ClinVar Miner

List of variants in gene MSH2 reported as likely pathogenic

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 207
Download table as spreadsheet
HGVS dbSNP
NC_000002.12:g.(?_47414259)_(47429951_?)dup
NC_000002.12:g.(?_47414263)_(47429947_?)dup
NC_000002.12:g.(?_47429736)_(47466814_?)del
NC_000002.12:g.47475254delG
NM_000251.2(MSH2):c.-78_-77del rs587779182
NM_000251.2(MSH2):c.1012G>C (p.Gly338Arg) rs63751004
NM_000251.2(MSH2):c.1015C>T (p.Gln339Ter)
NM_000251.2(MSH2):c.1022T>C (p.Leu341Pro) rs63751147
NM_000251.2(MSH2):c.1045C>A (p.Pro349Thr) rs267607939
NM_000251.2(MSH2):c.1046C>G (p.Pro349Arg) rs587779067
NM_000251.2(MSH2):c.1046C>T (p.Pro349Leu) rs587779067
NM_000251.2(MSH2):c.1046_1047delCTinsGC (p.Pro349Arg)
NM_000251.2(MSH2):c.1067T>G (p.Ile356Arg) rs753075410
NM_000251.2(MSH2):c.106_212-1229del
NM_000251.2(MSH2):c.1076+1G>T rs267607940
NM_000251.2(MSH2):c.1076G>C (p.Arg359Thr) rs63751604
NM_000251.2(MSH2):c.1077-1G>C rs267607944
NM_000251.2(MSH2):c.1077-1G>T rs267607944
NM_000251.2(MSH2):c.1077-2A>G rs267607943
NM_000251.2(MSH2):c.1077-2A>T rs267607943
NM_000251.2(MSH2):c.1077-66_1146del rs193922372
NM_000251.2(MSH2):c.1077-?_*279+?del
NM_000251.2(MSH2):c.1077-?_1276+?dup
NM_000251.2(MSH2):c.1090delG (p.Glu364Lysfs) rs863225385
NM_000251.2(MSH2):c.10C>T (p.Gln4Ter)
NM_000251.2(MSH2):c.1177A>T (p.Lys393Ter) rs863225386
NM_000251.2(MSH2):c.1224T>G (p.Tyr408Ter) rs63750132
NM_000251.2(MSH2):c.1237C>T (p.Gln413Ter) rs863225387
NM_000251.2(MSH2):c.1251_1268del18insAGTT (p.Ile418Valfs) rs863225388
NM_000251.2(MSH2):c.1276+1G>A rs267607950
NM_000251.2(MSH2):c.1276+1G>C rs267607950
NM_000251.2(MSH2):c.1276+1G>T rs267607950
NM_000251.2(MSH2):c.1276+2T>A rs267607953
NM_000251.2(MSH2):c.1276+2T>C rs267607953
NM_000251.2(MSH2):c.1277-1G>A rs267607948
NM_000251.2(MSH2):c.1277-1G>C rs267607948
NM_000251.2(MSH2):c.1277-2A>C rs267607949
NM_000251.2(MSH2):c.1277-2A>T
NM_000251.2(MSH2):c.1302delA (p.Val435Phefs) rs863225389
NM_000251.2(MSH2):c.1316_1318delCTC (p.Pro439del) rs587779082
NM_000251.2(MSH2):c.1319T>C (p.Leu440Pro) rs587779084
NM_000251.2(MSH2):c.1355A>T (p.Glu452Val) rs1553361274
NM_000251.2(MSH2):c.1386+1G>A rs267607957
NM_000251.2(MSH2):c.1386+1G>C rs267607957
NM_000251.2(MSH2):c.1386+1G>T rs267607957
NM_000251.2(MSH2):c.1387-1G>T rs267607956
NM_000251.2(MSH2):c.1401delA (p.Glu467Aspfs) rs1553365711
NM_000251.2(MSH2):c.1481C>G (p.Ser494Ter) rs370970617
NM_000251.2(MSH2):c.1510+1G>A rs1114167852
NM_000251.2(MSH2):c.1510+2T>C rs1060502023
NM_000251.2(MSH2):c.1510+2_1510+50del
NM_000251.2(MSH2):c.1511-1G>A
NM_000251.2(MSH2):c.1538_1539delTG (p.Leu513Argfs) rs863225391
NM_000251.2(MSH2):c.1571G>C (p.Arg524Pro) rs63751207
NM_000251.2(MSH2):c.1661+1G>A rs267607969
NM_000251.2(MSH2):c.1661+1G>T rs267607969
NM_000251.2(MSH2):c.1661+2T>C rs1553366680
NM_000251.2(MSH2):c.1661+5G>C rs267607972
NM_000251.2(MSH2):c.1662-12_1677delTTCGATTTGCAGCAAATTGACTTCTTTA rs864622436
NM_000251.2(MSH2):c.1662-2A>G rs267607971
NM_000251.2(MSH2):c.1667T>G (p.Leu556Trp) rs587779101
NM_000251.2(MSH2):c.1738_1741delGAAA (p.Glu580Leufs) rs1057524910
NM_000251.2(MSH2):c.1759+1G>A rs587779108
NM_000251.2(MSH2):c.1759+1G>C rs587779108
NM_000251.2(MSH2):c.1759+1G>T
NM_000251.2(MSH2):c.1759+2T>C rs267607976
NM_000251.2(MSH2):c.1759G>A (p.Gly587Ser) rs63751140
NM_000251.2(MSH2):c.1759G>C (p.Gly587Arg) rs63751140
NM_000251.2(MSH2):c.1759G>T (p.Gly587Cys) rs63751140
NM_000251.2(MSH2):c.1760-1G>A rs587779110
NM_000251.2(MSH2):c.1760-2_1783del26 rs1064795329
NM_000251.2(MSH2):c.1807G>A (p.Asp603Asn) rs63750657
NM_000251.2(MSH2):c.1808A>G (p.Asp603Gly) rs267607985
NM_000251.2(MSH2):c.1815_1817delTGT (p.Val606del) rs267607978
NM_000251.2(MSH2):c.1827delT (p.His610Thrfs) rs587779112
NM_000251.2(MSH2):c.1832T>A (p.Val611Glu) rs1553368590
NM_000251.2(MSH2):c.1838dup (p.Asn613Lysfs) rs1114167815
NM_000251.2(MSH2):c.1861C>G (p.Arg621Gly) rs63750508
NM_000251.2(MSH2):c.1862G>T (p.Arg621Leu) rs759263820
NM_000251.2(MSH2):c.1864C>A (p.Pro622Thr) rs63750280
NM_000251.2(MSH2):c.1865C>G (p.Pro622Arg) rs28929483
NM_000251.2(MSH2):c.1871T>G (p.Ile624Ser) rs1114167870
NM_000251.2(MSH2):c.1911delC (p.Arg638Glyfs) rs63750893
NM_000251.2(MSH2):c.1915C>T (p.His639Tyr) rs28929484
NM_000251.2(MSH2):c.1955C>A (p.Pro652His) rs267607983
NM_000251.2(MSH2):c.1979A>G (p.Asp660Gly) rs1085308057
NM_000251.2(MSH2):c.1982_1985delAACA (p.Lys661Argfs) rs587779120
NM_000251.2(MSH2):c.2004T>A (p.Thr668=) rs1553368731
NM_000251.2(MSH2):c.2005+1G>A rs267607986
NM_000251.2(MSH2):c.2005+1G>C rs267607986
NM_000251.2(MSH2):c.2005+1G>T rs267607986
NM_000251.2(MSH2):c.2005+2_2005+12del rs587779123
NM_000251.2(MSH2):c.2005+2del rs587779124
NM_000251.2(MSH2):c.2005+2dupT rs541623924
NM_000251.2(MSH2):c.2005+3_2005+14del12 rs587779125
NM_000251.2(MSH2):c.2005G>T (p.Gly669Cys) rs63751668
NM_000251.2(MSH2):c.2006-1G>C rs267607988
NM_000251.2(MSH2):c.2006-2A>G rs267607991
NM_000251.2(MSH2):c.2006-3T>G rs1553368975
NM_000251.2(MSH2):c.2013T>A (p.Asn671Lys) rs587779127
NM_000251.2(MSH2):c.2020G>C (p.Gly674Arg) rs63750234
NM_000251.2(MSH2):c.2021G>A (p.Gly674Asp) rs267607996
NM_000251.2(MSH2):c.2060T>C (p.Leu687Pro) rs587779133
NM_000251.2(MSH2):c.2074G>A (p.Gly692Arg) rs63750232
NM_000251.2(MSH2):c.2074G>C (p.Gly692Arg) rs63750232
NM_000251.2(MSH2):c.2074G>T (p.Gly692Trp) rs63750232
NM_000251.2(MSH2):c.2075G>A (p.Gly692Glu) rs63751432
NM_000251.2(MSH2):c.2075G>T (p.Gly692Val) rs63751432
NM_000251.2(MSH2):c.207_211+42del rs1553348901
NM_000251.2(MSH2):c.2081T>C (p.Phe694Ser) rs1114167857
NM_000251.2(MSH2):c.2087C>T (p.Pro696Leu) rs267607994
NM_000251.2(MSH2):c.2090G>A (p.Cys697Tyr) rs63750398
NM_000251.2(MSH2):c.20delA (p.Glu7Glyfs) rs267607915
NM_000251.2(MSH2):c.211+2T>C rs1060501993
NM_000251.2(MSH2):c.211G>C (p.Gly71Arg) rs587782659
NM_000251.2(MSH2):c.212-1G>A rs267607914
NM_000251.2(MSH2):c.212-2A>G rs267607917
NM_000251.2(MSH2):c.212-?_366+?dup
NM_000251.2(MSH2):c.2182_2199del (p.Glu728_Ala733del) rs1553369194
NM_000251.2(MSH2):c.2210+1G>A rs267608002
NM_000251.2(MSH2):c.2210+1G>C rs267608002
NM_000251.2(MSH2):c.2210_2210+1delGGinsTA rs1114167890
NM_000251.2(MSH2):c.2211-10T>A rs267608006
NM_000251.2(MSH2):c.2211-1G>T rs267607979
NM_000251.2(MSH2):c.2211-2A>C rs267608001
NM_000251.2(MSH2):c.2211-2A>G rs267608001
NM_000251.2(MSH2):c.2211-2A>T rs267608001
NM_000251.2(MSH2):c.2245G>A (p.Glu749Lys) rs63751477
NM_000251.2(MSH2):c.2251G>A (p.Gly751Arg) rs63751119
NM_000251.2(MSH2):c.2251G>C (p.Gly751Arg) rs63751119
NM_000251.2(MSH2):c.2295_2296insTA (p.Ile766Terfs) rs863225393
NM_000251.2(MSH2):c.2300C>G (p.Ser767Ter) rs863225395
NM_000251.2(MSH2):c.2304delA (p.Glu768Aspfs) rs587783053
NM_000251.2(MSH2):c.2320A>G (p.Ile774Val) rs775464903
NM_000251.2(MSH2):c.2335dupA (p.Met779Asnfs) rs63750149
NM_000251.2(MSH2):c.2363_2364delCT (p.Thr788Serfs) rs63750937
NM_000251.2(MSH2):c.2425G>T (p.Glu809Ter) rs202145681
NM_000251.2(MSH2):c.2458+1G>A rs267608010
NM_000251.2(MSH2):c.2458+1G>T rs267608010
NM_000251.2(MSH2):c.2458+2T>C
NM_000251.2(MSH2):c.2459-12A>G rs267608012
NM_000251.2(MSH2):c.2459-1G>A rs1060501991
NM_000251.2(MSH2):c.2459-1G>C
NM_000251.2(MSH2):c.2459-6_2459-2delTTATA rs1114167841
NM_000251.2(MSH2):c.2466T>A (p.Cys822Ter) rs63749846
NM_000251.2(MSH2):c.2494G>T (p.Glu832Ter) rs863225396
NM_000251.2(MSH2):c.2502_2508delTAATTTC (p.Asn835Leufs) rs63751447
NM_000251.2(MSH2):c.2588dup (p.Tyr863Terfs) rs1553370435
NM_000251.2(MSH2):c.2634+1G>A rs267608019
NM_000251.2(MSH2):c.2634+1G>T rs267608019
NM_000251.2(MSH2):c.2634+5G>T rs267608017
NM_000251.2(MSH2):c.2634G>A (p.Glu878=) rs63751624
NM_000251.2(MSH2):c.2634G>C (p.Glu878Asp) rs63751624
NM_000251.2(MSH2):c.2635-1G>A rs267608020
NM_000251.2(MSH2):c.2635-1G>T rs267608020
NM_000251.2(MSH2):c.2635-2A>C rs1114167818
NM_000251.2(MSH2):c.2635-2A>G
NM_000251.2(MSH2):c.2635-2A>T rs1114167818
NM_000251.2(MSH2):c.2635-5_2635-3inv
NM_000251.2(MSH2):c.2680dupA (p.Met894Asnfs) rs876658211
NM_000251.2(MSH2):c.277C>T (p.Leu93Phe) rs63751429
NM_000251.2(MSH2):c.301_306delGAAGTT (p.Glu101_Val102del) rs587779157
NM_000251.2(MSH2):c.340G>T (p.Glu114Ter) rs878853815
NM_000251.2(MSH2):c.354T>G (p.Tyr118Ter) rs1553350250
NM_000251.2(MSH2):c.366+1G>A rs267607924
NM_000251.2(MSH2):c.366+1G>T rs267607924
NM_000251.2(MSH2):c.367-1G>A rs267607925
NM_000251.2(MSH2):c.484G>A (p.Gly162Arg) rs63750624
NM_000251.2(MSH2):c.488T>A (p.Val163Asp) rs63750214
NM_000251.2(MSH2):c.491G>A (p.Gly164Glu) rs786204082
NM_000251.2(MSH2):c.493T>G (p.Tyr165Asp) rs587779163
NM_000251.2(MSH2):c.518T>C (p.Leu173Pro) rs63750070
NM_000251.2(MSH2):c.528_529delTG (p.Cys176Terfs) rs587779164
NM_000251.2(MSH2):c.560T>C (p.Leu187Pro) rs63751444
NM_000251.2(MSH2):c.571_573delCTC (p.Leu191del) rs587779165
NM_000251.2(MSH2):c.645+1G>T rs267607689
NM_000251.2(MSH2):c.645+2T>C rs876658996
NM_000251.2(MSH2):c.645+2T>G rs876658996
NM_000251.2(MSH2):c.646-2A>G rs587779169
NM_000251.2(MSH2):c.646-3T>G rs267607930
NM_000251.2(MSH2):c.646-3_654del rs267607929
NM_000251.2(MSH2):c.646-?_792+?del
NM_000251.2(MSH2):c.75delC (p.Met26Cysfs) rs1553348760
NM_000251.2(MSH2):c.792+1delG rs1064794155
NM_000251.2(MSH2):c.792+2T>C rs587782408
NM_000251.2(MSH2):c.792+2T>G
NM_000251.2(MSH2):c.793-1G>A rs863225397
NM_000251.2(MSH2):c.793-2A>C rs267607933
NM_000251.2(MSH2):c.793-?_1276+?dup
NM_000251.2(MSH2):c.806C>A (p.Ser269Ter) rs63750058
NM_000251.2(MSH2):c.845_848delATGA (p.Asp282Valfs) rs1553352462
NM_000251.2(MSH2):c.860dupG (p.Gln288Thrfs) rs193922375
NM_000251.2(MSH2):c.871delC (p.Leu291Terfs) rs1064794809
NM_000251.2(MSH2):c.929T>C (p.Leu310Pro) rs63750640
NM_000251.2(MSH2):c.942+1G>T rs587779193
NM_000251.2(MSH2):c.942+1delG
NM_000251.2(MSH2):c.942+2T>G rs587779195
NM_000251.2(MSH2):c.942+2_942+6delTAAAA rs755583143
NM_000251.2(MSH2):c.942+2del rs587779194
NM_000251.2(MSH2):c.943-1G>A rs12476364
NM_000251.2(MSH2):c.943-1G>C rs12476364
NM_000251.2(MSH2):c.943-2A>G rs587779198
NM_000251.2(MSH2):c.961_1006del (p.Thr321Leufs) rs1553353114
NM_000251.2(MSH2):c.989T>C (p.Leu330Pro) rs63750630
NM_000251.2(MSH2):c.997T>C (p.Cys333Arg) rs63750468
NM_000251.2(MSH2):c.998G>A (p.Cys333Tyr) rs63750828
NM_000251.2:c.1593del

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.