Arg) rs41295182
NM_000251.2(MSH2):c.2734A>C (p.Lys912Gln) rs1060501998
NM_000251.2(MSH2):c.2734A>G (p.Lys912Glu)
NM_000251.2(MSH2):c.2738C>G (p.Ala913Gly) rs1060502026
NM_000251.2(MSH2):c.2739T>C (p.Ala913=) rs1553370882
NM_000251.2(MSH2):c.2740G>T (p.Glu914Ter) rs267608024
NM_000251.2(MSH2):c.2741A>G (p.Glu914Gly)
NM_000251.2(MSH2):c.2743G>C (p.Val915Leu) rs1553370884
NM_000251.2(MSH2):c.2744T>C (p.Val915Ala) rs1399941088
NM_000251.2(MSH2):c.2745A>G (p.Val915=) rs1057520437
NM_000251.2(MSH2):c.2746A>T (p.Ile916Leu)
NM_000251.2(MSH2):c.2749G>A (p.Ala917Thr)
NM_000251.2(MSH2):c.274C>A (p.Leu92Ile) rs587779154
NM_000251.2(MSH2):c.274C>G (p.Leu92Val) rs587779154
NM_000251.2(MSH2):c.274C>T (p.Leu92Phe) rs587779154
NM_000251.2(MSH2):c.2754G>C (p.Lys918Asn) rs1553370893
NM_000251.2(MSH2):c.2754G>T (p.Lys918Asn)
NM_000251.2(MSH2):c.2757T>C (p.Asn919=) rs1354355913
NM_000251.2(MSH2):c.2758A>G (p.Asn920Asp) rs1553370894
NM_000251.2(MSH2):c.275T>A (p.Leu92His) rs1387584638
NM_000251.2(MSH2):c.2762G>A (p.Ser921Asn)
NM_000251.2(MSH2):c.2766T>C (p.Phe922=) rs55859129
NM_000251.2(MSH2):c.2766T>G (p.Phe922Leu)
NM_000251.2(MSH2):c.2768T>A (p.Val923Glu) rs146421227
NM_000251.2(MSH2):c.276T>G (p.Leu92=) rs1060504425
NM_000251.2(MSH2):c.2771A>G (p.Asn924Ser) rs779846182
NM_000251.2(MSH2):c.2775A>G (p.Glu925=) rs1057521004
NM_000251.2(MSH2):c.2776A>G (p.Ile926Val)
NM_000251.2(MSH2):c.2777T>A (p.Ile926Asn) rs199747712
NM_000251.2(MSH2):c.2779A>C (p.Ile927Leu) rs1553370905
NM_000251.2(MSH2):c.277C>T (p.Leu93Phe) rs63751429
NM_000251.2(MSH2):c.2782T>C (p.Ser928Pro) rs587781852
NM_000251.2(MSH2):c.2782T>G (p.Ser928Ala) rs587781852
NM_000251.2(MSH2):c.2785C>T (p.Arg929Ter) rs551060742
NM_000251.2(MSH2):c.2786G>A (p.Arg929Gln) rs587779967
NM_000251.2(MSH2):c.2786G>T (p.Arg929Leu) rs587779967
NM_000251.2(MSH2):c.2789T>A (p.Ile930Lys) rs587783054
NM_000251.2(MSH2):c.2789dupT (p.Val932Serfs) rs786202481
NM_000251.2(MSH2):c.278_279delTT (p.Leu93Profs) rs63749872
NM_000251.2(MSH2):c.2790A>G (p.Ile930Met) rs587779155
NM_000251.2(MSH2):c.2792A>C (p.Lys931Thr) rs267608023
NM_000251.2(MSH2):c.2795T>G (p.Val932Gly)
NM_000251.2(MSH2):c.2796T>G (p.Val932=)
NM_000251.2(MSH2):c.2797dupA (p.Thr933Asnfs) rs587779156
NM_000251.2(MSH2):c.2798C>G (p.Thr933Ser) rs587779968
NM_000251.2(MSH2):c.2798C>T (p.Thr933Ile) rs587779968
NM_000251.2(MSH2):c.2799T>A (p.Thr933=) rs1553370926
NM_000251.2(MSH2):c.279_281delTCT (p.Leu94del) rs267607919
NM_000251.2(MSH2):c.27G>A (p.Leu9=) rs1553348705
NM_000251.2(MSH2):c.2800A>T (p.Thr934Ser) rs786203590
NM_000251.2(MSH2):c.2801C>A (p.Thr934Lys) rs587779969
NM_000251.2(MSH2):c.2801C>T (p.Thr934Met) rs587779969
NM_000251.2(MSH2):c.2802G>A (p.Thr934=) rs150259097
NM_000251.2(MSH2):c.2802G>C (p.Thr934=) rs150259097
NM_000251.2(MSH2):c.2804G>A (p.Ter935=) rs876658335
NM_000251.2(MSH2):c.2804G>T (p.Ter935Leu) rs876658335
NM_000251.2(MSH2):c.280C>G (p.Leu94Val) rs1330621664
NM_000251.2(MSH2):c.280C>T (p.Leu94=) rs1330621664
NM_000251.2(MSH2):c.282G>A (p.Leu94=) rs752387348
NM_000251.2(MSH2):c.285T>C (p.Val95=) rs1369335343
NM_000251.2(MSH2):c.286C>T (p.Arg96Cys) rs1443234544
NM_000251.2(MSH2):c.287G>A (p.Arg96His) rs63750002
NM_000251.2(MSH2):c.289C>T (p.Gln97Ter) rs63750970
NM_000251.2(MSH2):c.289del (p.Gln97Serfs) rs1114167808
NM_000251.2(MSH2):c.28C>A (p.Gln10Lys) rs63751099
NM_000251.2(MSH2):c.28C>T (p.Gln10Ter) rs63751099
NM_000251.2(MSH2):c.290A>C (p.Gln97Pro)
NM_000251.2(MSH2):c.291G>A (p.Gln97=) rs1064794792
NM_000251.2(MSH2):c.291G>T (p.Gln97His) rs1064794792
NM_000251.2(MSH2):c.293A>G (p.Tyr98Cys) rs63750887
NM_000251.2(MSH2):c.293A>T (p.Tyr98Phe)
NM_000251.2(MSH2):c.294T>A (p.Tyr98Ter) rs763872353
NM_000251.2(MSH2):c.294T>C (p.Tyr98=) rs763872353
NM_000251.2(MSH2):c.294_295delTA (p.Tyr98Terfs) rs1553350167
NM_000251.2(MSH2):c.295A>C (p.Arg99=) rs63750230
NM_000251.2(MSH2):c.296G>A (p.Arg99Lys) rs1553350175
NM_000251.2(MSH2):c.297A>T (p.Arg99Ser) rs587782283
NM_000251.2(MSH2):c.29dupA (p.Leu11Valfs) rs63750589
NM_000251.2(MSH2):c.2T>G (p.Met1Arg) rs876658825
NM_000251.2(MSH2):c.301G>T (p.Glu101Ter) rs63750318
NM_000251.2(MSH2):c.301_306delGAAGTT (p.Glu101_Val102del) rs587779157
NM_000251.2(MSH2):c.304G>A (p.Val102Ile) rs193922373
NM_000251.2(MSH2):c.307T>C (p.Tyr103His) rs587780688
NM_000251.2(MSH2):c.308A>G (p.Tyr103Cys) rs63751173
NM_000251.2(MSH2):c.308A>T (p.Tyr103Phe)
NM_000251.2(MSH2):c.309del (p.Tyr103Terfs) rs1114167874
NM_000251.2(MSH2):c.30G>T (p.Gln10His) rs786203228
NM_000251.2(MSH2):c.311A>C (p.Lys104Thr) rs1553350191
NM_000251.2(MSH2):c.312G>A (p.Lys104=) rs372972328
NM_000251.2(MSH2):c.312G>C (p.Lys104Asn) rs372972328
NM_000251.2(MSH2):c.314A>G (p.Asn105Ser)
NM_000251.2(MSH2):c.315T>C (p.Asn105=) rs746066632
NM_000251.2(MSH2):c.317G>A (p.Arg106Lys) rs41295286
NM_000251.2(MSH2):c.317G>C (p.Arg106Thr) rs41295286
NM_000251.2(MSH2):c.319G>C (p.Ala107Pro) rs587779158
NM_000251.2(MSH2):c.320C>A (p.Ala107Asp) rs876658935
NM_000251.2(MSH2):c.320C>G (p.Ala107Gly) rs876658935
NM_000251.2(MSH2):c.320C>T (p.Ala107Val) rs876658935
NM_000251.2(MSH2):c.323G>A (p.Gly108Glu) rs1183145967
NM_000251.2(MSH2):c.323G>T (p.Gly108Val) rs1183145967
NM_000251.2(MSH2):c.326A>G (p.Asn109Ser) rs749545338
NM_000251.2(MSH2):c.327T>C (p.Asn109=) rs63751437
NM_000251.2(MSH2):c.328A>C (p.Lys110Gln) rs587779970
NM_000251.2(MSH2):c.329A>G (p.Lys110Arg) rs63751040
NM_000251.2(MSH2):c.330G>C (p.Lys110Asn)
NM_000251.2(MSH2):c.331G>A (p.Ala111Thr) rs1553350215
NM_000251.2(MSH2):c.333A>G (p.Ala111=) rs1060504408
NM_000251.2(MSH2):c.335C>G (p.Ser112Cys) rs769215192
NM_000251.2(MSH2):c.335C>T (p.Ser112Phe) rs769215192
NM_000251.2(MSH2):c.336C>A (p.Ser112=) rs34312619
NM_000251.2(MSH2):c.339G>A (p.Lys113=) rs35898375
NM_000251.2(MSH2):c.339G>C (p.Lys113Asn)
NM_000251.2(MSH2):c.340G>T (p.Glu114Ter) rs878853815
NM_000251.2(MSH2):c.343A>T (p.Asn115Tyr) rs1553350228
NM_000251.2(MSH2):c.344delA (p.Asn115Metfs) rs63751195
NM_000251.2(MSH2):c.347A>T (p.Asp116Val) rs1035655051
NM_000251.2(MSH2):c.347_350delATTG (p.Asp116Glyfs) rs63750501
NM_000251.2(MSH2):c.349T>G (p.Trp117Gly) rs1553350243
NM_000251.2(MSH2):c.34G>C (p.Glu12Gln) rs917968387
NM_000251.2(MSH2):c.34dupG (p.Glu12Glyfs) rs63750614
NM_000251.2(MSH2):c.350G>A (p.Trp117Ter) rs786202083
NM_000251.2(MSH2):c.350G>C (p.Trp117Ser) rs786202083
NM_000251.2(MSH2):c.350G>T (p.Trp117Leu)
NM_000251.2(MSH2):c.352_358delTATTTGG (p.Tyr118Hisfs) rs879254025
NM_000251.2(MSH2):c.352dupT (p.Tyr118Leufs) rs587779159
NM_000251.2(MSH2):c.353A>G (p.Tyr118Cys) rs1291162195
NM_000251.2(MSH2):c.354T>G (p.Tyr118Ter) rs1553350250
NM_000251.2(MSH2):c.35A>C (p.Glu12Ala) rs1553348722
NM_000251.2(MSH2):c.361T>A (p.Tyr121Asn) rs878853816
NM_000251.2(MSH2):c.362A>G (p.Tyr121Cys) rs587779971
NM_000251.2(MSH2):c.362delA (p.Tyr121Leufs) rs1114167831
NM_000251.2(MSH2):c.363T>G (p.Tyr121Ter) rs63750458
NM_000251.2(MSH2):c.365A>T (p.Lys122Met) rs863224643
NM_000251.2(MSH2):c.365delAinsCGG (p.Lys122Thrfs) rs1114167829
NM_000251.2(MSH2):c.366+14T>C rs1057521889
NM_000251.2(MSH2):c.366+18T>C rs775359941
NM_000251.2(MSH2):c.366+1G>A rs267607924
NM_000251.2(MSH2):c.366+1G>T rs267607924
NM_000251.2(MSH2):c.366+24A>G rs200890440
NM_000251.2(MSH2):c.366+25C>T rs764158568
NM_000251.2(MSH2):c.366+2T>C
NM_000251.2(MSH2):c.366+3A>G rs1221101310
NM_000251.2(MSH2):c.366+43G>A rs185555345
NM_000251.2(MSH2):c.366+4A>C rs876659880
NM_000251.2(MSH2):c.366+53A>C rs267607923
NM_000251.2(MSH2):c.366+88G>A rs864622763
NM_000251.2(MSH2):c.366+8T>C rs1057522956
NM_000251.2(MSH2):c.366+9C>T rs1553350269
NM_000251.2(MSH2):c.367-108A>C rs104895021
NM_000251.2(MSH2):c.367-13_367-6delTATTTTTAinsAATTTTT rs1064795557
NM_000251.2(MSH2):c.367-13del rs587779160
NM_000251.2(MSH2):c.367-168C>T
NM_000251.2(MSH2):c.367-19A>T rs730881783
NM_000251.2(MSH2):c.367-1G>A rs267607925
NM_000251.2(MSH2):c.367-20A>T rs1553350606
NM_000251.2(MSH2):c.367-3T>C
NM_000251.2(MSH2):c.367-3T>G
NM_000251.2(MSH2):c.367-480_645+644del
NM_000251.2(MSH2):c.367-4T>G rs876660764
NM_000251.2(MSH2):c.367-525_493del rs1553350466
NM_000251.2(MSH2):c.367-5C>G rs587782414
NM_000251.2(MSH2):c.367-5C>T rs587782414
NM_000251.2(MSH2):c.367-6A>G rs769501299
NM_000251.2(MSH2):c.367-?_1076+?del
NM_000251.2(MSH2):c.367-?_1276+?del
NM_000251.2(MSH2):c.367-?_1386+?del
NM_000251.2(MSH2):c.367-?_1759+?del
NM_000251.2(MSH2):c.367-?_645+?del
NM_000251.2(MSH2):c.367-?_942+?del
NM_000251.2(MSH2):c.368C>G (p.Ala123Gly) rs730881767
NM_000251.2(MSH2):c.368delC (p.Ala123Valfs) rs63750210
NM_000251.2(MSH2):c.36G>C (p.Glu12Asp)
NM_000251.2(MSH2):c.371C>G (p.Ser124Cys) rs1553350635
NM_000251.2(MSH2):c.373C>A (p.Pro125Thr) rs761767467
NM_000251.2(MSH2):c.374C>T (p.Pro125Leu) rs876659113
NM_000251.2(MSH2):c.376G>A (p.Gly126Ser) rs767371843
NM_000251.2(MSH2):c.376G>C (p.Gly126Arg) rs767371843
NM_000251.2(MSH2):c.380A>C (p.Asn127Thr)
NM_000251.2(MSH2):c.380A>G (p.Asn127Ser) rs17217772
NM_000251.2(MSH2):c.380A>T (p.Asn127Ile) rs17217772
NM_000251.2(MSH2):c.380_381delAT (p.Asn127Thrfs) rs63751227
NM_000251.2(MSH2):c.380dup (p.Asn127Lysfs)
NM_000251.2(MSH2):c.382C>G (p.Leu128Val) rs145649774
NM_000251.2(MSH2):c.383T>G (p.Leu128Arg) rs730881768
NM_000251.2(MSH2):c.384C>A (p.Leu128=) rs766694099
NM_000251.2(MSH2):c.384C>T (p.Leu128=) rs766694099
NM_000251.2(MSH2):c.386C>G (p.Ser129Cys) rs587779972
NM_000251.2(MSH2):c.386C>T (p.Ser129Phe) rs587779972
NM_000251.2(MSH2):c.387_388delTC (p.Gln130Valfs) rs63750924
NM_000251.2(MSH2):c.388C>T (p.Gln130Ter) rs1060501989
NM_000251.2(MSH2):c.388_389delCA (p.Gln130Valfs) rs63750704
NM_000251.2(MSH2):c.38G>A (p.Ser13Asn) rs63749907
NM_000251.2(MSH2):c.38G>T (p.Ser13Ile) rs63749907
NM_000251.2(MSH2):c.390G>C (p.Gln130His)
NM_000251.2(MSH2):c.391T>G (p.Phe131Val) rs755423698
NM_000251.2(MSH2):c.398A>G (p.Asp133Gly) rs984353312
NM_000251.2(MSH2):c.399C>T (p.Asp133=) rs61756462
NM_000251.2(MSH2):c.399delC (p.Asp133Glufs) rs63751290
NM_000251.2(MSH2):c.39C>A (p.Ser13Arg) rs1060502015
NM_000251.2(MSH2):c.39C>G (p.Ser13Arg)
NM_000251.2(MSH2):c.39_48delCGCGGCCGAG (p.Ser13Argfs) rs1064795264
NM_000251.2(MSH2):c.403C>G (p.Leu135Val) rs193096019
NM_000251.2(MSH2):c.403C>T (p.Leu135Phe) rs193096019
NM_000251.2(MSH2):c.405C>G (p.Leu135=) rs778368203
NM_000251.2(MSH2):c.408T>G (p.Phe136Leu)
NM_000251.2(MSH2):c.408delT (p.Phe136Leufs) rs63750408
NM_000251.2(MSH2):c.409G>C (p.Gly137Arg) rs587781795
NM_000251.2(MSH2):c.40G>A (p.Ala14Thr) rs876658277
NM_000251.2(MSH2):c.412A>G (p.Asn138Asp) rs1553350673
NM_000251.2(MSH2):c.413A>G (p.Asn138Ser) rs769154205
NM_000251.2(MSH2):c.416A>G (p.Asn139Ser) rs1553350676
NM_000251.2(MSH2):c.416delA (p.Asn139Metfs) rs63750401
NM_000251.2(MSH2):c.420dup (p.Met141Tyrfs) rs1114167810
NM_000251.2(MSH2):c.421A>G (p.Met141Val) rs193922374
NM_000251.2(MSH2):c.421_422delAT (p.Met141Valfs) rs1553350680
NM_000251.2(MSH2):c.422T>C (p.Met141Thr) rs768313658
NM_000251.2(MSH2):c.424T>G (p.Ser142Ala) rs1064795714
NM_000251.2(MSH2):c.425C>A (p.Ser142Ter) rs63750910
NM_000251.2(MSH2):c.425C>G (p.Ser142Ter) rs63750910
NM_000251.2(MSH2):c.426A>G (p.Ser142=) rs937438549
NM_000251.2(MSH2):c.427G>A (p.Ala143Thr) rs878853817
NM_000251.2(MSH2):c.428C>G (p.Ala143Gly) rs1553350694
NM_000251.2(MSH2):c.429T>C (p.Ala143=) rs1553350698
NM_000251.2(MSH2):c.42G>A (p.Ala14=) rs374396150
NM_000251.2(MSH2):c.431C>G (p.Ser144Cys) rs878853818
NM_000251.2(MSH2):c.432C>T (p.Ser144=)
NM_000251.2(MSH2):c.433A>G (p.Ile145Val) rs876659264
NM_000251.2(MSH2):c.434T>C (p.Ile145Thr) rs774132884
NM_000251.2(MSH2):c.435T>G (p.Ile145Met) rs63750124
NM_000251.2(MSH2):c.436G>C (p.Gly146Arg)
NM_000251.2(MSH2):c.437G>T (p.Gly146Val) rs772052262
NM_000251.2(MSH2):c.438T>C (p.Gly146=) rs587779161
NM_000251.2(MSH2):c.438T>G (p.Gly146=) rs587779161
NM_000251.2(MSH2):c.439G>A (p.Val147Ile) rs773125415
NM_000251.2(MSH2):c.439_440dup (p.Val148Leufs)
NM_000251.2(MSH2):c.43G>A (p.Ala15Thr) rs1183892581
NM_000251.2(MSH2):c.440T>G (p.Val147Gly) rs760851623
NM_000251.2(MSH2):c.443T>A (p.Val148Glu) rs1553350714
NM_000251.2(MSH2):c.443T>C (p.Val148Ala)
NM_000251.2(MSH2):c.443delT (p.Val148Glyfs) rs1553350721
NM_000251.2(MSH2):c.445_456del (p.Gly149_Met152del) rs1114167871
NM_000251.2(MSH2):c.446G>A (p.Gly149Asp) rs587779162
NM_000251.2(MSH2):c.446G>C (p.Gly149Ala) rs587779162
NM_000251.2(MSH2):c.447T>C (p.Gly149=) rs786203142
NM_000251.2(MSH2):c.448G>A (p.Val150Ile)
NM_000251.2(MSH2):c.452A>C (p.Lys151Thr)
NM_000251.2(MSH2):c.454delA (p.Met152Cysfs) rs63751449
NM_000251.2(MSH2):c.454dup (p.Met152Asnfs) rs63751449
NM_000251.2(MSH2):c.458C>G (p.Ser153Cys) rs766349734
NM_000251.2(MSH2):c.459C>T (p.Ser153=) rs63751065
NM_000251.2(MSH2):c.45C>T (p.Ala15=) rs876659170
NM_000251.2(MSH2):c.460G>A (p.Ala154Thr) rs759712763
NM_000251.2(MSH2):c.462A>C (p.Ala154=) rs1553350740
NM_000251.2(MSH2):c.464T>A (p.Val155Asp) rs876658188
NM_000251.2(MSH2):c.464T>C (p.Val155Ala) rs876658188
NM_000251.2(MSH2):c.464T>G (p.Val155Gly) rs876658188
NM_000251.2(MSH2):c.465_466delTGinsA (p.Asp156Metfs) rs1114167884
NM_000251.2(MSH2):c.470G>C (p.Gly157Ala) rs765489269
NM_000251.2(MSH2):c.470G>T (p.Gly157Val)
NM_000251.2(MSH2):c.471C>A (p.Gly157=) rs61756463
NM_000251.2(MSH2):c.471C>T (p.Gly157=) rs61756463
NM_000251.2(MSH2):c.472C>T (p.Gln158Ter) rs63751226
NM_000251.2(MSH2):c.475delA (p.Arg159Aspfs) rs1553350758
NM_000251.2(MSH2):c.475dupA (p.Arg159Lysfs) rs786204319
NM_000251.2(MSH2):c.476G>T (p.Arg159Ile) rs786202921
NM_000251.2(MSH2):c.478C>A (p.Gln160Lys) rs63751426
NM_000251.2(MSH2):c.478C>T (p.Gln160Ter) rs63751426
NM_000251.2(MSH2):c.47A>C (p.Glu16Ala) rs745771647
NM_000251.2(MSH2):c.480G>T (p.Gln160His)
NM_000251.2(MSH2):c.481G>A (p.Val161Ile) rs149511545
NM_000251.2(MSH2):c.481G>C (p.Val161Leu)
NM_000251.2(MSH2):c.482T>A (p.Val161Asp) rs63750126
NM_000251.2(MSH2):c.482T>C (p.Val161Ala)
NM_000251.2(MSH2):c.484G>A (p.Gly162Arg) rs63750624
NM_000251.2(MSH2):c.485G>C (p.Gly162Ala) rs63750773
NM_000251.2(MSH2):c.488T>A (p.Val163Asp) rs63750214
NM_000251.2(MSH2):c.488T>C (p.Val163Ala) rs63750214
NM_000251.2(MSH2):c.488T>G (p.Val163Gly) rs63750214
NM_000251.2(MSH2):c.48G>A (p.Glu16=) rs1060502036
NM_000251.2(MSH2):c.48G>C (p.Glu16Asp) rs1060502036
NM_000251.2(MSH2):c.490G>A (p.Gly164Arg) rs63750582
NM_000251.2(MSH2):c.490G>T (p.Gly164Trp) rs63750582
NM_000251.2(MSH2):c.491G>A (p.Gly164Glu) rs786204082
NM_000251.2(MSH2):c.493T>G (p.Tyr165Asp) rs587779163
NM_000251.2(MSH2):c.494A>G (p.Tyr165Cys) rs1553350772
NM_000251.2(MSH2):c.495T>G (p.Tyr165Ter) rs63749949
NM_000251.2(MSH2):c.499G>C (p.Asp167His) rs63750255
NM_000251.2(MSH2):c.49G>A (p.Val17Ile) rs63750966
NM_000251.2(MSH2):c.49G>C (p.Val17Leu) rs63750966
NM_000251.2(MSH2):c.49G>T (p.Val17Phe) rs63750966
NM_000251.2(MSH2):c.4G>A (p.Ala2Thr) rs63750466
NM_000251.2(MSH2):c.4_21dup18 (p.Glu7_Thr8insAlaValGlnProLysGlu) rs281864943
NM_000251.2(MSH2):c.501T>C (p.Asp167=) rs757733033
NM_000251.2(MSH2):c.503C>T (p.Ser168Phe) rs1244537662
NM_000251.2(MSH2):c.504C>T (p.Ser168=) rs1200735883
NM_000251.2(MSH2):c.505A>G (p.Ile169Val) rs63750716
NM_000251.2(MSH2):c.506T>C (p.Ile169Thr) rs1060502011
NM_000251.2(MSH2):c.506_509delTACA (p.Ile169Argfs) rs63751013
NM_000251.2(MSH2):c.507A>G (p.Ile169Met) rs748762580
NM_000251.2(MSH2):c.508C>G (p.Gln170Glu) rs63750843
NM_000251.2(MSH2):c.508C>T (p.Gln170Ter) rs63750843
NM_000251.2(MSH2):c.509A>G (p.Gln170Arg) rs1114167865
NM_000251.2(MSH2):c.510dupG (p.Arg171Glufs) rs1553350787
NM_000251.2(MSH2):c.511_583dup73 (p.Gly195Glufs) rs1553350789
NM_000251.2(MSH2):c.512G>A (p.Arg171Lys) rs63750902
NM_000251.2(MSH2):c.513delG (p.Lys172Asnfs) rs63750933
NM_000251.2(MSH2):c.516A>G (p.Lys172=) rs1553350796
NM_000251.2(MSH2):c.518T>C (p.Leu173Pro) rs63750070
NM_000251.2(MSH2):c.518T>G (p.Leu173Arg) rs63750070
NM_000251.2(MSH2):c.518delT (p.Leu173Glnfs) rs63750069
NM_000251.2(MSH2):c.519A>G (p.Leu173=) rs1553350805
NM_000251.2(MSH2):c.51C>A (p.Val17=) rs397515879
NM_000251.2(MSH2):c.51C>T (p.Val17=) rs397515879
NM_000251.2(MSH2):c.523_564del42 (p.Leu175_Glu188del) rs63750705
NM_000251.2(MSH2):c.524T>C (p.Leu175Pro) rs63751291
NM_000251.2(MSH2):c.525G>A (p.Leu175=) rs771827041
NM_000251.2(MSH2):c.525G>T (p.Leu175=) rs771827041
NM_000251.2(MSH2):c.525_532delGTGTGAAT (p.Cys176Profs) rs1114167877
NM_000251.2(MSH2):c.527G>T (p.Cys176Phe) rs1553350829
NM_000251.2(MSH2):c.528_529delTG (p.Cys176Terfs) rs587779164
NM_000251.2(MSH2):c.529G>A (p.Glu177Lys) rs63750382
NM_000251.2(MSH2):c.529G>T (p.Glu177Ter) rs63750382
NM_000251.2(MSH2):c.530A>G (p.Glu177Gly) rs786203795
NM_000251.2(MSH2):c.530A>T (p.Glu177Val) rs786203795
NM_000251.2(MSH2):c.530_531delAA (p.Glu177Valfs) rs63750551
NM_000251.2(MSH2):c.531A>G (p.Glu177=) rs1060504416
NM_000251.2(MSH2):c.531A>T (p.Glu177Asp) rs1060504416
NM_000251.2(MSH2):c.533T>A (p.Phe178Tyr)
NM_000251.2(MSH2):c.534C>G (p.Phe178Leu) rs1553350837
NM_000251.2(MSH2):c.535_536del (p.Pro179Terfs) rs1114167812
NM_000251.2(MSH2):c.536C>T (p.Pro179Leu) rs902336078
NM_000251.2(MSH2):c.536del (p.Pro179Leufs) rs1114167812
NM_000251.2(MSH2):c.53G>A (p.Gly18Asp)
NM_000251.2(MSH2):c.540T>C (p.Asp180=) rs1553350845
NM_000251.2(MSH2):c.543T>C (p.Asn181=) rs528114416
NM_000251.2(MSH2):c.544G>T (p.Asp182Tyr) rs730881770
NM_000251.2(MSH2):c.547C>A (p.Gln183Lys) rs63750037
NM_000251.2(MSH2):c.547C>T (p.Gln183Ter) rs63750037
NM_000251.2(MSH2):c.548A>G (p.Gln183Arg)
NM_000251.2(MSH2):c.54C>G (p.Gly18=) rs63750777
NM_000251.2(MSH2):c.54C>T (p.Gly18=) rs63750777
NM_000251.2(MSH2):c.551delT (p.Phe184Serfs) rs267607928
NM_000251.2(MSH2):c.552C>A (p.Phe184Leu)
NM_000251.2(MSH2):c.552C>T (p.Phe184=) rs786202238
NM_000251.2(MSH2):c.554C>T (p.Ser185Phe) rs878853819
NM_000251.2(MSH2):c.556A>C (p.Asn186His) rs766497093
NM_000251.2(MSH2):c.557A>G (p.Asn186Ser) rs151129360
NM_000251.2(MSH2):c.559C>A (p.Leu187Ile) rs759603999
NM_000251.2(MSH2):c.559C>T (p.Leu187Phe) rs759603999
NM_000251.2(MSH2):c.55T>C (p.Phe19Leu) rs141711342
NM_000251.2(MSH2):c.55T>G (p.Phe19Val) rs141711342
NM_000251.2(MSH2):c.560T>C (p.Leu187Pro) rs63751444
NM_000251.2(MSH2):c.560T>G (p.Leu187Arg) rs63751444
NM_000251.2(MSH2):c.561_569delTGAGGCTCT (p.Glu188_Leu190del) rs63750088
NM_000251.2(MSH2):c.562G>C (p.Glu188Gln) rs1064795622
NM_000251.2(MSH2):c.563del (p.Glu188Glyfs) rs1114167885
NM_000251.2(MSH2):c.564G>A (p.Glu188=) rs1553350883
NM_000251.2(MSH2):c.565G>A (p.Ala189Thr) rs63750821
NM_000251.2(MSH2):c.565G>T (p.Ala189Ser) rs63750821
NM_000251.2(MSH2):c.565_566dup (p.Leu191Serfs) rs1114167855
NM_000251.2(MSH2):c.566C>G (p.Ala189Gly) rs141021599
NM_000251.2(MSH2):c.567T>C (p.Ala189=) rs1553350889
NM_000251.2(MSH2):c.569T>C (p.Leu190Pro) rs1114167878
NM_000251.2(MSH2):c.569_570delTCinsCT (p.Leu190Pro) rs267607927
NM_000251.2(MSH2):c.570C>T (p.Leu190=) rs764573221
NM_000251.2(MSH2):c.571C>T (p.Leu191Phe) rs1553350898
NM_000251.2(MSH2):c.571_573delCTC (p.Leu191del) rs587779165
NM_000251.2(MSH2):c.573C>T (p.Leu191=) rs1800151
NM_000251.2(MSH2):c.574A>T (p.Ile192Phe) rs768006988
NM_000251.2(MSH2):c.576C>G (p.Ile192Met)
NM_000251.2(MSH2):c.576C>T (p.Ile192=) rs864622381
NM_000251.2(MSH2):c.577C>T (p.Gln193Ter) rs63751326
NM_000251.2(MSH2):c.581T>C (p.Ile194Thr) rs730881778
NM_000251.2(MSH2):c.586C>T (p.Pro196Ser) rs587782804
NM_000251.2(MSH2):c.587C>A (p.Pro196Gln) rs754478179
NM_000251.2(MSH2):c.587delC (p.Pro196Glnfs) rs63750682
NM_000251.2(MSH2):c.588A>C (p.Pro196=) rs1553350915
NM_000251.2(MSH2):c.589A>C (p.Lys197Gln) rs778573140
NM_000251.2(MSH2):c.589A>G (p.Lys197Glu) rs778573140
NM_000251.2(MSH2):c.58G>A (p.Val20Met) rs1198168331
NM_000251.2(MSH2):c.591G>A (p.Lys197=) rs876659506
NM_000251.2(MSH2):c.592G>A (p.Glu198Lys) rs587779166
NM_000251.2(MSH2):c.592G>T (p.Glu198Ter) rs587779166
NM_000251.2(MSH2):c.592dupG (p.Glu198Glyfs) rs63750786
NM_000251.2(MSH2):c.593A>G (p.Glu198Gly) rs63750327
NM_000251.2(MSH2):c.594A>G (p.Glu198=) rs369685768
NM_000251.2(MSH2):c.594A>T (p.Glu198Asp) rs369685768
NM_000251.2(MSH2):c.595T>C (p.Cys199Arg) rs63751110
NM_000251.2(MSH2):c.595T>G (p.Cys199Gly) rs63751110
NM_000251.2(MSH2):c.596G>A (p.Cys199Tyr) rs63751136
NM_000251.2(MSH2):c.598G>A (p.Val200Ile)
NM_000251.2(MSH2):c.599T>A (p.Val200Asp) rs587779167
NM_000251.2(MSH2):c.5C>A (p.Ala2Glu) rs587778521
NM_000251.2(MSH2):c.5C>T (p.Ala2Val) rs587778521
NM_000251.2(MSH2):c.602T>A (p.Leu201Ter) rs1114167839
NM_000251.2(MSH2):c.605C>G (p.Pro202Arg) rs1060502002
NM_000251.2(MSH2):c.605C>T (p.Pro202Leu)
NM_000251.2(MSH2):c.606C>A (p.Pro202=)
NM_000251.2(MSH2):c.606C>G (p.Pro202=) rs63750600
NM_000251.2(MSH2):c.606C>T (p.Pro202=) rs63750600
NM_000251.2(MSH2):c.607G>A (p.Gly203Arg) rs587779973
NM_000251.2(MSH2):c.60G>A (p.Val20=) rs368874228
NM_000251.2(MSH2):c.610G>A (p.Gly204Arg) rs63750574
NM_000251.2(MSH2):c.610G>T (p.Gly204Ter) rs63750574
NM_000251.2(MSH2):c.611G>A (p.Gly204Glu) rs770787472
NM_000251.2(MSH2):c.611G>C (p.Gly204Ala) rs770787472
NM_000251.2(MSH2):c.613G>C (p.Glu205Gln) rs63749984
NM_000251.2(MSH2):c.613G>T (p.Glu205Ter) rs63749984
NM_000251.2(MSH2):c.613_616dup (p.Thr206Argfs) rs1553350946
NM_000251.2(MSH2):c.615G>C (p.Glu205Asp) rs1553350951
NM_000251.2(MSH2):c.616dupA (p.Thr206Asnfs) rs63750995
NM_000251.2(MSH2):c.617C>G (p.Thr206Ser) rs876658623
NM_000251.2(MSH2):c.618T>G (p.Thr206=)
NM_000251.2(MSH2):c.619G>A (p.Ala207Thr) rs63750913
NM_000251.2(MSH2):c.619G>T (p.Ala207Ser) rs63750913
NM_000251.2(MSH2):c.61C>T (p.Arg21Cys) rs774708147
NM_000251.2(MSH2):c.622_627dupGGAGAC (p.Asp209_Met210insGlyAsp) rs1553350958
NM_000251.2(MSH2):c.624A>C (p.Gly208=) rs786202651
NM_000251.2(MSH2):c.624A>T (p.Gly208=) rs786202651
NM_000251.2(MSH2):c.628A>G (p.Met210Val)
NM_000251.2(MSH2):c.628_629delAT (p.Met210Glyfs) rs1553350966
NM_000251.2(MSH2):c.62G>A (p.Arg21His) rs730881760
NM_000251.2(MSH2):c.62G>T (p.Arg21Leu) rs730881760
NM_000251.2(MSH2):c.62_63delGCinsTT (p.Arg21Leu) rs1060501996
NM_000251.2(MSH2):c.630G>A (p.Met210Ile)
NM_000251.2(MSH2):c.631G>A (p.Gly211Arg) rs587780689
NM_000251.2(MSH2):c.633G>A (p.Gly211=)
NM_000251.2(MSH2):c.633del (p.Lys212Asnfs) rs1114167821
NM_000251.2(MSH2):c.638T>A (p.Leu213Gln) rs1553350974
NM_000251.2(MSH2):c.638_639delTG (p.Leu213Glnfs) rs63751622
NM_000251.2(MSH2):c.639G>A (p.Leu213=) rs751250018
NM_000251.2(MSH2):c.63C>T (p.Arg21=) rs1060504419
NM_000251.2(MSH2):c.640A>G (p.Arg214Gly) rs1553350980
NM_000251.2(MSH2):c.641G>A (p.Arg214Lys) rs763298811
NM_000251.2(MSH2):c.641G>T (p.Arg214Ile) rs763298811
NM_000251.2(MSH2):c.642A>G (p.Arg214=) rs768931909
NM_000251.2(MSH2):c.642_645delACAG (p.Gln215Terfs) rs63751695
NM_000251.2(MSH2):c.643C>T (p.Gln215Ter) rs63751274
NM_000251.2(MSH2):c.643delC (p.Gln215Argfs)
NM_000251.2(MSH2):c.644del (p.Gln215Argfs)
NM_000251.2(MSH2):c.645+11T>G rs1057522494
NM_000251.2(MSH2):c.645+17T>C rs1553350995
NM_000251.2(MSH2):c.645+19G>C rs750907559
NM_000251.2(MSH2):c.645+1G>A rs267607689
NM_000251.2(MSH2):c.645+1G>T rs267607689
NM_000251.2(MSH2):c.645+2T>C rs876658996
NM_000251.2(MSH2):c.645+2T>G rs876658996
NM_000251.2(MSH2):c.645+3A>G rs587779168
NM_000251.2(MSH2):c.645+8A>G rs140217708
NM_000251.2(MSH2):c.645+8A>T rs140217708
NM_000251.2(MSH2):c.646-11T>C rs879254124
NM_000251.2(MSH2):c.646-13T>C rs761205332
NM_000251.2(MSH2):c.646-14_646-13delTT rs1553351532
NM_000251.2(MSH2):c.646-16A>G rs565117135
NM_000251.2(MSH2):c.646-16A>T rs565117135
NM_000251.2(MSH2):c.646-18C>G rs140723233
NM_000251.2(MSH2):c.646-1G>C rs1114167888
NM_000251.2(MSH2):c.646-1_648delGATA rs1553351549
NM_000251.2(MSH2):c.646-2A>G rs587779169
NM_000251.2(MSH2):c.646-3T>C rs267607930
NM_000251.2(MSH2):c.646-3T>G rs267607930
NM_000251.2(MSH2):c.646-3_654del rs267607929
NM_000251.2(MSH2):c.646-4A>G rs587779974
NM_000251.2(MSH2):c.646-4_655del rs1114167851
NM_000251.2(MSH2):c.646-4dup rs1553351541
NM_000251.2(MSH2):c.646-6A>G rs1553351543
NM_000251.2(MSH2):c.646-8delC rs878853820
NM_000251.2(MSH2):c.646-?_*(272_?)del
NM_000251.2(MSH2):c.646-?_1076+?del
NM_000251.2(MSH2):c.646-?_1076+?dup431
NM_000251.2(MSH2):c.646-?_1276+?del
NM_000251.2(MSH2):c.646-?_1386+?del
NM_000251.2(MSH2):c.646-?_792+?del
NM_000251.2(MSH2):c.646-?_942+?del
NM_000251.2(MSH2):c.646A>G (p.Ile216Val) rs63749936
NM_000251.2(MSH2):c.646A>T (p.Ile216Leu)
NM_000251.2(MSH2):c.647T>C (p.Ile216Thr) rs786203108
NM_000251.2(MSH2):c.648_650delAAT (p.Ile217del) rs1553351554
NM_000251.2(MSH2):c.64T>A (p.Phe22Ile)
NM_000251.2(MSH2):c.64T>C (p.Phe22Leu) rs1189127007
NM_000251.2(MSH2):c.650_654delTTCAA (p.Ile217Lysfs) rs63751602
NM_000251.2(MSH2):c.652C>T (p.Gln218Ter) rs587779170
NM_000251.2(MSH2):c.654A>G (p.Gln218=)
NM_000251.2(MSH2):c.655dup (p.Arg219Lysfs)
NM_000251.2(MSH2):c.656G>C (p.Arg219Thr) rs878853821
NM_000251.2(MSH2):c.656_664delGAGGAGGAAins13 (p.?)
NM_000251.2(MSH2):c.661G>C (p.Gly221Arg)
NM_000251.2(MSH2):c.663A>G (p.Gly221=) rs1553351570
NM_000251.2(MSH2):c.664A>G (p.Ile222Val) rs763720908
NM_000251.2(MSH2):c.665T>C (p.Ile222Thr) rs1064795747
NM_000251.2(MSH2):c.667C>G (p.Leu223Val)
NM_000251.2(MSH2):c.668T>C (p.Leu223Pro) rs1060501992
NM_000251.2(MSH2):c.669G>A (p.Leu223=) rs751195930
NM_000251.2(MSH2):c.66C>G (p.Phe22Leu) rs200632093
NM_000251.2(MSH2):c.672C>G (p.Ile224Met) rs587779171
NM_000251.2(MSH2):c.672C>T (p.Ile224=) rs587779171
NM_000251.2(MSH2):c.674C>G (p.Thr225Arg) rs1553351576
NM_000251.2(MSH2):c.674C>T (p.Thr225Ile) rs1553351576
NM_000251.2(MSH2):c.675_679delAGAAAinsTAAT (p.Glu226Asnfs) rs587779172
NM_000251.2(MSH2):c.67T>C (p.Phe23Leu) rs372619120
NM_000251.2(MSH2):c.680_683delGAAA (p.Arg227Lysfs) rs587782537
NM_000251.2(MSH2):c.681A>C (p.Arg227Ser) rs876658956
NM_000251.2(MSH2):c.681A>T (p.Arg227Ser)
NM_000251.2(MSH2):c.682A>G (p.Lys228Glu) rs200313142
NM_000251.2(MSH2):c.685A>T (p.Lys229Ter) rs587779173
NM_000251.2(MSH2):c.686_687delAA (p.Lys229Serfs) rs63749897
NM_000251.2(MSH2):c.687_688insT (p.Ala230Cysfs) rs63750364
NM_000251.2(MSH2):c.687delA (p.Ala230Leufs) rs63749897
NM_000251.2(MSH2):c.687dupA (p.Ala230Serfs) rs63749897
NM_000251.2(MSH2):c.689C>G (p.Ala230Gly)
NM_000251.2(MSH2):c.689C>T (p.Ala230Val) rs1553351592
NM_000251.2(MSH2):c.690T>C (p.Ala230=) rs1553351595
NM_000251.2(MSH2):c.691G>A (p.Asp231Asn) rs1384841612
NM_000251.2(MSH2):c.691G>T (p.Asp231Tyr) rs1384841612
NM_000251.2(MSH2):c.691delG (p.Asp231Thrfs) rs587779174
NM_000251.2(MSH2):c.693C>T (p.Asp231=) rs541325199
NM_000251.2(MSH2):c.696_697delTT (p.Ser233Hisfs) rs63750426
NM_000251.2(MSH2):c.698C>G (p.Ser233Cys) rs587781724
NM_000251.2(MSH2):c.699C>A (p.Ser233=) rs1403583908
NM_000251.2(MSH2):c.6G>C (p.Ala2=) rs368270856
NM_000251.2(MSH2):c.6G>T (p.Ala2=) rs368270856
NM_000251.2(MSH2):c.700A>G (p.Thr234Ala) rs1212577306
NM_000251.2(MSH2):c.701C>G (p.Thr234Arg) rs730881773
NM_000251.2(MSH2):c.701C>T (p.Thr234Ile) rs730881773
NM_000251.2(MSH2):c.703A>G (p.Lys235Glu) rs749442037
NM_000251.2(MSH2):c.704_705delAA (p.Lys235Argfs) rs281864944
NM_000251.2(MSH2):c.705delA (p.Asp236Thrfs) rs281864944
NM_000251.2(MSH2):c.706G>C (p.Asp236His) rs1064793655
NM_000251.2(MSH2):c.707A>G (p.Asp236Gly) rs876660490
NM_000251.2(MSH2):c.708C>A (p.Asp236Glu) rs1553351613
NM_000251.2(MSH2):c.709A>G (p.Ile237Val) rs63751307
NM_000251.2(MSH2):c.70C>G (p.Gln24Glu) rs587779976
NM_000251.2(MSH2):c.70C>T (p.Gln24Ter) rs587779976
NM_000251.2(MSH2):c.710_716del (p.Ile237Argfs) rs1114167807
NM_000251.2(MSH2):c.711_714delTTAT (p.Tyr238Argfs) rs63751288
NM_000251.2(MSH2):c.712T>G (p.Tyr238Asp) rs1060501987
NM_000251.2(MSH2):c.713A>G (p.Tyr238Cys) rs1553351618
NM_000251.2(MSH2):c.714T>C (p.Tyr238=) rs369670665
NM_000251.2(MSH2):c.715C>G (p.Gln239Glu) rs63750488
NM_000251.2(MSH2):c.715C>T (p.Gln239Ter) rs63750488
NM_000251.2(MSH2):c.716A>G (p.Gln239Arg) rs199676483
NM_000251.2(MSH2):c.717_721delGGACCinsTTA (p.Gln239Hisfs) rs63750690
NM_000251.2(MSH2):c.719A>C (p.Asp240Ala)
NM_000251.2(MSH2):c.719A>G (p.Asp240Gly) rs878853822
NM_000251.2(MSH2):c.71dupA (p.Met26Hisfs) rs587779175
NM_000251.2(MSH2):c.721C>G (p.Leu241Val) rs1410859610
NM_000251.2(MSH2):c.721C>T (p.Leu241Phe) rs1410859610
NM_000251.2(MSH2):c.724A>C (p.Asn242His) rs1553351634
NM_000251.2(MSH2):c.725A>G (p.Asn242Ser) rs779051492
NM_000251.2(MSH2):c.725dupA (p.Asn242Lysfs) rs587779176
NM_000251.2(MSH2):c.726C>G (p.Asn242Lys) rs748427458
NM_000251.2(MSH2):c.726C>T (p.Asn242=) rs748427458
NM_000251.2(MSH2):c.727C>T (p.Arg243Trp) rs138857091
NM_000251.2(MSH2):c.728G>A (p.Arg243Gln) rs63751455
NM_000251.2(MSH2):c.729dup (p.Leu244Valfs) rs1553351651
NM_000251.2(MSH2):c.72G>C (p.Gln24His) rs1064794928
NM_000251.2(MSH2):c.731T>C (p.Leu244Ser) rs1553351657
NM_000251.2(MSH2):c.731del (p.Leu244Cysfs) rs876660655
NM_000251.2(MSH2):c.735G>C (p.Leu245Phe) rs864622271
NM_000251.2(MSH2):c.735G>T (p.Leu245Phe) rs864622271
NM_000251.2(MSH2):c.735dupG (p.Lys246Glufs) rs63750107
NM_000251.2(MSH2):c.736A>C (p.Lys246Gln) rs63750881
NM_000251.2(MSH2):c.736A>G (p.Lys246Glu) rs63750881
NM_000251.2(MSH2):c.736A>T (p.Lys246Ter) rs63750881
NM_000251.2(MSH2):c.73G>T (p.Gly25Cys) rs746259256
NM_000251.2(MSH2):c.73_74insC (p.Gly25Alafs) rs587779177
NM_000251.2(MSH2):c.741C>A (p.Gly247=) rs747321505
NM_000251.2(MSH2):c.741C>G (p.Gly247=) rs747321505
NM_000251.2(MSH2):c.742A>C (p.Lys248Gln)
NM_000251.2(MSH2):c.742A>G (p.Lys248Glu) rs587779178
NM_000251.2(MSH2):c.743A>G (p.Lys248Arg) rs1064794704
NM_000251.2(MSH2):c.744A>C (p.Lys248Asn) rs1060502022
NM_000251.2(MSH2):c.746A>C (p.Lys249Thr) rs61756464
NM_000251.2(MSH2):c.746A>G (p.Lys249Arg) rs61756464
NM_000251.2(MSH2):c.746delA (p.Lys249Argfs) rs63749832
NM_000251.2(MSH2):c.747G>A (p.Lys249=) rs786201568
NM_000251.2(MSH2):c.747G>C (p.Lys249Asn) rs786201568
NM_000251.2(MSH2):c.748G>A (p.Gly250Arg) rs864622183
NM_000251.2(MSH2):c.748G>T (p.Gly250Ter) rs864622183