ClinVar Miner

List of variants in gene MSH2 reported by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 1588
Download table as spreadsheet
NM_000251.2(MSH2):c.-181G>A rs786201698
NM_000251.2(MSH2):c.-225G>C rs138068023
NM_000251.2(MSH2):c.1006C>A (p.Pro336Thr) rs63751062
NM_000251.2(MSH2):c.1007dup (p.Gln337fs) rs587779064
NM_000251.2(MSH2):c.1008del (p.Gln337fs) rs879253899
NM_000251.2(MSH2):c.1009C>G (p.Gln337Glu) rs63750778
NM_000251.2(MSH2):c.1010A>G (p.Gln337Arg) rs1553353190
NM_000251.2(MSH2):c.1012G>A (p.Gly338Arg) rs63751004
NM_000251.2(MSH2):c.1013G>C (p.Gly338Ala) rs587779065
NM_000251.2(MSH2):c.1013G>T (p.Gly338Val)
NM_000251.2(MSH2):c.1014A>C (p.Gly338=) rs774083607
NM_000251.2(MSH2):c.1016A>C (p.Gln339Pro) rs1060502006
NM_000251.2(MSH2):c.1021C>G (p.Leu341Val) rs748115066
NM_000251.2(MSH2):c.1022T>G (p.Leu341Arg) rs63751147
NM_000251.2(MSH2):c.1023del (p.Val342fs) rs864622340
NM_000251.2(MSH2):c.1024G>A (p.Val342Ile) rs63749879
NM_000251.2(MSH2):c.1027A>G (p.Asn343Asp) rs587779961
NM_000251.2(MSH2):c.1029C>A (p.Asn343Lys) rs1060501995
NM_000251.2(MSH2):c.1032G>A (p.Gln344=) rs375799148
NM_000251.2(MSH2):c.1032G>C (p.Gln344His) rs375799148
NM_000251.2(MSH2):c.1034G>A (p.Trp345Ter) rs63751027
NM_000251.2(MSH2):c.1034_1045del (p.Trp345_Pro349delinsSer) rs1553353226
NM_000251.2(MSH2):c.103C>G (p.Arg35Gly) rs1060502034
NM_000251.2(MSH2):c.103C>T (p.Arg35Cys) rs1060502034
NM_000251.2(MSH2):c.1042C>G (p.Gln348Glu) rs979212552
NM_000251.2(MSH2):c.1042C>T (p.Gln348Ter) rs979212552
NM_000251.2(MSH2):c.1043A>G (p.Gln348Arg) rs773177076
NM_000251.2(MSH2):c.1045C>G (p.Pro349Ala) rs267607939
NM_000251.2(MSH2):c.1046C>G (p.Pro349Arg) rs587779067
NM_000251.2(MSH2):c.1046C>T (p.Pro349Leu) rs587779067
NM_000251.2(MSH2):c.1048C>G (p.Leu350Val) rs771126636
NM_000251.2(MSH2):c.104G>A (p.Arg35His) rs1060502012
NM_000251.2(MSH2):c.1051A>G (p.Met351Val) rs138026880
NM_000251.2(MSH2):c.1052T>G (p.Met351Arg) rs1553353246
NM_000251.2(MSH2):c.1053G>C (p.Met351Ile) rs373122667
NM_000251.2(MSH2):c.1053G>T (p.Met351Ile)
NM_000251.2(MSH2):c.1067T>C (p.Ile356Thr) rs753075410
NM_000251.2(MSH2):c.1069G>C (p.Glu357Gln) rs587779069
NM_000251.2(MSH2):c.106C>G (p.Leu36Val) rs1553348786
NM_000251.2(MSH2):c.1070A>C (p.Glu357Ala) rs150503781
NM_000251.2(MSH2):c.1076+1G>A rs267607940
NM_000251.2(MSH2):c.1076+5G>A rs1400610583
NM_000251.2(MSH2):c.1076G>A (p.Arg359Lys) rs63751604
NM_000251.2(MSH2):c.1076G>C (p.Arg359Thr) rs63751604
NM_000251.2(MSH2):c.1077-10T>C rs17224360
NM_000251.2(MSH2):c.1077-2A>G rs267607943
NM_000251.2(MSH2):c.1077-3C>T rs758182607
NM_000251.2(MSH2):c.1077-66_1146del rs193922372
NM_000251.2(MSH2):c.1077-7A>G rs370807334
NM_000251.2(MSH2):c.1082A>G (p.Asn361Ser) rs587779072
NM_000251.2(MSH2):c.1083T>C (p.Asn361=) rs864622544
NM_000251.2(MSH2):c.1087G>A (p.Val363Met)
NM_000251.2(MSH2):c.1087G>T (p.Val363Leu) rs377345366
NM_000251.2(MSH2):c.108T>G (p.Leu36=) rs876659034
NM_000251.2(MSH2):c.1092A>C (p.Glu364Asp)
NM_000251.2(MSH2):c.1094C>G (p.Ala365Gly) rs1242235025
NM_000251.2(MSH2):c.1094C>T (p.Ala365Val) rs1242235025
NM_000251.2(MSH2):c.1099G>A (p.Val367Ile) rs80285180
NM_000251.2(MSH2):c.10C>A (p.Gln4Lys) rs878853797
NM_000251.2(MSH2):c.10C>T (p.Gln4Ter)
NM_000251.2(MSH2):c.1100T>C (p.Val367Ala)
NM_000251.2(MSH2):c.1103A>G (p.Glu368Gly) rs1553356552
NM_000251.2(MSH2):c.1103A>T (p.Glu368Val) rs1553356552
NM_000251.2(MSH2):c.1108G>A (p.Ala370Thr) rs1064794109
NM_000251.2(MSH2):c.1111G>C (p.Glu371Gln) rs1060501994
NM_000251.2(MSH2):c.1111G>T (p.Glu371Ter)
NM_000251.2(MSH2):c.1114T>C (p.Leu372=) rs770201760
NM_000251.2(MSH2):c.1114T>G (p.Leu372Val) rs770201760
NM_000251.2(MSH2):c.1115T>C (p.Leu372Ser)
NM_000251.2(MSH2):c.1117A>C (p.Arg373=) rs781061998
NM_000251.2(MSH2):c.1118G>A (p.Arg373Lys) rs864622254
NM_000251.2(MSH2):c.1119G>T (p.Arg373Ser) rs1553356567
NM_000251.2(MSH2):c.1120C>T (p.Gln374Ter) rs63750558
NM_000251.2(MSH2):c.1122G>C (p.Gln374His) rs370378607
NM_000251.2(MSH2):c.1124C>T (p.Thr375Ile) rs774539871
NM_000251.2(MSH2):c.112G>T (p.Asp38Tyr) rs730881761
NM_000251.2(MSH2):c.1130A>G (p.Gln377Arg) rs776174711
NM_000251.2(MSH2):c.1131A>G (p.Gln377=) rs181852377
NM_000251.2(MSH2):c.1138T>G (p.Leu380Val) rs1558478310
NM_000251.2(MSH2):c.1139T>C (p.Leu380Ser) rs730881755
NM_000251.2(MSH2):c.1139T>G (p.Leu380Ter) rs730881755
NM_000251.2(MSH2):c.1143_1145TCG[1] (p.Arg383del)
NM_000251.2(MSH2):c.1144C>T (p.Arg382Cys) rs752373431
NM_000251.2(MSH2):c.1145G>A (p.Arg382His) rs267607947
NM_000251.2(MSH2):c.1147C>T (p.Arg383Ter) rs63749849
NM_000251.2(MSH2):c.1148G>A (p.Arg383Gln) rs376934727
NM_000251.2(MSH2):c.1148G>C (p.Arg383Pro) rs376934727
NM_000251.2(MSH2):c.114C>G (p.Asp38Glu) rs587779074
NM_000251.2(MSH2):c.1151dup (p.Asp386fs)
NM_000251.2(MSH2):c.1153C>G (p.Pro385Ala) rs763985746
NM_000251.2(MSH2):c.1154C>T (p.Pro385Leu) rs564736113
NM_000251.2(MSH2):c.1158T>C (p.Asp386=) rs1060504421
NM_000251.2(MSH2):c.1159C>G (p.Leu387Val) rs751249745
NM_000251.2(MSH2):c.1159C>T (p.Leu387Phe) rs751249745
NM_000251.2(MSH2):c.115C>A (p.Arg39=) rs786202334
NM_000251.2(MSH2):c.115_123del (p.Arg39_Asp41del) rs863224831
NM_000251.2(MSH2):c.115del (p.Arg39fs) rs1553348794
NM_000251.2(MSH2):c.1165C>T (p.Arg389Ter) rs587779075
NM_000251.2(MSH2):c.1166G>A (p.Arg389Gln) rs757276241
NM_000251.2(MSH2):c.1168C>T (p.Leu390Phe) rs17224367
NM_000251.2(MSH2):c.116G>C (p.Arg39Pro) rs587782759
NM_000251.2(MSH2):c.1171G>A (p.Ala391Thr) rs878853798
NM_000251.2(MSH2):c.1171G>C (p.Ala391Pro)
NM_000251.2(MSH2):c.1172C>A (p.Ala391Asp) rs864622674
NM_000251.2(MSH2):c.1172C>T (p.Ala391Val) rs864622674
NM_000251.2(MSH2):c.1175A>T (p.Lys392Met) rs61756465
NM_000251.2(MSH2):c.1177A>C (p.Lys393Gln) rs863225386
NM_000251.2(MSH2):c.1179G>A (p.Lys393=) rs1553356646
NM_000251.2(MSH2):c.1182T>G (p.Phe394Leu) rs374135434
NM_000251.2(MSH2):c.1189C>G (p.Gln397Glu) rs63750611
NM_000251.2(MSH2):c.118G>A (p.Gly40Ser) rs63751260
NM_000251.2(MSH2):c.1191A>G (p.Gln397=) rs768694189
NM_000251.2(MSH2):c.1191A>T (p.Gln397His) rs768694189
NM_000251.2(MSH2):c.1192G>A (p.Ala398Thr) rs988252817
NM_000251.2(MSH2):c.1193C>T (p.Ala398Val) rs1060502019
NM_000251.2(MSH2):c.1194A>G (p.Ala398=) rs1060504412
NM_000251.2(MSH2):c.119G>T (p.Gly40Val) rs876658719
NM_000251.2(MSH2):c.119del (p.Gly40fs) rs63750984
NM_000251.2(MSH2):c.11A>C (p.Gln4Pro)
NM_000251.2(MSH2):c.11A>T (p.Gln4Leu) rs754562075
NM_000251.2(MSH2):c.11_12delinsC (p.Gln4fs) rs1558451119
NM_000251.2(MSH2):c.1200C>G (p.Asn400Lys) rs1301023135
NM_000251.2(MSH2):c.1201_1204del (p.Leu401fs) rs1558478567
NM_000251.2(MSH2):c.1203dup (p.Gln402fs) rs63750586
NM_000251.2(MSH2):c.1204C>A (p.Gln402Lys) rs63751412
NM_000251.2(MSH2):c.1204C>G (p.Gln402Glu) rs63751412
NM_000251.2(MSH2):c.1204del (p.Gln402fs) rs63751413
NM_000251.2(MSH2):c.1206A>C (p.Gln402His)
NM_000251.2(MSH2):c.1206A>T (p.Gln402His) rs1553356673
NM_000251.2(MSH2):c.1209T>C (p.Asp403=) rs1060504420
NM_000251.2(MSH2):c.1211G>T (p.Cys404Phe) rs1553356682
NM_000251.2(MSH2):c.1216C>T (p.Arg406Ter) rs63751108
NM_000251.2(MSH2):c.1217G>A (p.Arg406Gln) rs146567853
NM_000251.2(MSH2):c.1217G>T (p.Arg406Leu) rs146567853
NM_000251.2(MSH2):c.121G>T (p.Asp41Tyr) rs878853799
NM_000251.2(MSH2):c.1221C>G (p.Leu407=) rs63750813
NM_000251.2(MSH2):c.1222dup (p.Tyr408fs) rs63751142
NM_000251.2(MSH2):c.1223A>G (p.Tyr408Cys) rs63750379
NM_000251.2(MSH2):c.1223A>T (p.Tyr408Phe) rs63750379
NM_000251.2(MSH2):c.1225C>G (p.Gln409Glu) rs151244108
NM_000251.2(MSH2):c.1226_1227del (p.Gln409fs) rs63750086
NM_000251.2(MSH2):c.1227_1238del (p.Gly410_Gln413del)
NM_000251.2(MSH2):c.1229G>T (p.Gly410Val) rs1354753753
NM_000251.2(MSH2):c.1229del (p.Gly410fs) rs1553356700
NM_000251.2(MSH2):c.1237C>G (p.Gln413Glu) rs863225387
NM_000251.2(MSH2):c.1238A>C (p.Gln413Pro) rs587779962
NM_000251.2(MSH2):c.123C>G (p.Asp41Glu) rs761960690
NM_000251.2(MSH2):c.123C>T (p.Asp41=) rs761960690
NM_000251.2(MSH2):c.1240C>T (p.Leu414=) rs908316909
NM_000251.2(MSH2):c.1241T>G (p.Leu414Arg) rs587779078
NM_000251.2(MSH2):c.1243C>T (p.Pro415Ser) rs35717997
NM_000251.2(MSH2):c.1244C>G (p.Pro415Arg)
NM_000251.2(MSH2):c.1246A>G (p.Asn416Asp)
NM_000251.2(MSH2):c.1247A>G (p.Asn416Ser) rs1386630417
NM_000251.2(MSH2):c.1251T>C (p.Val417=) rs1553356731
NM_000251.2(MSH2):c.1252A>G (p.Ile418Val)
NM_000251.2(MSH2):c.1253T>C (p.Ile418Thr) rs786202303
NM_000251.2(MSH2):c.1254A>G (p.Ile418Met) rs751431238
NM_000251.2(MSH2):c.1255C>A (p.Gln419Lys) rs63750006
NM_000251.2(MSH2):c.1261C>G (p.Leu421Val)
NM_000251.2(MSH2):c.1264G>A (p.Glu422Lys) rs63751712
NM_000251.2(MSH2):c.1265_1269delinsGAAAAG (p.Glu422fs) rs63751667
NM_000251.2(MSH2):c.1267A>G (p.Lys423Glu) rs201059765
NM_000251.2(MSH2):c.126C>G (p.Phe42Leu) rs730881766
NM_000251.2(MSH2):c.1270C>T (p.His424Tyr) rs587782278
NM_000251.2(MSH2):c.1271A>G (p.His424Arg) rs200429136
NM_000251.2(MSH2):c.1275A>G (p.Glu425=) rs63751650
NM_000251.2(MSH2):c.1276+1G>A rs267607950
NM_000251.2(MSH2):c.1276+1G>T rs267607950
NM_000251.2(MSH2):c.1276+2T>C rs267607953
NM_000251.2(MSH2):c.1276+4A>G rs1481785592
NM_000251.2(MSH2):c.1276+7A>G rs748554540
NM_000251.2(MSH2):c.1277-7C>A rs375437307
NM_000251.2(MSH2):c.1277-8T>C rs145400590
NM_000251.2(MSH2):c.1284C>G (p.His428Gln) rs776034412
NM_000251.2(MSH2):c.1285C>T (p.Gln429Ter) rs63751693
NM_000251.2(MSH2):c.1285del (p.Gln429fs) rs1114167833
NM_000251.2(MSH2):c.128A>G (p.Tyr43Cys) rs17217723
NM_000251.2(MSH2):c.128A>T (p.Tyr43Phe) rs17217723
NM_000251.2(MSH2):c.1294T>A (p.Leu432Met)
NM_000251.2(MSH2):c.1294T>C (p.Leu432=) rs937218360
NM_000251.2(MSH2):c.12G>A (p.Gln4=) rs878853800
NM_000251.2(MSH2):c.1301C>T (p.Ala434Val) rs768070717
NM_000251.2(MSH2):c.1307T>C (p.Phe436Ser)
NM_000251.2(MSH2):c.1308dup (p.Val437fs) rs1060502035
NM_000251.2(MSH2):c.1309G>A (p.Val437Met)
NM_000251.2(MSH2):c.1311G>T (p.Val437=) rs730881781
NM_000251.2(MSH2):c.1313_1315CTC[1] (p.Pro439del) rs587779082
NM_000251.2(MSH2):c.1314T>C (p.Thr438=) rs761558457
NM_000251.2(MSH2):c.1315C>T (p.Pro439Ser) rs786203116
NM_000251.2(MSH2):c.1316_1317CT[1] (p.Leu440fs) rs587779083
NM_000251.2(MSH2):c.1318C>T (p.Leu440Phe) rs1553361201
NM_000251.2(MSH2):c.131C>A (p.Thr44Lys) rs587779085
NM_000251.2(MSH2):c.1321A>C (p.Thr441Pro) rs587779086
NM_000251.2(MSH2):c.1322C>G (p.Thr441Ser) rs1553361210
NM_000251.2(MSH2):c.1327C>A (p.Leu443Ile) rs876659906
NM_000251.2(MSH2):c.1327C>G (p.Leu443Val) rs876659906
NM_000251.2(MSH2):c.1328T>C (p.Leu443Pro) rs1553361220
NM_000251.2(MSH2):c.132G>A (p.Thr44=) rs766856128
NM_000251.2(MSH2):c.1331G>A (p.Arg444His) rs557339938
NM_000251.2(MSH2):c.1331G>T (p.Arg444Leu) rs557339938
NM_000251.2(MSH2):c.1333T>G (p.Ser445Ala) rs1553361224
NM_000251.2(MSH2):c.1334C>T (p.Ser445Phe) rs752067883
NM_000251.2(MSH2):c.1339_1340del (p.Phe447fs) rs1553361231
NM_000251.2(MSH2):c.1341C>G (p.Phe447Leu) rs587781373
NM_000251.2(MSH2):c.1341C>T (p.Phe447=) rs587781373
NM_000251.2(MSH2):c.1344C>T (p.Ser448=) rs1010360604
NM_000251.2(MSH2):c.1344del (p.Lys449fs) rs876658918
NM_000251.2(MSH2):c.1347G>C (p.Lys449Asn) rs587781331
NM_000251.2(MSH2):c.1351C>T (p.Gln451Ter) rs786201066
NM_000251.2(MSH2):c.1352A>G (p.Gln451Arg) rs878853801
NM_000251.2(MSH2):c.1353G>A (p.Gln451=) rs1060504415
NM_000251.2(MSH2):c.1354G>A (p.Glu452Lys) rs267607954
NM_000251.2(MSH2):c.1354G>T (p.Glu452Ter) rs267607954
NM_000251.2(MSH2):c.135G>A (p.Ala45=) rs890172773
NM_000251.2(MSH2):c.1360A>G (p.Ile454Val) rs587781627
NM_000251.2(MSH2):c.1361T>C (p.Ile454Thr) rs1060502025
NM_000251.2(MSH2):c.1367C>T (p.Thr456Ile) rs777963115
NM_000251.2(MSH2):c.1373del (p.Thr457_Leu458insTer) rs1553361289
NM_000251.2(MSH2):c.1378A>G (p.Met460Val) rs575905950
NM_000251.2(MSH2):c.1379T>C (p.Met460Thr) rs1553361303
NM_000251.2(MSH2):c.137A>C (p.His46Pro) rs1553348822
NM_000251.2(MSH2):c.1382A>C (p.Asp461Ala) rs730881756
NM_000251.2(MSH2):c.1382A>G (p.Asp461Gly) rs730881756
NM_000251.2(MSH2):c.1384C>T (p.Gln462Ter) rs876657701
NM_000251.2(MSH2):c.1386+1G>A rs267607957
NM_000251.2(MSH2):c.1386+5G>A rs1553361317
NM_000251.2(MSH2):c.1386G>A (p.Gln462=)
NM_000251.2(MSH2):c.1386G>C (p.Gln462His) rs587781997
NM_000251.2(MSH2):c.1387-3C>T rs1553365696
NM_000251.2(MSH2):c.1387-4G>C rs376796243
NM_000251.2(MSH2):c.1387-5T>C rs757458333
NM_000251.2(MSH2):c.1387-8G>T rs187525243
NM_000251.2(MSH2):c.138C>G (p.His46Gln) rs33946261
NM_000251.2(MSH2):c.1394A>G (p.Asn465Ser) rs1487094949
NM_000251.2(MSH2):c.1396C>T (p.His466Tyr) rs876658457
NM_000251.2(MSH2):c.1396del (p.His466fs) rs1558508067
NM_000251.2(MSH2):c.1397A>G (p.His466Arg) rs544265737
NM_000251.2(MSH2):c.139G>A (p.Gly47Ser) rs763573151
NM_000251.2(MSH2):c.13C>T (p.Pro5Ser)
NM_000251.2(MSH2):c.1401del (p.Glu467fs) rs1553365711
NM_000251.2(MSH2):c.1404C>G (p.Phe468Leu) rs1255961940
NM_000251.2(MSH2):c.1404_1410del (p.Phe468fs) rs878853802
NM_000251.2(MSH2):c.1405C>G (p.Leu469Val) rs780702096
NM_000251.2(MSH2):c.1405del (p.Leu469_Val470insTer) rs1060502027
NM_000251.2(MSH2):c.1408G>A (p.Val470Ile) rs1391167729
NM_000251.2(MSH2):c.1408del (p.Leu469_Val470insTer) rs63750384
NM_000251.2(MSH2):c.1412A>G (p.Lys471Arg)
NM_000251.2(MSH2):c.1413A>C (p.Lys471Asn) rs745874745
NM_000251.2(MSH2):c.1413del (p.Lys471fs) rs1553365719
NM_000251.2(MSH2):c.1414C>G (p.Pro472Ala) rs1558508137
NM_000251.2(MSH2):c.1415C>T (p.Pro472Leu) rs1553365723
NM_000251.2(MSH2):c.1418C>T (p.Ser473Leu) rs63751403
NM_000251.2(MSH2):c.141C>T (p.Gly47=)
NM_000251.2(MSH2):c.141_154del (p.Glu48fs) rs863224481
NM_000251.2(MSH2):c.1424A>G (p.Asp475Gly) rs1349765126
NM_000251.2(MSH2):c.1429A>C (p.Asn477His) rs587781346
NM_000251.2(MSH2):c.1429A>G (p.Asn477Asp)
NM_000251.2(MSH2):c.142G>T (p.Glu48Ter) rs63750615
NM_000251.2(MSH2):c.1432C>T (p.Leu478Phe) rs1051194508
NM_000251.2(MSH2):c.1435A>C (p.Ser479Arg) rs770550720
NM_000251.2(MSH2):c.1439A>G (p.Glu480Gly) rs1558508167
NM_000251.2(MSH2):c.1440A>G (p.Glu480=) rs138049198
NM_000251.2(MSH2):c.1441T>A (p.Leu481Ile)
NM_000251.2(MSH2):c.1442T>A (p.Leu481Ter) rs786203036
NM_000251.2(MSH2):c.1461C>G (p.Asp487Glu) rs35107951
NM_000251.2(MSH2):c.1462T>G (p.Leu488Val) rs587781314
NM_000251.2(MSH2):c.1465G>A (p.Glu489Lys) rs876658187
NM_000251.2(MSH2):c.1467A>C (p.Glu489Asp) rs1553365781
NM_000251.2(MSH2):c.1469A>G (p.Lys490Arg) rs1060502008
NM_000251.2(MSH2):c.146A>T (p.Asp49Val) rs63750335
NM_000251.2(MSH2):c.1470_1473delinsAAA (p.Met492fs) rs1060502029
NM_000251.2(MSH2):c.1475T>C (p.Met492Thr) rs1357803103
NM_000251.2(MSH2):c.1476G>A (p.Met492Ile) rs1553365792
NM_000251.2(MSH2):c.1477C>T (p.Gln493Ter) rs63750936
NM_000251.2(MSH2):c.1478A>T (p.Gln493Leu) rs376990143
NM_000251.2(MSH2):c.1478del (p.Gln493fs) rs1553365799
NM_000251.2(MSH2):c.147C>G (p.Asp49Glu) rs730881771
NM_000251.2(MSH2):c.1480T>C (p.Ser494Pro) rs55653533
NM_000251.2(MSH2):c.1481C>G (p.Ser494Ter) rs370970617
NM_000251.2(MSH2):c.1483A>G (p.Thr495Ala) rs730881757
NM_000251.2(MSH2):c.1484C>T (p.Thr495Ile) rs756516114
NM_000251.2(MSH2):c.1487T>C (p.Leu496Ser) rs587779093
NM_000251.2(MSH2):c.1488A>G (p.Leu496=) rs267607960
NM_000251.2(MSH2):c.1489A>G (p.Ile497Val) rs755501968
NM_000251.2(MSH2):c.1491_1492insTT (p.Ser498fs) rs1558508343
NM_000251.2(MSH2):c.1493G>A (p.Ser498Asn) rs1553365810
NM_000251.2(MSH2):c.1495G>C (p.Ala499Pro) rs1060502010
NM_000251.2(MSH2):c.1497A>G (p.Ala499=) rs1357985821
NM_000251.2(MSH2):c.149C>A (p.Ala50Glu) rs876658582
NM_000251.2(MSH2):c.149C>G (p.Ala50Gly) rs876658582
NM_000251.2(MSH2):c.14C>A (p.Pro5Gln) rs56170584
NM_000251.2(MSH2):c.14C>G (p.Pro5Arg) rs56170584
NM_000251.2(MSH2):c.14C>T (p.Pro5Leu) rs56170584
NM_000251.2(MSH2):c.1505A>G (p.Asp502Gly) rs148192104
NM_000251.2(MSH2):c.1505A>T (p.Asp502Val)
NM_000251.2(MSH2):c.1507C>G (p.Leu503Val) rs1553365825
NM_000251.2(MSH2):c.1510+2T>C rs1060502023
NM_000251.2(MSH2):c.1510+6_1510+7delAA rs1060502013
NM_000251.2(MSH2):c.1510+9G>A rs780895577
NM_000251.2(MSH2):c.1511-10_1511-7delGATT rs864622529
NM_000251.2(MSH2):c.1511-41G>C rs202215396
NM_000251.2(MSH2):c.1511G>T (p.Gly504Val) rs1191742655
NM_000251.2(MSH2):c.1513T>C (p.Leu505=) rs1553366502
NM_000251.2(MSH2):c.1518C>A (p.Asp506Glu) rs1553366508
NM_000251.2(MSH2):c.151C>G (p.Leu51Val)
NM_000251.2(MSH2):c.1520del (p.Pro507fs) rs1553366510
NM_000251.2(MSH2):c.1523G>C (p.Gly508Ala) rs786202710
NM_000251.2(MSH2):c.1527A>G (p.Lys509=) rs1212558633
NM_000251.2(MSH2):c.1528C>T (p.Gln510Ter) rs587779097
NM_000251.2(MSH2):c.1530G>A (p.Gln510=) rs587782355
NM_000251.2(MSH2):c.1530G>C (p.Gln510His) rs587782355
NM_000251.2(MSH2):c.1530G>T (p.Gln510His) rs587782355
NM_000251.2(MSH2):c.1532T>G (p.Ile511Ser)
NM_000251.2(MSH2):c.1539G>A (p.Leu513=) rs777195739
NM_000251.2(MSH2):c.153dup (p.Leu52fs) rs1553348842
NM_000251.2(MSH2):c.1545C>T (p.Ser515=) rs1553366537
NM_000251.2(MSH2):c.1546A>G (p.Ser516Gly) rs878853803
NM_000251.2(MSH2):c.1547G>A (p.Ser516Asn) rs373564353
NM_000251.2(MSH2):c.1547G>T (p.Ser516Ile) rs373564353
NM_000251.2(MSH2):c.154C>A (p.Leu52Met) rs786202335
NM_000251.2(MSH2):c.154C>G (p.Leu52Val) rs786202335
NM_000251.2(MSH2):c.154C>T (p.Leu52=) rs786202335
NM_000251.2(MSH2):c.1550C>T (p.Ala517Val) rs1060501997
NM_000251.2(MSH2):c.1550_1551CA[1] (p.Gln518fs) rs63749930
NM_000251.2(MSH2):c.1552C>T (p.Gln518Ter) rs63750780
NM_000251.2(MSH2):c.1560A>G (p.Gly520=) rs63750820
NM_000251.2(MSH2):c.1562A>G (p.Tyr521Cys)
NM_000251.2(MSH2):c.1563T>A (p.Tyr521Ter) rs63750330
NM_000251.2(MSH2):c.1563T>C (p.Tyr521=) rs63750330
NM_000251.2(MSH2):c.1564T>C (p.Tyr522His) rs1553366567
NM_000251.2(MSH2):c.1565_1568del (p.Tyr522fs) rs1064793561
NM_000251.2(MSH2):c.156G>A (p.Leu52=) rs750241099
NM_000251.2(MSH2):c.1570C>T (p.Arg524Cys) rs755818010
NM_000251.2(MSH2):c.1571G>A (p.Arg524His) rs63751207
NM_000251.2(MSH2):c.1571G>C (p.Arg524Pro) rs63751207
NM_000251.2(MSH2):c.1571G>T (p.Arg524Leu) rs63751207
NM_000251.2(MSH2):c.1577C>T (p.Thr526Ile) rs1204369578
NM_000251.2(MSH2):c.1578C>G (p.Thr526=) rs1057520435
NM_000251.2(MSH2):c.157G>T (p.Ala53Ser) rs755931648
NM_000251.2(MSH2):c.1580G>C (p.Cys527Ser) rs1553366585
NM_000251.2(MSH2):c.1582A>C (p.Lys528Gln) rs199744440
NM_000251.2(MSH2):c.1584G>A (p.Lys528=) rs1453387283
NM_000251.2(MSH2):c.158C>G (p.Ala53Gly) rs1456393710
NM_000251.2(MSH2):c.1593A>C (p.Lys531Asn) rs1553366599
NM_000251.2(MSH2):c.1595T>C (p.Val532Ala) rs754778750
NM_000251.2(MSH2):c.1597C>G (p.Leu533Val) rs786202987
NM_000251.2(MSH2):c.1597C>T (p.Leu533Phe)
NM_000251.2(MSH2):c.159C>T (p.Ala53=) rs780178752
NM_000251.2(MSH2):c.1600C>T (p.Arg534Cys) rs63750029
NM_000251.2(MSH2):c.1601G>A (p.Arg534His) rs587778523
NM_000251.2(MSH2):c.1605C>G (p.Asn535Lys) rs587779098
NM_000251.2(MSH2):c.1605C>T (p.Asn535=) rs587779098
NM_000251.2(MSH2):c.1607A>G (p.Asn536Ser)
NM_000251.2(MSH2):c.1607A>T (p.Asn536Ile) rs201722703
NM_000251.2(MSH2):c.160G>A (p.Ala54Thr) rs749212640
NM_000251.2(MSH2):c.160G>T (p.Ala54Ser) rs749212640
NM_000251.2(MSH2):c.1619G>C (p.Ser540Thr) rs1553366622
NM_000251.2(MSH2):c.1622C>T (p.Thr541Ile) rs864622079
NM_000251.2(MSH2):c.1626A>G (p.Val542=) rs1553366635
NM_000251.2(MSH2):c.162C>T (p.Ala54=) rs1045377929
NM_000251.2(MSH2):c.1631T>C (p.Ile544Thr) rs587778524
NM_000251.2(MSH2):c.1637A>G (p.Lys546Arg)
NM_000251.2(MSH2):c.1638G>A (p.Lys546=) rs372350768
NM_000251.2(MSH2):c.1638G>C (p.Lys546Asn) rs372350768
NM_000251.2(MSH2):c.163C>G (p.Arg55Gly) rs587782354
NM_000251.2(MSH2):c.1640A>G (p.Asn547Ser) rs267607967
NM_000251.2(MSH2):c.1642G>T (p.Gly548Cys) rs63750538
NM_000251.2(MSH2):c.1643G>A (p.Gly548Asp)
NM_000251.2(MSH2):c.1645G>A (p.Val549Ile) rs876659905
NM_000251.2(MSH2):c.1645G>T (p.Val549Phe) rs876659905
NM_000251.2(MSH2):c.1647T>C (p.Val549=) rs763525239
NM_000251.2(MSH2):c.1648A>G (p.Lys550Glu) rs1558511191
NM_000251.2(MSH2):c.164G>A (p.Arg55Gln) rs748196422
NM_000251.2(MSH2):c.1653T>A (p.Phe551Leu) rs876660635
NM_000251.2(MSH2):c.1654A>G (p.Thr552Ala) rs63750838
NM_000251.2(MSH2):c.1657A>G (p.Asn553Asp) rs772772789
NM_000251.2(MSH2):c.1657A>T (p.Asn553Tyr) rs772772789
NM_000251.2(MSH2):c.1659C>G (p.Asn553Lys)
NM_000251.2(MSH2):c.1661+1G>A rs267607969
NM_000251.2(MSH2):c.1661+2T>C rs1553366680
NM_000251.2(MSH2):c.1661+5G>C rs267607972
NM_000251.2(MSH2):c.1661+5G>T rs267607972
NM_000251.2(MSH2):c.1661+6dupC rs863224832
NM_000251.2(MSH2):c.1661+7A>C rs753508952
NM_000251.2(MSH2):c.1661+9G>T rs1060504414
NM_000251.2(MSH2):c.1661G>A (p.Ser554Asn) rs63750597
NM_000251.2(MSH2):c.1662-10C>T rs752606387
NM_000251.2(MSH2):c.1662-12_1677delTTCGATTTGCAGCAAATTGACTTCTTTA rs864622436
NM_000251.2(MSH2):c.1662-2A>G rs267607971
NM_000251.2(MSH2):c.1662-3C>T rs878853804
NM_000251.2(MSH2):c.1662-9G>A rs17218356
NM_000251.2(MSH2):c.1662C>G (p.Ser554Arg)
NM_000251.2(MSH2):c.1662C>T (p.Ser554=) rs587778525
NM_000251.2(MSH2):c.1666T>C (p.Leu556=) rs61756466
NM_000251.2(MSH2):c.1667dup (p.Leu556fs) rs267607694
NM_000251.2(MSH2):c.1668G>C (p.Leu556Phe)
NM_000251.2(MSH2):c.1669A>G (p.Thr557Ala)
NM_000251.2(MSH2):c.166G>A (p.Glu56Lys) rs587779102
NM_000251.2(MSH2):c.166G>C (p.Glu56Gln) rs587779102
NM_000251.2(MSH2):c.1670C>G (p.Thr557Ser) rs139920308
NM_000251.2(MSH2):c.1670_1672CTT[1] (p.Ser558del) rs1558514487
NM_000251.2(MSH2):c.1679A>T (p.Asn560Ile) rs1429353441
NM_000251.2(MSH2):c.167A>T (p.Glu56Val) rs587782004
NM_000251.2(MSH2):c.167_184del (p.Glu56_Gln61del) rs1553348867
NM_000251.2(MSH2):c.1680T>C (p.Asn560=) rs200056411
NM_000251.2(MSH2):c.1681G>A (p.Glu561Lys) rs63750328
NM_000251.2(MSH2):c.1685A>T (p.Glu562Val) rs63750997
NM_000251.2(MSH2):c.1686G>C (p.Glu562Asp) rs786203850
NM_000251.2(MSH2):c.1687dup (p.Tyr563fs) rs587779103
NM_000251.2(MSH2):c.1689T>C (p.Tyr563=) rs1553367626
NM_000251.2(MSH2):c.1690A>G (p.Thr564Ala) rs55778204
NM_000251.2(MSH2):c.1691C>G (p.Thr564Ser) rs1553367632
NM_000251.2(MSH2):c.1692C>G (p.Thr564=) rs786203290
NM_000251.2(MSH2):c.1699A>G (p.Lys567Glu) rs63751149
NM_000251.2(MSH2):c.16A>G (p.Lys6Glu) rs777351049
NM_000251.2(MSH2):c.1700_1704del (p.Lys567fs) rs63750474
NM_000251.2(MSH2):c.1705_1706del (p.Glu569fs) rs63750393
NM_000251.2(MSH2):c.1706A>G (p.Glu569Gly) rs786201077
NM_000251.2(MSH2):c.1709A>G (p.Tyr570Cys) rs587779963
NM_000251.2(MSH2):c.170T>G (p.Val57Gly) rs1558451971
NM_000251.2(MSH2):c.1714_1715delinsAT (p.Glu572Ile) rs1558514635
NM_000251.2(MSH2):c.1717G>A (p.Ala573Thr) rs200766962
NM_000251.2(MSH2):c.1719C>T (p.Ala573=) rs1553367674
NM_000251.2(MSH2):c.1724A>G (p.Asp575Gly) rs370330868
NM_000251.2(MSH2):c.1726G>C (p.Ala576Pro) rs587779107
NM_000251.2(MSH2):c.1729A>G (p.Ile577Val) rs774985655
NM_000251.2(MSH2):c.172T>C (p.Phe58Leu) rs1219748334
NM_000251.2(MSH2):c.1730T>C (p.Ile577Thr) rs63749910
NM_000251.2(MSH2):c.1737A>G (p.Lys579=) rs61756467
NM_000251.2(MSH2):c.1738G>T (p.Glu580Ter) rs63751411
NM_000251.2(MSH2):c.1746C>A (p.Val582=) rs786201486
NM_000251.2(MSH2):c.1746C>T (p.Val582=) rs786201486
NM_000251.2(MSH2):c.1748A>G (p.Asn583Ser) rs201118107
NM_000251.2(MSH2):c.1748A>T (p.Asn583Ile) rs201118107
NM_000251.2(MSH2):c.174C>A (p.Phe58Leu) rs372189599
NM_000251.2(MSH2):c.174C>G (p.Phe58Leu) rs372189599
NM_000251.2(MSH2):c.174C>T (p.Phe58=) rs372189599
NM_000251.2(MSH2):c.1750A>G (p.Ile584Val) rs1236208777
NM_000251.2(MSH2):c.1751T>C (p.Ile584Thr)
NM_000251.2(MSH2):c.1754C>T (p.Ser585Phe) rs1280971849
NM_000251.2(MSH2):c.1759+10A>G rs1553367706
NM_000251.2(MSH2):c.1759+11_1759+15delTAGAA rs878853805
NM_000251.2(MSH2):c.1759+1G>A rs587779108
NM_000251.2(MSH2):c.1759+1G>C rs587779108
NM_000251.2(MSH2):c.1759+2T>C rs267607976
NM_000251.2(MSH2):c.1759+3A>T rs863224630
NM_000251.2(MSH2):c.1759+7T>G rs1350919914
NM_000251.2(MSH2):c.1759+9A>C rs994093288
NM_000251.2(MSH2):c.1759G>A (p.Gly587Ser) rs63751140
NM_000251.2(MSH2):c.1759G>C (p.Gly587Arg) rs63751140
NM_000251.2(MSH2):c.1760-1G>A rs587779110
NM_000251.2(MSH2):c.1760-2_1783del rs1064795329
NM_000251.2(MSH2):c.1760-3C>T rs786202843
NM_000251.2(MSH2):c.1760-4A>G rs1060504409
NM_000251.2(MSH2):c.1760-7T>C rs972129356
NM_000251.2(MSH2):c.1760G>T (p.Gly587Val) rs1436608214
NM_000251.2(MSH2):c.1761C>G (p.Gly587=) rs920449426
NM_000251.2(MSH2):c.1763A>G (p.Tyr588Cys)
NM_000251.2(MSH2):c.1764T>C (p.Tyr588=) rs63750844
NM_000251.2(MSH2):c.1765G>A (p.Val589Ile) rs1064793981
NM_000251.2(MSH2):c.1770A>C (p.Glu590Asp) rs760619442
NM_000251.2(MSH2):c.1770del (p.Glu590fs)
NM_000251.2(MSH2):c.1771C>A (p.Pro591Thr) rs951988481
NM_000251.2(MSH2):c.1771_1772insA (p.Pro591fs) rs267607977
NM_000251.2(MSH2):c.1772C>T (p.Pro591Leu) rs587782643
NM_000251.2(MSH2):c.1773A>G (p.Pro591=) rs786203894
NM_000251.2(MSH2):c.1774A>G (p.Met592Val) rs371614039
NM_000251.2(MSH2):c.1777C>G (p.Gln593Glu) rs63750200
NM_000251.2(MSH2):c.1777C>T (p.Gln593Ter) rs63750200
NM_000251.2(MSH2):c.1778A>G (p.Gln593Arg)
NM_000251.2(MSH2):c.1778A>T (p.Gln593Leu) rs1558517711
NM_000251.2(MSH2):c.1781C>A (p.Thr594Lys)
NM_000251.2(MSH2):c.1781C>T (p.Thr594Ile) rs1553368510
NM_000251.2(MSH2):c.1783C>T (p.Leu595Phe) rs1553368514
NM_000251.2(MSH2):c.1784T>G (p.Leu595Arg) rs786201590
NM_000251.2(MSH2):c.1786_1788del (p.Asn596del) rs63749831
NM_000251.2(MSH2):c.1787A>G (p.Asn596Ser) rs41295288
NM_000251.2(MSH2):c.1789G>A (p.Asp597Asn) rs765442101
NM_000251.2(MSH2):c.1790A>C (p.Asp597Ala) rs548407418
NM_000251.2(MSH2):c.1790A>T (p.Asp597Val) rs548407418
NM_000251.2(MSH2):c.1792G>A (p.Val598Met) rs778152746
NM_000251.2(MSH2):c.1796T>C (p.Leu599Ser) rs747504492
NM_000251.2(MSH2):c.1796del (p.Val598_Leu599insTer) rs1060502039
NM_000251.2(MSH2):c.1798G>A (p.Ala600Thr)
NM_000251.2(MSH2):c.1798G>C (p.Ala600Pro)
NM_000251.2(MSH2):c.1798G>T (p.Ala600Ser) rs587778526
NM_000251.2(MSH2):c.1799C>T (p.Ala600Val) rs63751236
NM_000251.2(MSH2):c.1801C>T (p.Gln601Ter) rs63750047
NM_000251.2(MSH2):c.1801_1805del (p.Gln601fs)
NM_000251.2(MSH2):c.1802A>G (p.Gln601Arg) rs779447213
NM_000251.2(MSH2):c.1803G>C (p.Gln601His) rs1553368556
NM_000251.2(MSH2):c.1804C>G (p.Leu602Val) rs748797209
NM_000251.2(MSH2):c.1805T>C (p.Leu602Pro) rs1553368561
NM_000251.2(MSH2):c.1808A>C (p.Asp603Ala)
NM_000251.2(MSH2):c.1810G>A (p.Ala604Thr) rs1553368568
NM_000251.2(MSH2):c.1813G>A (p.Val605Ile) rs730881777
NM_000251.2(MSH2):c.1813G>C (p.Val605Leu) rs730881777
NM_000251.2(MSH2):c.1813G>T (p.Val605Phe) rs730881777
NM_000251.2(MSH2):c.1817T>A (p.Val606Asp) rs376044376
NM_000251.2(MSH2):c.1817T>C (p.Val606Ala) rs376044376
NM_000251.2(MSH2):c.1818_1877del (p.Ser607_Glu626del) rs1553368576
NM_000251.2(MSH2):c.181C>G (p.Gln61Glu) rs63750951
NM_000251.2(MSH2):c.181C>T (p.Gln61Ter) rs63750951
NM_000251.2(MSH2):c.1825G>T (p.Ala609Ser) rs150980616
NM_000251.2(MSH2):c.1827del (p.His610fs) rs587779112
NM_000251.2(MSH2):c.1828C>A (p.His610Asn) rs267607980
NM_000251.2(MSH2):c.1828C>T (p.His610Tyr) rs267607980
NM_000251.2(MSH2):c.182del (p.Gln61fs) rs1553348882
NM_000251.2(MSH2):c.1830C>T (p.His610=) rs766326295
NM_000251.2(MSH2):c.1831G>A (p.Val611Met) rs369385048
NM_000251.2(MSH2):c.1835C>G (p.Ser612Ter) rs63750493
NM_000251.2(MSH2):c.1837A>C (p.Asn613His) rs200147804
NM_000251.2(MSH2):c.183G>T (p.Gln61His) rs751082926
NM_000251.2(MSH2):c.1842A>C (p.Gly614=) rs923770168
NM_000251.2(MSH2):c.1846C>T (p.Pro616Ser) rs587782627
NM_000251.2(MSH2):c.1847C>G (p.Pro616Arg) rs587779965
NM_000251.2(MSH2):c.1849G>C (p.Val617Leu) rs1224364754
NM_000251.2(MSH2):c.1852C>T (p.Pro618Ser)
NM_000251.2(MSH2):c.1853C>T (p.Pro618Leu) rs1486519909
NM_000251.2(MSH2):c.1854A>G (p.Pro618=) rs786203744
NM_000251.2(MSH2):c.1857T>G (p.Tyr619Ter) rs63750312
NM_000251.2(MSH2):c.185G>C (p.Gly62Ala) rs879254195
NM_000251.2(MSH2):c.1861C>G (p.Arg621Gly) rs63750508
NM_000251.2(MSH2):c.1861C>T (p.Arg621Ter) rs63750508
NM_000251.2(MSH2):c.1862G>A (p.Arg621Gln) rs759263820
NM_000251.2(MSH2):c.1862G>C (p.Arg621Pro) rs759263820
NM_000251.2(MSH2):c.1862G>T (p.Arg621Leu) rs759263820
NM_000251.2(MSH2):c.1863A>T (p.Arg621=) rs786203119
NM_000251.2(MSH2):c.1865C>G (p.Pro622Arg) rs28929483
NM_000251.2(MSH2):c.1865C>T (p.Pro622Leu) rs28929483
NM_000251.2(MSH2):c.1868C>T (p.Ala623Val) rs781698416
NM_000251.2(MSH2):c.1869C>T (p.Ala623=) rs1553368623
NM_000251.2(MSH2):c.186G>A (p.Gly62=) rs750058876
NM_000251.2(MSH2):c.186G>C (p.Gly62=) rs750058876
NM_000251.2(MSH2):c.186G>T (p.Gly62=) rs750058876
NM_000251.2(MSH2):c.1870A>G (p.Ile624Val) rs1553368626
NM_000251.2(MSH2):c.1879A>G (p.Lys627Glu) rs1558518146
NM_000251.2(MSH2):c.1882G>C (p.Gly628Arg) rs371776176
NM_000251.2(MSH2):c.1884A>G (p.Gly628=) rs786202663
NM_000251.2(MSH2):c.1884A>T (p.Gly628=) rs786202663
NM_000251.2(MSH2):c.1886A>G (p.Gln629Arg) rs61756468
NM_000251.2(MSH2):c.1892G>A (p.Arg631Lys) rs1361816581
NM_000251.2(MSH2):c.1894A>G (p.Ile632Val) rs1301770111
NM_000251.2(MSH2):c.1897A>G (p.Ile633Val) rs771695599
NM_000251.2(MSH2):c.1898T>C (p.Ile633Thr) rs864622093
NM_000251.2(MSH2):c.18G>A (p.Lys6=) rs146017810
NM_000251.2(MSH2):c.18G>C (p.Lys6Asn)
NM_000251.2(MSH2):c.1906G>C (p.Ala636Pro) rs63750875
NM_000251.2(MSH2):c.1907C>T (p.Ala636Val) rs63750279
NM_000251.2(MSH2):c.1910C>G (p.Ser637Cys) rs1064795992
NM_000251.2(MSH2):c.1911del (p.Arg638fs) rs63750893
NM_000251.2(MSH2):c.1914G>A (p.Arg638=) rs1177447151
NM_000251.2(MSH2):c.1916A>G (p.His639Arg) rs587779116
NM_000251.2(MSH2):c.1918G>A (p.Ala640Thr)
NM_000251.2(MSH2):c.1918G>T (p.Ala640Ser)
NM_000251.2(MSH2):c.191del (p.Ile64fs)
NM_000251.2(MSH2):c.1922G>A (p.Cys641Tyr) rs786204110
NM_000251.2(MSH2):c.1922G>T (p.Cys641Phe)
NM_000251.2(MSH2):c.1924G>T (p.Val642Phe) rs776528054
NM_000251.2(MSH2):c.1927G>A (p.Glu643Lys) rs374840361
NM_000251.2(MSH2):c.192C>G (p.Ile64Met) rs1395172053
NM_000251.2(MSH2):c.192dup (p.Lys65fs) rs1553348896
NM_000251.2(MSH2):c.1933C>G (p.Gln645Glu) rs267607982
NM_000251.2(MSH2):c.1934A>C (p.Gln645Pro)
NM_000251.2(MSH2):c.1935A>C (p.Gln645His) rs587780684
NM_000251.2(MSH2):c.1935A>G (p.Gln645=) rs587780684
NM_000251.2(MSH2):c.1935del (p.Asp646fs)
NM_000251.2(MSH2):c.1936G>T (p.Asp646Tyr)
NM_000251.2(MSH2):c.1937A>C (p.Asp646Ala) rs41295290
NM_000251.2(MSH2):c.1937A>G (p.Asp646Gly) rs41295290
NM_000251.2(MSH2):c.1938T>C (p.Asp646=) rs775484022
NM_000251.2(MSH2):c.1939G>C (p.Glu647Gln) rs63750078
NM_000251.2(MSH2):c.1939G>T (p.Glu647Ter)
NM_000251.2(MSH2):c.193A>G (p.Lys65Glu)
NM_000251.2(MSH2):c.193_194insTC (p.Lys65fs) rs1553348898
NM_000251.2(MSH2):c.1943T>A (p.Ile648Asn) rs763100088
NM_000251.2(MSH2):c.1951A>G (p.Ile651Val) rs878853806
NM_000251.2(MSH2):c.1954C>A (p.Pro652Thr) rs876660900
NM_000251.2(MSH2):c.1954C>G (p.Pro652Ala) rs876660900
NM_000251.2(MSH2):c.1959del (p.Asn653fs)
NM_000251.2(MSH2):c.1962C>T (p.Asp654=) rs751939698
NM_000251.2(MSH2):c.1963G>A (p.Val655Ile) rs549467183
NM_000251.2(MSH2):c.1963_1964del (p.Val655fs) rs864622121
NM_000251.2(MSH2):c.1965A>C (p.Val655=) rs767941059
NM_000251.2(MSH2):c.1967A>C (p.Tyr656Ser) rs185356145
NM_000251.2(MSH2):c.1967A>G (p.Tyr656Cys) rs185356145
NM_000251.2(MSH2):c.1968C>A (p.Tyr656Ter) rs63751317
NM_000251.2(MSH2):c.1968del (p.Phe657fs) rs1114167805
NM_000251.2(MSH2):c.1980T>A (p.Asp660Glu) rs1060501988
NM_000251.2(MSH2):c.1981A>G (p.Lys661Glu) rs1553368707
NM_000251.2(MSH2):c.1982A>G (p.Lys661Arg) rs1558518553
NM_000251.2(MSH2):c.1985dup (p.Met663fs)
NM_000251.2(MSH2):c.1986G>A (p.Gln662=) rs587780685
NM_000251.2(MSH2):c.1986G>C (p.Gln662His) rs587780685
NM_000251.2(MSH2):c.1989G>A (p.Met663Ile) rs863224640
NM_000251.2(MSH2):c.198C>A (p.Tyr66Ter)
NM_000251.2(MSH2):c.198C>T (p.Tyr66=) rs730881784
NM_000251.2(MSH2):c.199A>G (p.Met67Val) rs768824654
NM_000251.2(MSH2):c.1A>C (p.Met1Leu) rs267607911
NM_000251.2(MSH2):c.1A>G (p.Met1Val) rs267607911
NM_000251.2(MSH2):c.1A>T (p.Met1Leu) rs267607911
NM_000251.2(MSH2):c.2003del (p.Thr668fs)
NM_000251.2(MSH2):c.2005+3A>T rs1060502014
NM_000251.2(MSH2):c.2005+6A>C rs1060502018
NM_000251.2(MSH2):c.2005+8dup rs267607992
NM_000251.2(MSH2):c.2006-4G>A rs369853630
NM_000251.2(MSH2):c.2006-8T>A rs1553368970
NM_000251.2(MSH2):c.2006-9G>A rs985337130
NM_000251.2(MSH2):c.2006G>T (p.Gly669Val) rs63751640
NM_000251.2(MSH2):c.2008C>T (p.Pro670Ser) rs1558519495
NM_000251.2(MSH2):c.2009C>G (p.Pro670Arg) rs41294982
NM_000251.2(MSH2):c.2009C>T (p.Pro670Leu) rs41294982
NM_000251.2(MSH2):c.200T>A (p.Met67Lys) rs876660001
NM_000251.2(MSH2):c.2010C>T (p.Pro670=) rs766618212
NM_000251.2(MSH2):c.2010del (p.Asn671fs) rs63751123
NM_000251.2(MSH2):c.2010dup (p.Asn671fs)
NM_000251.2(MSH2):c.2015T>G (p.Met672Arg) rs786203126
NM_000251.2(MSH2):c.201G>C (p.Met67Ile) rs1442557180
NM_000251.2(MSH2):c.2023A>G (p.Lys675Glu) rs1060501990
NM_000251.2(MSH2):c.2028A>C (p.Ser676=) rs1057522032
NM_000251.2(MSH2):c.2030C>G (p.Thr677Arg) rs876660711
NM_000251.2(MSH2):c.2031A>G (p.Thr677=) rs786203923
NM_000251.2(MSH2):c.2032T>C (p.Tyr678His) rs876659093
NM_000251.2(MSH2):c.2034T>A (p.Tyr678Ter) rs1558519611
NM_000251.2(MSH2):c.2038C>G (p.Arg680Gly) rs63749932
NM_000251.2(MSH2):c.2038C>T (p.Arg680Ter) rs63749932
NM_000251.2(MSH2):c.2039G>A (p.Arg680Gln) rs1203462814
NM_000251.2(MSH2):c.2041C>G (p.Gln681Glu) rs730881762
NM_000251.2(MSH2):c.2041C>T (p.Gln681Ter) rs730881762
NM_000251.2(MSH2):c.2043A>C (p.Gln681His)
NM_000251.2(MSH2):c.2043A>G (p.Gln681=) rs730881763
NM_000251.2(MSH2):c.2043A>T (p.Gln681His) rs730881763
NM_000251.2(MSH2):c.2047G>A (p.Gly683Arg) rs267607995
NM_000251.2(MSH2):c.2048G>A (p.Gly683Glu) rs755920849
NM_000251.2(MSH2):c.2048G>T (p.Gly683Val) rs755920849
NM_000251.2(MSH2):c.2050G>T (p.Val684Leu) rs1060502041
NM_000251.2(MSH2):c.2053A>G (p.Ile685Val) rs1060499876
NM_000251.2(MSH2):c.2055A>G (p.Ile685Met) rs989001878
NM_000251.2(MSH2):c.2060T>C (p.Leu687Pro) rs587779133
NM_000251.2(MSH2):c.2060del (p.Leu687fs)
NM_000251.2(MSH2):c.2061C>G (p.Leu687=) rs63750032
NM_000251.2(MSH2):c.2062A>C (p.Met688Leu)
NM_000251.2(MSH2):c.2063T>C (p.Met688Thr)
NM_000251.2(MSH2):c.2063T>G (p.Met688Arg) rs63749993
NM_000251.2(MSH2):c.2064G>A (p.Met688Ile) rs63750790
NM_000251.2(MSH2):c.2065G>T (p.Ala689Ser)
NM_000251.2(MSH2):c.2066C>T (p.Ala689Val) rs1060502020
NM_000251.2(MSH2):c.2067C>G (p.Ala689=) rs1039052221
NM_000251.2(MSH2):c.2067C>T (p.Ala689=) rs1039052221
NM_000251.2(MSH2):c.206del (p.Pro69fs) rs1553348904
NM_000251.2(MSH2):c.2072T>C (p.Ile691Thr) rs754824872
NM_000251.2(MSH2):c.2073T>G (p.Ile691Met) rs779101144
NM_000251.2(MSH2):c.2074G>C (p.Gly692Arg) rs63750232
NM_000251.2(MSH2):c.2075G>A (p.Gly692Glu) rs63751432
NM_000251.2(MSH2):c.2076G>A (p.Gly692=) rs1060504422
NM_000251.2(MSH2):c.2077T>C (p.Cys693Arg) rs1558519728
NM_000251.2(MSH2):c.207_211+42del rs1553348901
NM_000251.2(MSH2):c.2082T>C (p.Phe694=) rs748210094
NM_000251.2(MSH2):c.2082del (p.Phe694fs) rs63750689
NM_000251.2(MSH2):c.2085dup (p.Pro696fs) rs1553369100
NM_000251.2(MSH2):c.2086C>T (p.Pro696Ser) rs546201898
NM_000251.2(MSH2):c.2087C>T (p.Pro696Leu) rs267607994
NM_000251.2(MSH2):c.2088A>G (p.Pro696=) rs878853807
NM_000251.2(MSH2):c.2089T>C (p.Cys697Arg) rs63750961
NM_000251.2(MSH2):c.208G>A (p.Ala70Thr) rs587778522
NM_000251.2(MSH2):c.2090G>A (p.Cys697Tyr) rs63750398
NM_000251.2(MSH2):c.2094G>A (p.Glu698=) rs773555449
NM_000251.2(MSH2):c.2096C>G (p.Ser699Ter) rs587779136
NM_000251.2(MSH2):c.2096C>T (p.Ser699Leu) rs587779136
NM_000251.2(MSH2):c.2098_2100delinsAAG (p.Ala700Lys) rs1558519789
NM_000251.2(MSH2):c.209C>T (p.Ala70Val) rs587782481
NM_000251.2(MSH2):c.20A>C (p.Glu7Ala) rs530071578
NM_000251.2(MSH2):c.20A>G (p.Glu7Gly) rs530071578
NM_000251.2(MSH2):c.2100A>G (p.Ala700=) rs771426077
NM_000251.2(MSH2):c.2102A>C (p.Glu701Ala) rs876659187
NM_000251.2(MSH2):c.2105T>G (p.Val702Gly) rs587779137
NM_000251.2(MSH2):c.2106G>A (p.Val702=) rs786201108
NM_000251.2(MSH2):c.2108C>T (p.Ser703Phe)
NM_000251.2(MSH2):c.210A>C (p.Ala70=) rs1230662279
NM_000251.2(MSH2):c.211+1G>T rs1114167883
NM_000251.2(MSH2):c.211+2T>C rs1060501993
NM_000251.2(MSH2):c.211+4A>G rs1553348917
NM_000251.2(MSH2):c.211+5G>T rs1060501999
NM_000251.2(MSH2):c.211+6G>C rs1558452178
NM_000251.2(MSH2):c.211+8C>T rs267607916
NM_000251.2(MSH2):c.211+8_211+9delCCinsTG rs1553348920
NM_000251.2(MSH2):c.211+9C>A rs2303426
NM_000251.2(MSH2):c.211+9C>G rs2303426
NM_000251.2(MSH2):c.2110A>G (p.Ile704Val) rs730881764
NM_000251.2(MSH2):c.2111T>C (p.Ile704Thr) rs564657106
NM_000251.2(MSH2):c.2113G>A (p.Val705Met) rs1553369128
NM_000251.2(MSH2):c.2113G>C (p.Val705Leu) rs1553369128
NM_000251.2(MSH2):c.2113del (p.Val705fs) rs63749811
NM_000251.2(MSH2):c.2116del (p.Asp706fs) rs1553369131
NM_000251.2(MSH2):c.211G>C (p.Gly71Arg) rs587782659
NM_000251.2(MSH2):c.212-1G>A rs267607914
NM_000251.2(MSH2):c.212-2delA rs1060502007
NM_000251.2(MSH2):c.212-3A>T rs879255341
NM_000251.2(MSH2):c.2120G>A (p.Cys707Tyr) rs373226409
NM_000251.2(MSH2):c.2120G>C (p.Cys707Ser) rs373226409
NM_000251.2(MSH2):c.2122A>C (p.Ile708Leu) rs750084297
NM_000251.2(MSH2):c.2122A>G (p.Ile708Val) rs750084297
NM_000251.2(MSH2):c.2123T>C (p.Ile708Thr) rs63750108
NM_000251.2(MSH2):c.2125T>G (p.Leu709Val) rs1060502030
NM_000251.2(MSH2):c.2128G>C (p.Ala710Pro) rs1558519878
NM_000251.2(MSH2):c.2129C>G (p.Ala710Gly) rs373717132
NM_000251.2(MSH2):c.2131C>G (p.Arg711Gly)
NM_000251.2(MSH2):c.2131C>T (p.Arg711Ter) rs63750636
NM_000251.2(MSH2):c.2132G>A (p.Arg711Gln) rs138465383
NM_000251.2(MSH2):c.2132G>T (p.Arg711Leu) rs138465383
NM_000251.2(MSH2):c.2133A>G (p.Arg711=)
NM_000251.2(MSH2):c.2135dup (p.Gly713fs) rs63751453
NM_000251.2(MSH2):c.2136A>G (p.Val712=) rs1553369157
NM_000251.2(MSH2):c.2139G>T (p.Gly713=) rs63750003
NM_000251.2(MSH2):c.213A>G (p.Gly71=) rs878853808
NM_000251.2(MSH2):c.2141C>T (p.Ala714Val) rs63751224
NM_000251.2(MSH2):c.2144G>C (p.Gly715Ala) rs1558519942
NM_000251.2(MSH2):c.214G>T (p.Ala72Ser)
NM_000251.2(MSH2):c.2150G>A (p.Ser717Asn) rs752883472
NM_000251.2(MSH2):c.2150_2153del (p.Ser717fs) rs878853809
NM_000251.2(MSH2):c.2152C>T (p.Gln718Ter) rs587779139
NM_000251.2(MSH2):c.2154A>G (p.Gln718=) rs63750810
NM_000251.2(MSH2):c.2156T>G (p.Leu719Trp)
NM_000251.2(MSH2):c.2158A>G (p.Lys720Glu) rs747265823
NM_000251.2(MSH2):c.215C>G (p.Ala72Gly) rs1558457009
NM_000251.2(MSH2):c.2161G>T (p.Gly721Ter) rs1060502032
NM_000251.2(MSH2):c.2164G>A (p.Val722Ile) rs587781996
NM_000251.2(MSH2):c.2164G>T (p.Val722Phe) rs587781996
NM_000251.2(MSH2):c.2166C>A (p.Val722=) rs1057520969
NM_000251.2(MSH2):c.2166C>G (p.Val722=) rs1057520969
NM_000251.2(MSH2):c.2166C>T (p.Val722=) rs1057520969
NM_000251.2(MSH2):c.2168C>T (p.Ser723Phe) rs63750794
NM_000251.2(MSH2):c.2170A>G (p.Thr724Ala) rs879254203
NM_000251.2(MSH2):c.2171C>T (p.Thr724Met) rs63751125
NM_000251.2(MSH2):c.2172G>A (p.Thr724=) rs370636719
NM_000251.2(MSH2):c.2172G>T (p.Thr724=) rs370636719
NM_000251.2(MSH2):c.2176A>G (p.Met726Val) rs1114167847
NM_000251.2(MSH2):c.2176A>T (p.Met726Leu)
NM_000251.2(MSH2):c.2178G>A (p.Met726Ile) rs587782396
NM_000251.2(MSH2):c.2178G>C (p.Met726Ile) rs587782396
NM_000251.2(MSH2):c.2178G>T (p.Met726Ile) rs587782396
NM_000251.2(MSH2):c.2179G>C (p.Ala727Pro) rs104895026
NM_000251.2(MSH2):c.2179G>T (p.Ala727Ser) rs104895026
NM_000251.2(MSH2):c.2179del (p.Ala727fs)
NM_000251.2(MSH2):c.217A>G (p.Lys73Glu) rs770110491
NM_000251.2(MSH2):c.217A>T (p.Lys73Ter) rs770110491
NM_000251.2(MSH2):c.2181T>C (p.Ala727=) rs763387694
NM_000251.2(MSH2):c.2185A>G (p.Met729Val) rs1558520059
NM_000251.2(MSH2):c.218A>G (p.Lys73Arg) rs1444672793
NM_000251.2(MSH2):c.2190G>A (p.Leu730=) rs864622370
NM_000251.2(MSH2):c.2197G>A (p.Ala733Thr) rs772662439
NM_000251.2(MSH2):c.21G>A (p.Glu7=) rs1060504423
NM_000251.2(MSH2):c.2201C>G (p.Ser734Cys) rs1553369204
NM_000251.2(MSH2):c.2203A>G (p.Ile735Val) rs2229061
NM_000251.2(MSH2):c.2204del (p.Ile735fs) rs63750572
NM_000251.2(MSH2):c.2205C>A (p.Ile735=) rs533553381
NM_000251.2(MSH2):c.2205C>T (p.Ile735=) rs533553381
NM_000251.2(MSH2):c.2208C>T (p.Leu736=) rs541880457
NM_000251.2(MSH2):c.2209A>G (p.Arg737Gly)
NM_000251.2(MSH2):c.220A>C (p.Asn74His) rs150548839
NM_000251.2(MSH2):c.2210+1G>A rs267608002
NM_000251.2(MSH2):c.2210+7G>A rs374675118
NM_000251.2(MSH2):c.2210+7G>T rs374675118
NM_000251.2(MSH2):c.2210+8C>T rs778020437
NM_000251.2(MSH2):c.2210+9A>G rs878853810
NM_000251.2(MSH2):c.2211-10T>A rs267608006
NM_000251.2(MSH2):c.2211-2A>G rs267608001
NM_000251.2(MSH2):c.2211-5T>G rs368596736
NM_000251.2(MSH2):c.2211-6C>A rs267608003
NM_000251.2(MSH2):c.2211-7G>A rs764972956
NM_000251.2(MSH2):c.2218A>G (p.Thr740Ala) rs1553369627
NM_000251.2(MSH2):c.2219C>T (p.Thr740Ile)
NM_000251.2(MSH2):c.221A>G (p.Asn74Ser)
NM_000251.2(MSH2):c.2224G>A (p.Asp742Asn) rs879254183
NM_000251.2(MSH2):c.2228C>G (p.Ser743Ter) rs63751155
NM_000251.2(MSH2):c.222T>A (p.Asn74Lys) rs1553350075
NM_000251.2(MSH2):c.2236_2241del (p.Ile746_Ile747del) rs587779142
NM_000251.2(MSH2):c.2236dup (p.Ile746fs) rs863225392
NM_000251.2(MSH2):c.2241A>T (p.Ile747=) rs1060504411
NM_000251.2(MSH2):c.2242G>C (p.Asp748His) rs267608007
NM_000251.2(MSH2):c.2247A>G (p.Glu749=) rs1553369670
NM_000251.2(MSH2):c.2248T>C (p.Leu750=) rs527725593
NM_000251.2(MSH2):c.2252G>A (p.Gly751Glu)
NM_000251.2(MSH2):c.2260A>G (p.Thr754Ala) rs757268664
NM_000251.2(MSH2):c.2260A>T (p.Thr754Ser) rs757268664
NM_000251.2(MSH2):c.2261C>T (p.Thr754Ile) rs1553369680
NM_000251.2(MSH2):c.2266A>G (p.Thr756Ala) rs750646335
NM_000251.2(MSH2):c.2267C>G (p.Thr756Ser) rs372383829
NM_000251.2(MSH2):c.2269T>G (p.Tyr757Asp) rs1553369693
NM_000251.2(MSH2):c.226C>T (p.Gln76Ter) rs63750042
NM_000251.2(MSH2):c.2270A>G (p.Tyr757Cys)
NM_000251.2(MSH2):c.2271C>T (p.Tyr757=) rs56076152
NM_000251.2(MSH2):c.2272G>A (p.Asp758Asn) rs876658254
NM_000251.2(MSH2):c.2275G>T (p.Gly759Ter) rs63749854
NM_000251.2(MSH2):c.2277A>G (p.Gly759=) rs1057520316
NM_000251.2(MSH2):c.2279T>C (p.Phe760Ser)
NM_000251.2(MSH2):c.227A>G (p.Gln76Arg)
NM_000251.2(MSH2):c.227_228AG[1] (p.Ser77fs) rs63749848
NM_000251.2(MSH2):c.2281G>A (p.Gly761Arg) rs1060502038
NM_000251.2(MSH2):c.2282G>C (p.Gly761Ala) rs876659937
NM_000251.2(MSH2):c.2283G>A (p.Gly761=) rs755548149
NM_000251.2(MSH2):c.2283del (p.Gly761_Leu762insTer) rs786204050
NM_000251.2(MSH2):c.2288C>T (p.Ala763Val) rs144412585
NM_000251.2(MSH2):c.228G>T (p.Gln76His) rs587782857
NM_000251.2(MSH2):c.2290T>C (p.Trp764Arg) rs879254058
NM_000251.2(MSH2):c.2290T>G (p.Trp764Gly) rs879254058
NM_000251.2(MSH2):c.2291G>A (p.Trp764Ter) rs587779143
NM_000251.2(MSH2):c.2292G>C (p.Trp764Cys) rs63751105
NM_000251.2(MSH2):c.2293G>A (p.Ala765Thr) rs63750368
NM_000251.2(MSH2):c.2294C>T (p.Ala765Val) rs1261458082
NM_000251.2(MSH2):c.2296A>G (p.Ile766Val) rs374399939
NM_000251.2(MSH2):c.2297del (p.Ile766fs) rs863225394
NM_000251.2(MSH2):c.2298A>G (p.Ile766Met) rs1064795116
NM_000251.2(MSH2):c.2300C>G (p.Ser767Ter) rs863225395
NM_000251.2(MSH2):c.2303A>T (p.Glu768Val) rs1553369720
NM_000251.2(MSH2):c.2307C>G (p.Tyr769Ter)
NM_000251.2(MSH2):c.2308A>G (p.Ile770Val) rs63750684
NM_000251.2(MSH2):c.2309T>C (p.Ile770Thr) rs371718349
NM_000251.2(MSH2):c.2319G>C (p.Lys773Asn) rs745528772
NM_000251.2(MSH2):c.231T>G (p.Ser77Arg) rs1553350080
NM_000251.2(MSH2):c.2320A>G (p.Ile774Val) rs775464903
NM_000251.2(MSH2):c.2321T>C (p.Ile774Thr) rs878853811
NM_000251.2(MSH2):c.2321T>G (p.Ile774Ser) rs878853811
NM_000251.2(MSH2):c.2322T>C (p.Ile774=) rs56397910
NM_000251.2(MSH2):c.2326G>A (p.Ala776Thr) rs1558521842
NM_000251.2(MSH2):c.232G>A (p.Val78Ile) rs772779997
NM_000251.2(MSH2):c.2335A>C (p.Met779Leu) rs1114167843
NM_000251.2(MSH2):c.2335dup (p.Met779fs) rs63750149
NM_000251.2(MSH2):c.2337G>A (p.Met779Ile) rs41295292
NM_000251.2(MSH2):c.233T>C (p.Val78Ala)
NM_000251.2(MSH2):c.2341G>A (p.Ala781Thr) rs1553369742
NM_000251.2(MSH2):c.2343A>C (p.Ala781=) rs1057523777
NM_000251.2(MSH2):c.2347C>G (p.His783Asp) rs1553369748
NM_000251.2(MSH2):c.2347C>T (p.His783Tyr) rs1553369748
NM_000251.2(MSH2):c.2350T>C (p.Phe784Leu) rs1553369750
NM_000251.2(MSH2):c.2351T>G (p.Phe784Cys) rs1553369756
NM_000251.2(MSH2):c.2352T>G (p.Phe784Leu) rs1558521908
NM_000251.2(MSH2):c.2353C>T (p.His785Tyr) rs1553369759
NM_000251.2(MSH2):c.2354A>C (p.His785Pro) rs200252727
NM_000251.2(MSH2):c.2354A>G (p.His785Arg) rs200252727
NM_000251.2(MSH2):c.235G>A (p.Val79Met)
NM_000251.2(MSH2):c.2362A>C (p.Thr788Pro) rs774440277
NM_000251.2(MSH2):c.2365G>T (p.Ala789Ser) rs1553369769
NM_000251.2(MSH2):c.2366C>G (p.Ala789Gly)
NM_000251.2(MSH2):c.2366C>T (p.Ala789Val) rs876660292
NM_000251.2(MSH2):c.2367C>T (p.Ala789=) rs786202414
NM_000251.2(MSH2):c.2369del (p.Leu790fs) rs1558521949
NM_000251.2(MSH2):c.2372C>T (p.Ala791Val) rs1558521964
NM_000251.2(MSH2):c.2375A>G (p.Asn792Ser) rs587782891
NM_000251.2(MSH2):c.2375A>T (p.Asn792Ile) rs587782891
NM_000251.2(MSH2):c.2376T>A (p.Asn792Lys) rs1281667531
NM_000251.2(MSH2):c.2377C>A (p.Gln793Lys) rs730881769
NM_000251.2(MSH2):c.2377C>G (p.Gln793Glu) rs730881769
NM_000251.2(MSH2):c.2379G>T (p.Gln793His) rs767520406
NM_000251.2(MSH2):c.237G>T (p.Val79=) rs786202203
NM_000251.2(MSH2):c.2380A>C (p.Ile794Leu)
NM_000251.2(MSH2):c.2381T>A (p.Ile794Lys) rs1553369781
NM_000251.2(MSH2):c.2384C>A (p.Pro795Gln) rs1558521999
NM_000251.2(MSH2):c.2386A>T (p.Thr796Ser) rs876660738
NM_000251.2(MSH2):c.2387C>G (p.Thr796Ser)
NM_000251.2(MSH2):c.2387C>T (p.Thr796Ile) rs863224641
NM_000251.2(MSH2):c.2393A>C (p.Asn798Thr) rs786204073
NM_000251.2(MSH2):c.2393A>G (p.Asn798Ser) rs786204073
NM_000251.2(MSH2):c.2397T>C (p.Asn799=) rs368988823
NM_000251.2(MSH2):c.23C>G (p.Thr8Arg) rs17217716
NM_000251.2(MSH2):c.23C>T (p.Thr8Met) rs17217716
NM_000251.2(MSH2):c.2400A>G (p.Leu800=) rs201298777
NM_000251.2(MSH2):c.2401C>T (p.His801Tyr)
NM_000251.2(MSH2):c.2403T>C (p.His801=) rs1060504410
NM_000251.2(MSH2):c.2407A>G (p.Thr803Ala) rs63751168
NM_000251.2(MSH2):c.2410G>A (p.Ala804Thr) rs1060502005
NM_000251.2(MSH2):c.2412A>G (p.Ala804=) rs141523959
NM_000251.2(MSH2):c.2417C>T (p.Thr806Ile) rs758889557
NM_000251.2(MSH2):c.2420C>G (p.Thr807Ser) rs41295294
NM_000251.2(MSH2):c.2425G>A (p.Glu809Lys) rs202145681
NM_000251.2(MSH2):c.2426A>G (p.Glu809Gly)
NM_000251.2(MSH2):c.242G>A (p.Ser81Asn)
NM_000251.2(MSH2):c.242G>T (p.Ser81Ile) rs1064793491
NM_000251.2(MSH2):c.2437A>G (p.Met813Val) rs63749841
NM_000251.2(MSH2):c.2439G>A (p.Met813Ile) rs587781678
NM_000251.2(MSH2):c.2439G>C (p.Met813Ile) rs587781678
NM_000251.2(MSH2):c.2446C>T (p.Gln816Ter) rs63749917
NM_000251.2(MSH2):c.2448G>A (p.Gln816=)
NM_000251.2(MSH2):c.2458+1G>A rs267608010
NM_000251.2(MSH2):c.2458+1G>T rs267608010
NM_000251.2(MSH2):c.2458+3A>C rs761709497
NM_000251.2(MSH2):c.2458+4T>C rs1038735071
NM_000251.2(MSH2):c.2458+6T>C rs1558522202
NM_000251.2(MSH2):c.2458+8C>G rs189025757
NM_000251.2(MSH2):c.2458+9T>C rs864622575
NM_000251.2(MSH2):c.2459-1G>A rs1060501991
NM_000251.2(MSH2):c.2459-3T>C rs587781988
NM_000251.2(MSH2):c.2459-3T>G rs587781988
NM_000251.2(MSH2):c.2459-5T>A rs1060504417
NM_000251.2(MSH2):c.2459-6_2459-2delTTATA rs1114167841
NM_000251.2(MSH2):c.2459-9T>C rs776644342
NM_000251.2(MSH2):c.2459G>A (p.Gly820Asp) rs794729229
NM_000251.2(MSH2):c.2461G>C (p.Val821Leu)
NM_000251.2(MSH2):c.2466T>G (p.Cys822Trp)
NM_000251.2(MSH2):c.2470C>T (p.Gln824Ter) rs63750623
NM_000251.2(MSH2):c.2472A>G (p.Gln824=) rs1553370311
NM_000251.2(MSH2):c.2474del (p.Ser825fs)
NM_000251.2(MSH2):c.247A>G (p.Met83Val) rs766196837
NM_000251.2(MSH2):c.2481del (p.Ile828fs)
NM_000251.2(MSH2):c.2483T>G (p.Ile828Ser) rs753067992
NM_000251.2(MSH2):c.2487T>G (p.His829Gln) rs989510855
NM_000251.2(MSH2):c.2489T>C (p.Val830Ala) rs1553370328
NM_000251.2(MSH2):c.2491G>C (p.Ala831Pro)
NM_000251.2(MSH2):c.2496G>T (p.Glu832Asp)
NM_000251.2(MSH2):c.2500G>A (p.Ala834Thr) rs63750757
NM_000251.2(MSH2):c.2503A>C (p.Asn835His) rs41295296
NM_000251.2(MSH2):c.2503A>G (p.Asn835Asp) rs41295296
NM_000251.2(MSH2):c.2504A>G (p.Asn835Ser) rs779729016
NM_000251.2(MSH2):c.2506T>A (p.Phe836Ile) rs1553370345
NM_000251.2(MSH2):c.2508C>T (p.Phe836=) rs965790911
NM_000251.2(MSH2):c.2509C>T (p.Pro837Ser) rs1198289499
NM_000251.2(MSH2):c.250A>T (p.Asn84Tyr)
NM_000251.2(MSH2):c.2515C>G (p.His839Asp) rs876659466
NM_000251.2(MSH2):c.2516A>G (p.His839Arg) rs63750027
NM_000251.2(MSH2):c.2517T>A (p.His839Gln) rs267608016
NM_000251.2(MSH2):c.2518G>A (p.Val840Ile) rs878853812
NM_000251.2(MSH2):c.2519T>C (p.Val840Ala) rs1064794561
NM_000251.2(MSH2):c.2522T>C (p.Ile841Thr) rs1275767178
NM_000251.2(MSH2):c.2523A>G (p.Ile841Met)
NM_000251.2(MSH2):c.2523_2524AG[1] (p.Glu842fs) rs587779148
NM_000251.2(MSH2):c.2523dup (p.Glu842fs) rs1553370366
NM_000251.2(MSH2):c.2525A>T (p.Glu842Val) rs373393954
NM_000251.2(MSH2):c.2528G>A (p.Cys843Tyr) rs747700106
NM_000251.2(MSH2):c.2532dup (p.Lys845Ter) rs1553370371
NM_000251.2(MSH2):c.2533A>G (p.Lys845Glu) rs63750571
NM_000251.2(MSH2):c.2537A>G (p.Gln846Arg) rs140754514
NM_000251.2(MSH2):c.2542G>T (p.Ala848Ser) rs746972142
NM_000251.2(MSH2):c.2545C>G (p.Leu849Val) rs587778527
NM_000251.2(MSH2):c.2545C>T (p.Leu849=) rs587778527
NM_000251.2(MSH2):c.2551C>A (p.Leu851Ile) rs267608015
NM_000251.2(MSH2):c.2551C>G (p.Leu851Val) rs267608015
NM_000251.2(MSH2):c.2554G>A (p.Glu852Lys) rs587779966
NM_000251.2(MSH2):c.2554G>C (p.Glu852Gln) rs587779966
NM_000251.2(MSH2):c.2554_2556GAG[1] (p.Glu853del) rs766906365
NM_000251.2(MSH2):c.2556G>C (p.Glu852Asp) rs587781453
NM_000251.2(MSH2):c.2557G>T (p.Glu853Ter) rs1553370397
NM_000251.2(MSH2):c.2558A>C (p.Glu853Ala) rs63750797
NM_000251.2(MSH2):c.2558A>G (p.Glu853Gly) rs63750797
NM_000251.2(MSH2):c.2563C>G (p.Gln855Glu) rs1553370404
NM_000251.2(MSH2):c.2563C>T (p.Gln855Ter) rs1553370404
NM_000251.2(MSH2):c.2564A>G (p.Gln855Arg) rs587782256
NM_000251.2(MSH2):c.2565G>T (p.Gln855His) rs1553370408
NM_000251.2(MSH2):c.2566T>C (p.Tyr856His) rs786203818
NM_000251.2(MSH2):c.2567A>G (p.Tyr856Cys) rs587779150
NM_000251.2(MSH2):c.2569A>G (p.Ile857Val) rs753459308
NM_000251.2(MSH2):c.2571T>G (p.Ile857Met) rs1400051085
NM_000251.2(MSH2):c.2572G>A (p.Gly858Arg) rs754533481
NM_000251.2(MSH2):c.2574A>G (p.Gly858=) rs1553370416
NM_000251.2(MSH2):c.2575G>A (p.Glu859Lys) rs63749830
NM_000251.2(MSH2):c.2575G>T (p.Glu859Ter) rs63749830
NM_000251.2(MSH2):c.2576_2584del (p.Glu859_Gln861del) rs587781278
NM_000251.2(MSH2):c.2579C>A (p.Ser860Ter) rs63750849
NM_000251.2(MSH2):c.2579C>T (p.Ser860Leu) rs63750849
NM_000251.2(MSH2):c.257A>G (p.Glu86Gly)
NM_000251.2(MSH2):c.2580G>A (p.Ser860=) rs752428475
NM_000251.2(MSH2):c.2580G>T (p.Ser860=) rs752428475
NM_000251.2(MSH2):c.2582A>C (p.Gln861Pro) rs1313098392
NM_000251.2(MSH2):c.2582A>T (p.Gln861Leu) rs1313098392
NM_000251.2(MSH2):c.2585G>T (p.Gly862Val) rs1216558739
NM_000251.2(MSH2):c.2585dup (p.Tyr863fs) rs1553370431
NM_000251.2(MSH2):c.2586A>G (p.Gly862=) rs1060502024
NM_000251.2(MSH2):c.2588dup (p.Tyr863Ter) rs1553370435
NM_000251.2(MSH2):c.2590G>A (p.Asp864Asn) rs1553370439
NM_000251.2(MSH2):c.2591A>C (p.Asp864Ala) rs863224642
NM_000251.2(MSH2):c.2594T>C (p.Ile865Thr) rs549759248
NM_000251.2(MSH2):c.2595C>T (p.Ile865=) rs547695133
NM_000251.2(MSH2):c.2595_2597del (p.Ile865del) rs759912716
NM_000251.2(MSH2):c.2606C>A (p.Ala869Glu) rs730881772
NM_000251.2(MSH2):c.2606C>T (p.Ala869Val)
NM_000251.2(MSH2):c.2607A>G (p.Ala869=) rs876658574
NM_000251.2(MSH2):c.260C>G (p.Ser87Cys) rs587781447
NM_000251.2(MSH2):c.2615A>G (p.Lys872Arg) rs587780686
NM_000251.2(MSH2):c.2620T>G (p.Tyr874Asp) rs879254152
NM_000251.2(MSH2):c.2621A>G (p.Tyr874Cys) rs775390721
NM_000251.2(MSH2):c.2626G>T (p.Glu876Ter)
NM_000251.2(MSH2):c.2627A>G (p.Glu876Gly) rs1553370474
NM_000251.2(MSH2):c.2629_2630AG[2] (p.Glu878fs) rs63751618
NM_000251.2(MSH2):c.2630G>A (p.Arg877Lys)
NM_000251.2(MSH2):c.2634+1G>A rs267608019
NM_000251.2(MSH2):c.2634+5G>T rs267608017
NM_000251.2(MSH2):c.2634+7C>G rs905179122
NM_000251.2(MSH2):c.2634+8A>G rs1060502004
NM_000251.2(MSH2):c.2634G>A (p.Glu878=) rs63751624
NM_000251.2(MSH2):c.2634G>C (p.Glu878Asp) rs63751624
NM_000251.2(MSH2):c.2635-1G>T rs267608020
NM_000251.2(MSH2):c.2635-2A>C rs1114167818
NM_000251.2(MSH2):c.2635C>T (p.Gln879Ter) rs63751469
NM_000251.2(MSH2):c.2637A>G (p.Gln879=) rs1553370836
NM_000251.2(MSH2):c.2640_2656del (p.Glu881fs) rs1064792951
NM_000251.2(MSH2):c.2641G>C (p.Glu881Gln) rs876660450
NM_000251.2(MSH2):c.2645A>C (p.Lys882Thr) rs1284087975
NM_000251.2(MSH2):c.2647del (p.Ile883fs) rs63750084
NM_000251.2(MSH2):c.2647dup (p.Ile883fs) rs63750084
NM_000251.2(MSH2):c.2648T>C (p.Ile883Thr) rs1064796682
NM_000251.2(MSH2):c.2649T>G (p.Ile883Met) rs768983827
NM_000251.2(MSH2):c.264dup (p.Val89fs) rs267607920
NM_000251.2(MSH2):c.2650A>T (p.Ile884Phe) rs774732579
NM_000251.2(MSH2):c.2651T>C (p.Ile884Thr) rs63750409
NM_000251.2(MSH2):c.2656G>T (p.Glu886Ter) rs1230083633
NM_000251.2(MSH2):c.2661C>G (p.Phe887Leu) rs1290935051
NM_000251.2(MSH2):c.2662del (p.Leu888fs) rs63751007
NM_000251.2(MSH2):c.2666C>T (p.Ser889Phe) rs1553370845
NM_000251.2(MSH2):c.2667C>G (p.Ser889=) rs561680100
NM_000251.2(MSH2):c.266T>C (p.Val89Ala) rs876659747
NM_000251.2(MSH2):c.267A>G (p.Val89=) rs876658718
NM_000251.2(MSH2):c.2680dup (p.Met894fs) rs876658211
NM_000251.2(MSH2):c.2681T>C (p.Met894Thr) rs1558526026
NM_000251.2(MSH2):c.2683C>T (p.Pro895Ser)
NM_000251.2(MSH2):c.2684C>T (p.Pro895Leu) rs786203553
NM_000251.2(MSH2):c.2686T>G (p.Phe896Val) rs1558526036
NM_000251.2(MSH2):c.2691T>C (p.Thr897=) rs148653184
NM_000251.2(MSH2):c.2693A>C (p.Glu898Ala) rs1060502037
NM_000251.2(MSH2):c.2694A>C (p.Glu898Asp) rs890670494
NM_000251.2(MSH2):c.2697G>T (p.Met899Ile) rs878853813
NM_000251.2(MSH2):c.2699C>G (p.Ser900Ter) rs878853814
NM_000251.2(MSH2):c.26T>G (p.Leu9Arg)
NM_000251.2(MSH2):c.2706A>C (p.Glu902Asp) rs876660824
NM_000251.2(MSH2):c.2710A>T (p.Ile904Phe)
NM_000251.2(MSH2):c.2711T>A (p.Ile904Asn)
NM_000251.2(MSH2):c.2714C>G (p.Thr905Arg) rs267608022
NM_000251.2(MSH2):c.2714C>T (p.Thr905Ile) rs267608022
NM_000251.2(MSH2):c.2716A>G (p.Ile906Val) rs876658598
NM_000251.2(MSH2):c.2717T>C (p.Ile906Thr) rs587780687
NM_000251.2(MSH2):c.2717T>G (p.Ile906Arg) rs587780687
NM_000251.2(MSH2):c.2718A>G (p.Ile906Met) rs876659835
NM_000251.2(MSH2):c.2725A>C (p.Lys909Gln) rs879254253
NM_000251.2(MSH2):c.2725A>G (p.Lys909Glu)
NM_000251.2(MSH2):c.2726A>G (p.Lys909Arg) rs34319539
NM_000251.2(MSH2):c.2726A>T (p.Lys909Ile) rs34319539
NM_000251.2(MSH2):c.2728C>A (p.Gln910Lys) rs775130557
NM_000251.2(MSH2):c.272A>T (p.Asp91Val) rs876660914
NM_000251.2(MSH2):c.2732T>G (p.Leu911Arg) rs41295182
NM_000251.2(MSH2):c.2734A>C (p.Lys912Gln) rs1060501998
NM_000251.2(MSH2):c.2734A>G (p.Lys912Glu)
NM_000251.2(MSH2):c.2738C>G (p.Ala913Gly) rs1060502026
NM_000251.2(MSH2):c.273_275TCT[2] (p.Leu94del) rs267607919
NM_000251.2(MSH2):c.2741A>G (p.Glu914Gly) rs1558526149
NM_000251.2(MSH2):c.2743G>C (p.Val915Leu) rs1553370884
NM_000251.2(MSH2):c.2744T>C (p.Val915Ala) rs1399941088
NM_000251.2(MSH2):c.2746A>G (p.Ile916Val)
NM_000251.2(MSH2):c.2746A>T (p.Ile916Leu)
NM_000251.2(MSH2):c.2749G>A (p.Ala917Thr)
NM_000251.2(MSH2):c.274C>A (p.Leu92Ile) rs587779154
NM_000251.2(MSH2):c.274C>G (p.Leu92Val) rs587779154
NM_000251.2(MSH2):c.2754G>C (p.Lys918Asn) rs1553370893
NM_000251.2(MSH2):c.2755A>G (p.Asn919Asp)
NM_000251.2(MSH2):c.2757T>C (p.Asn919=) rs1354355913
NM_000251.2(MSH2):c.275T>A (p.Leu92His) rs1387584638
NM_000251.2(MSH2):c.2766T>C (p.Phe922=) rs55859129
NM_000251.2(MSH2):c.2768T>A (p.Val923Glu) rs146421227
NM_000251.2(MSH2):c.276T>G (p.Leu92=) rs1060504425
NM_000251.2(MSH2):c.2776A>G (p.Ile926Val) rs995312903
NM_000251.2(MSH2):c.2777T>A (p.Ile926Asn) rs199747712
NM_000251.2(MSH2):c.2782T>C (p.Ser928Pro) rs587781852
NM_000251.2(MSH2):c.2785C>T (p.Arg929Ter) rs551060742
NM_000251.2(MSH2):c.2786G>A (p.Arg929Gln) rs587779967
NM_000251.2(MSH2):c.2786G>T (p.Arg929Leu) rs587779967
NM_000251.2(MSH2):c.2789dup (p.Val932fs) rs786202481
NM_000251.2(MSH2):c.2790A>G (p.Ile930Met) rs587779155
NM_000251.2(MSH2):c.2798C>G (p.Thr933Ser) rs587779968
NM_000251.2(MSH2):c.2798C>T (p.Thr933Ile) rs587779968
NM_000251.2(MSH2):c.2801C>A (p.Thr934Lys) rs587779969
NM_000251.2(MSH2):c.2801C>T (p.Thr934Met) rs587779969
NM_000251.2(MSH2):c.2802G>A (p.Thr934=) rs150259097
NM_000251.2(MSH2):c.2803T>C (p.Ter935Arg)
NM_000251.2(MSH2):c.2804G>A (p.Ter935=) rs876658335
NM_000251.2(MSH2):c.282G>A (p.Leu94=) rs752387348
NM_000251.2(MSH2):c.283G>A (p.Val95Ile)
NM_000251.2(MSH2):c.285T>C (p.Val95=) rs1369335343
NM_000251.2(MSH2):c.286C>T (p.Arg96Cys) rs1443234544
NM_000251.2(MSH2):c.287G>A (p.Arg96His) rs63750002
NM_000251.2(MSH2):c.289C>T (p.Gln97Ter) rs63750970
NM_000251.2(MSH2):c.28C>T (p.Gln10Ter) rs63751099
NM_000251.2(MSH2):c.290A>C (p.Gln97Pro) rs1558457235
NM_000251.2(MSH2):c.291G>A (p.Gln97=) rs1064794792
NM_000251.2(MSH2):c.292_293TA[1] (p.Tyr98_Arg99delinsTer) rs1553350167
NM_000251.2(MSH2):c.293A>G (p.Tyr98Cys) rs63750887
NM_000251.2(MSH2):c.297A>T (p.Arg99Ser) rs587782283
NM_000251.2(MSH2):c.298G>A (p.Val100Ile)
NM_000251.2(MSH2):c.301G>T (p.Glu101Ter) rs63750318
NM_000251.2(MSH2):c.301_306del (p.Glu101_Val102del) rs587779157
NM_000251.2(MSH2):c.304G>A (p.Val102Ile) rs193922373
NM_000251.2(MSH2):c.307T>C (p.Tyr103His) rs587780688
NM_000251.2(MSH2):c.308A>T (p.Tyr103Phe)
NM_000251.2(MSH2):c.312G>A (p.Lys104=) rs372972328
NM_000251.2(MSH2):c.314A>G (p.Asn105Ser) rs1558457336
NM_000251.2(MSH2):c.315T>C (p.Asn105=) rs746066632
NM_000251.2(MSH2):c.317G>A (p.Arg106Lys) rs41295286
NM_000251.2(MSH2):c.317G>C (p.Arg106Thr) rs41295286
NM_000251.2(MSH2):c.319G>C (p.Ala107Pro) rs587779158
NM_000251.2(MSH2):c.320C>G (p.Ala107Gly) rs876658935
NM_000251.2(MSH2):c.326A>G (p.Asn109Ser) rs749545338
NM_000251.2(MSH2):c.327T>C (p.Asn109=) rs63751437
NM_000251.2(MSH2):c.328A>C (p.Lys110Gln) rs587779970
NM_000251.2(MSH2):c.333A>G (p.Ala111=) rs1060504408
NM_000251.2(MSH2):c.336C>A (p.Ser112=) rs34312619
NM_000251.2(MSH2):c.339G>A (p.Lys113=) rs35898375
NM_000251.2(MSH2):c.340G>T (p.Glu114Ter) rs878853815
NM_000251.2(MSH2):c.343A>T (p.Asn115Tyr) rs1553350228
NM_000251.2(MSH2):c.347A>T (p.Asp116Val) rs1035655051
NM_000251.2(MSH2):c.349T>G (p.Trp117Gly) rs1553350243
NM_000251.2(MSH2):c.34G>C (p.Glu12Gln) rs917968387
NM_000251.2(MSH2):c.34dup (p.Glu12fs) rs63750614
NM_000251.2(MSH2):c.350G>A (p.Trp117Ter) rs786202083
NM_000251.2(MSH2):c.350G>T (p.Trp117Leu)
NM_000251.2(MSH2):c.35A>C (p.Glu12Ala) rs1553348722
NM_000251.2(MSH2):c.361T>A (p.Tyr121Asn) rs878853816
NM_000251.2(MSH2):c.362A>G (p.Tyr121Cys) rs587779971
NM_000251.2(MSH2):c.362del (p.Tyr121fs) rs1114167831
NM_000251.2(MSH2):c.364A>G (p.Lys122Glu)
NM_000251.2(MSH2):c.365A>T (p.Lys122Met) rs863224643
NM_000251.2(MSH2):c.366+1G>A rs267607924
NM_000251.2(MSH2):c.366+88G>A rs864622763
NM_000251.2(MSH2):c.366+9C>T rs1553350269
NM_000251.2(MSH2):c.367-3T>G rs1558458845
NM_000251.2(MSH2):c.367-525_493del rs1553350466
NM_000251.2(MSH2):c.367-5C>G rs587782414
NM_000251.2(MSH2):c.367-6A>G rs769501299
NM_000251.2(MSH2):c.368C>G (p.Ala123Gly) rs730881767
NM_000251.2(MSH2):c.36G>C (p.Glu12Asp) rs1558451303
NM_000251.2(MSH2):c.373C>A (p.Pro125Thr) rs761767467
NM_000251.2(MSH2):c.376G>A (p.Gly126Ser) rs767371843
NM_000251.2(MSH2):c.380A>C (p.Asn127Thr)
NM_000251.2(MSH2):c.380A>G (p.Asn127Ser) rs17217772
NM_000251.2(MSH2):c.381_382TC[3] (p.Gln130fs) rs63750924
NM_000251.2(MSH2):c.382C>G (p.Leu128Val) rs145649774
NM_000251.2(MSH2):c.383T>G (p.Leu128Arg) rs730881768
NM_000251.2(MSH2):c.386C>G (p.Ser129Cys) rs587779972
NM_000251.2(MSH2):c.388C>T (p.Gln130Ter) rs1060501989
NM_000251.2(MSH2):c.388_389del (p.Gln130fs) rs63750704
NM_000251.2(MSH2):c.38G>A (p.Ser13Asn) rs63749907
NM_000251.2(MSH2):c.390G>C (p.Gln130His) rs1558458954
NM_000251.2(MSH2):c.391T>G (p.Phe131Val) rs755423698
NM_000251.2(MSH2):c.399C>T (p.Asp133=) rs61756462
NM_000251.2(MSH2):c.39C>A (p.Ser13Arg) rs1060502015
NM_000251.2(MSH2):c.39C>G (p.Ser13Arg)
NM_000251.2(MSH2):c.400A>G (p.Ile134Val)
NM_000251.2(MSH2):c.403C>G (p.Leu135Val) rs193096019
NM_000251.2(MSH2):c.403C>T (p.Leu135Phe) rs193096019
NM_000251.2(MSH2):c.405C>G (p.Leu135=) rs778368203
NM_000251.2(MSH2):c.408T>G (p.Phe136Leu) rs1558458996
NM_000251.2(MSH2):c.408del (p.Phe136fs) rs63750408
NM_000251.2(MSH2):c.409G>C (p.Gly137Arg) rs587781795
NM_000251.2(MSH2):c.40G>A (p.Ala14Thr) rs876658277
NM_000251.2(MSH2):c.413A>G (p.Asn138Ser) rs769154205
NM_000251.2(MSH2):c.419_420AT[1] (p.Met141fs) rs1553350680
NM_000251.2(MSH2):c.421A>G (p.Met141Val) rs193922374
NM_000251.2(MSH2):c.426A>G (p.Ser142=) rs937438549
NM_000251.2(MSH2):c.427G>A (p.Ala143Thr) rs878853817
NM_000251.2(MSH2):c.428C>G (p.Ala143Gly) rs1553350694
NM_000251.2(MSH2):c.42G>A (p.Ala14=) rs374396150
NM_000251.2(MSH2):c.431C>G (p.Ser144Cys) rs878853818
NM_000251.2(MSH2):c.433A>G (p.Ile145Val) rs876659264
NM_000251.2(MSH2):c.434T>C (p.Ile145Thr) rs774132884
NM_000251.2(MSH2):c.435T>G (p.Ile145Met) rs63750124
NM_000251.2(MSH2):c.437G>T (p.Gly146Val) rs772052262
NM_000251.2(MSH2):c.437_438GT[3] (p.Val148fs) rs1558459096
NM_000251.2(MSH2):c.438T>C (p.Gly146=) rs587779161
NM_000251.2(MSH2):c.439G>A (p.Val147Ile) rs773125415
NM_000251.2(MSH2):c.43G>A (p.Ala15Thr) rs1183892581
NM_000251.2(MSH2):c.446G>A (p.Gly149Asp) rs587779162
NM_000251.2(MSH2):c.446G>C (p.Gly149Ala) rs587779162
NM_000251.2(MSH2):c.446G>T (p.Gly149Val)
NM_000251.2(MSH2):c.447T>C (p.Gly149=) rs786203142
NM_000251.2(MSH2):c.448G>A (p.Val150Ile) rs1558459157
NM_000251.2(MSH2):c.448G>C (p.Val150Leu)
NM_000251.2(MSH2):c.452A>C (p.Lys151Thr) rs1558459171
NM_000251.2(MSH2):c.458C>G (p.Ser153Cys) rs766349734
NM_000251.2(MSH2):c.459C>T (p.Ser153=) rs63751065
NM_000251.2(MSH2):c.460G>A (p.Ala154Thr) rs759712763
NM_000251.2(MSH2):c.462A>C (p.Ala154=) rs1553350740
NM_000251.2(MSH2):c.464T>C (p.Val155Ala) rs876658188
NM_000251.2(MSH2):c.464T>G (p.Val155Gly) rs876658188
NM_000251.2(MSH2):c.470G>C (p.Gly157Ala) rs765489269
NM_000251.2(MSH2):c.470G>T (p.Gly157Val)
NM_000251.2(MSH2):c.471C>A (p.Gly157=) rs61756463
NM_000251.2(MSH2):c.471C>T (p.Gly157=) rs61756463
NM_000251.2(MSH2):c.475del (p.Arg159fs) rs1553350758
NM_000251.2(MSH2):c.478C>T (p.Gln160Ter) rs63751426
NM_000251.2(MSH2):c.47A>C (p.Glu16Ala) rs745771647
NM_000251.2(MSH2):c.481G>A (p.Val161Ile) rs149511545
NM_000251.2(MSH2):c.481G>C (p.Val161Leu)
NM_000251.2(MSH2):c.482T>C (p.Val161Ala)
NM_000251.2(MSH2):c.484G>A (p.Gly162Arg) rs63750624
NM_000251.2(MSH2):c.485G>C (p.Gly162Ala) rs63750773
NM_000251.2(MSH2):c.48G>C (p.Glu16Asp) rs1060502036
NM_000251.2(MSH2):c.491G>A (p.Gly164Glu) rs786204082
NM_000251.2(MSH2):c.493T>G (p.Tyr165Asp) rs587779163
NM_000251.2(MSH2):c.499G>C (p.Asp167His) rs63750255
NM_000251.2(MSH2):c.49G>C (p.Val17Leu) rs63750966
NM_000251.2(MSH2):c.4G>A (p.Ala2Thr) rs63750466
NM_000251.2(MSH2):c.4_21dup (p.Ala2_Glu7dup) rs281864943
NM_000251.2(MSH2):c.501T>C (p.Asp167=) rs757733033
NM_000251.2(MSH2):c.503C>T (p.Ser168Phe) rs1244537662
NM_000251.2(MSH2):c.504C>T (p.Ser168=) rs1200735883
NM_000251.2(MSH2):c.505A>G (p.Ile169Val) rs63750716
NM_000251.2(MSH2):c.506T>C (p.Ile169Thr) rs1060502011
NM_000251.2(MSH2):c.507A>G (p.Ile169Met) rs748762580
NM_000251.2(MSH2):c.508C>G (p.Gln170Glu) rs63750843
NM_000251.2(MSH2):c.508C>T (p.Gln170Ter) rs63750843
NM_000251.2(MSH2):c.510dup (p.Arg171fs) rs1553350787
NM_000251.2(MSH2):c.512G>A (p.Arg171Lys) rs63750902
NM_000251.2(MSH2):c.516A>G (p.Lys172=) rs1553350796
NM_000251.2(MSH2):c.519A>G (p.Leu173=) rs1553350805
NM_000251.2(MSH2):c.524T>C (p.Leu175Pro) rs63751291
NM_000251.2(MSH2):c.525G>A (p.Leu175=) rs771827041
NM_000251.2(MSH2):c.525_532del (p.Cys176fs) rs1114167877
NM_000251.2(MSH2):c.527G>T (p.Cys176Phe) rs1553350829
NM_000251.2(MSH2):c.531A>G (p.Glu177=) rs1060504416
NM_000251.2(MSH2):c.531A>T (p.Glu177Asp) rs1060504416
NM_000251.2(MSH2):c.536C>T (p.Pro179Leu) rs902336078
NM_000251.2(MSH2):c.540T>C (p.Asp180=) rs1553350845
NM_000251.2(MSH2):c.548A>G (p.Gln183Arg) rs1327382646
NM_000251.2(MSH2):c.54C>T (p.Gly18=) rs63750777
NM_000251.2(MSH2):c.552C>A (p.Phe184Leu)
NM_000251.2(MSH2):c.552C>T (p.Phe184=) rs786202238
NM_000251.2(MSH2):c.554C>T (p.Ser185Phe) rs878853819
NM_000251.2(MSH2):c.556A>C (p.Asn186His) rs766497093
NM_000251.2(MSH2):c.557A>G (p.Asn186Ser) rs151129360
NM_000251.2(MSH2):c.559C>T (p.Leu187Phe) rs759603999
NM_000251.2(MSH2):c.55T>C (p.Phe19Leu) rs141711342
NM_000251.2(MSH2):c.55T>G (p.Phe19Val) rs141711342
NM_000251.2(MSH2):c.560T>G (p.Leu187Arg) rs63751444
NM_000251.2(MSH2):c.562G>C (p.Glu188Gln) rs1064795622
NM_000251.2(MSH2):c.564G>A (p.Glu188=) rs1553350883
NM_000251.2(MSH2):c.565G>A (p.Ala189Thr) rs63750821
NM_000251.2(MSH2):c.566C>G (p.Ala189Gly) rs141021599
NM_000251.2(MSH2):c.568_570CTC[1] (p.Leu191del) rs587779165
NM_000251.2(MSH2):c.56T>C (p.Phe19Ser)
NM_000251.2(MSH2):c.573C>T (p.Leu191=) rs1800151
NM_000251.2(MSH2):c.574A>T (p.Ile192Phe) rs768006988
NM_000251.2(MSH2):c.576C>G (p.Ile192Met)
NM_000251.2(MSH2):c.576C>T (p.Ile192=) rs864622381
NM_000251.2(MSH2):c.577C>T (p.Gln193Ter) rs63751326
NM_000251.2(MSH2):c.581T>C (p.Ile194Thr) rs730881778
NM_000251.2(MSH2):c.586C>T (p.Pro196Ser) rs587782804
NM_000251.2(MSH2):c.587C>A (p.Pro196Gln) rs754478179
NM_000251.2(MSH2):c.588A>C (p.Pro196=) rs1553350915
NM_000251.2(MSH2):c.589A>C (p.Lys197Gln) rs778573140
NM_000251.2(MSH2):c.589A>G (p.Lys197Glu) rs778573140
NM_000251.2(MSH2):c.58G>C (p.Val20Leu)
NM_000251.2(MSH2):c.594A>G (p.Glu198=) rs369685768
NM_000251.2(MSH2):c.598G>A (p.Val200Ile) rs1558459684
NM_000251.2(MSH2):c.599T>A (p.Val200Asp) rs587779167
NM_000251.2(MSH2):c.5C>A (p.Ala2Glu) rs587778521
NM_000251.2(MSH2):c.5C>T (p.Ala2Val) rs587778521
NM_000251.2(MSH2):c.605C>G (p.Pro202Arg) rs1060502002
NM_000251.2(MSH2):c.605C>T (p.Pro202Leu) rs1060502002
NM_000251.2(MSH2):c.606C>A (p.Pro202=)
NM_000251.2(MSH2):c.606C>G (p.Pro202=) rs63750600
NM_000251.2(MSH2):c.606C>T (p.Pro202=) rs63750600
NM_000251.2(MSH2):c.607G>A (p.Gly203Arg) rs587779973
NM_000251.2(MSH2):c.610G>A (p.Gly204Arg) rs63750574
NM_000251.2(MSH2):c.610G>T (p.Gly204Ter) rs63750574
NM_000251.2(MSH2):c.613G>C (p.Glu205Gln) rs63749984
NM_000251.2(MSH2):c.617C>G (p.Thr206Ser) rs876658623
NM_000251.2(MSH2):c.619G>A (p.Ala207Thr) rs63750913
NM_000251.2(MSH2):c.622_627dup (p.Gly208_Asp209dup) rs1553350958
NM_000251.2(MSH2):c.623G>C (p.Gly208Ala)
NM_000251.2(MSH2):c.624A>C (p.Gly208=) rs786202651
NM_000251.2(MSH2):c.624A>T (p.Gly208=) rs786202651
NM_000251.2(MSH2):c.628A>G (p.Met210Val) rs1558459826
NM_000251.2(MSH2):c.628_629del (p.Met210fs) rs1553350966
NM_000251.2(MSH2):c.62G>A (p.Arg21His) rs730881760
NM_000251.2(MSH2):c.62G>T (p.Arg21Leu) rs730881760
NM_000251.2(MSH2):c.62_63delinsTT (p.Arg21Leu) rs1060501996
NM_000251.2(MSH2):c.630G>A (p.Met210Ile)
NM_000251.2(MSH2):c.631G>A (p.Gly211Arg) rs587780689
NM_000251.2(MSH2):c.639G>A (p.Leu213=) rs751250018
NM_000251.2(MSH2):c.63C>T (p.Arg21=) rs1060504419
NM_000251.2(MSH2):c.641G>T (p.Arg214Ile) rs763298811
NM_000251.2(MSH2):c.642A>G (p.Arg214=) rs768931909
NM_000251.2(MSH2):c.643del (p.Gln215fs) rs1558459882
NM_000251.2(MSH2):c.645+2T>G rs876658996
NM_000251.2(MSH2):c.645+3A>G rs587779168
NM_000251.2(MSH2):c.645+8A>G rs140217708
NM_000251.2(MSH2):c.646-2A>G rs587779169
NM_000251.2(MSH2):c.646-3T>C rs267607930
NM_000251.2(MSH2):c.646-4A>G rs587779974
NM_000251.2(MSH2):c.646-4dup rs1553351541
NM_000251.2(MSH2):c.646-8delC rs878853820
NM_000251.2(MSH2):c.646A>G (p.Ile216Val) rs63749936
NM_000251.2(MSH2):c.655dup (p.Arg219fs) rs1558461615
NM_000251.2(MSH2):c.656G>C (p.Arg219Thr) rs878853821
NM_000251.2(MSH2):c.658G>C (p.Gly220Arg)
NM_000251.2(MSH2):c.661G>C (p.Gly221Arg) rs1558461638
NM_000251.2(MSH2):c.663A>G (p.Gly221=) rs1553351570
NM_000251.2(MSH2):c.668T>C (p.Leu223Pro) rs1060501992
NM_000251.2(MSH2):c.669G>A (p.Leu223=) rs751195930
NM_000251.2(MSH2):c.66C>G (p.Phe22Leu) rs200632093
NM_000251.2(MSH2):c.672C>G (p.Ile224Met) rs587779171
NM_000251.2(MSH2):c.674C>T (p.Thr225Ile) rs1553351576
NM_000251.2(MSH2):c.679del (p.Arg227fs)
NM_000251.2(MSH2):c.67T>C (p.Phe23Leu) rs372619120
NM_000251.2(MSH2):c.680_681del (p.Arg227fs) rs1558461683
NM_000251.2(MSH2):c.681A>T (p.Arg227Ser)
NM_000251.2(MSH2):c.682A>G (p.Lys228Glu) rs200313142
NM_000251.2(MSH2):c.686_687del (p.Lys229fs) rs63749897
NM_000251.2(MSH2):c.687del (p.Ala230fs) rs63749897
NM_000251.2(MSH2):c.687dup (p.Ala230fs) rs63749897
NM_000251.2(MSH2):c.689C>G (p.Ala230Gly) rs1553351592
NM_000251.2(MSH2):c.689C>T (p.Ala230Val) rs1553351592
NM_000251.2(MSH2):c.691G>A (p.Asp231Asn) rs1384841612
NM_000251.2(MSH2):c.693C>T (p.Asp231=) rs541325199
NM_000251.2(MSH2):c.698C>G (p.Ser233Cys) rs587781724
NM_000251.2(MSH2):c.699C>A (p.Ser233=) rs1403583908
NM_000251.2(MSH2):c.6G>C (p.Ala2=) rs368270856
NM_000251.2(MSH2):c.6G>T (p.Ala2=) rs368270856
NM_000251.2(MSH2):c.700A>G (p.Thr234Ala) rs1212577306
NM_000251.2(MSH2):c.700A>T (p.Thr234Ser)
NM_000251.2(MSH2):c.701C>T (p.Thr234Ile) rs730881773
NM_000251.2(MSH2):c.703A>G (p.Lys235Glu) rs749442037
NM_000251.2(MSH2):c.704_705del (p.Lys235fs) rs281864944
NM_000251.2(MSH2):c.708C>A (p.Asp236Glu) rs1553351613
NM_000251.2(MSH2):c.709A>G (p.Ile237Val) rs63751307
NM_000251.2(MSH2):c.70C>G (p.Gln24Glu) rs587779976
NM_000251.2(MSH2):c.712T>G (p.Tyr238Asp) rs1060501987
NM_000251.2(MSH2):c.713A>G (p.Tyr238Cys) rs1553351618
NM_000251.2(MSH2):c.713A>T (p.Tyr238Phe)
NM_000251.2(MSH2):c.714T>C (p.Tyr238=) rs369670665
NM_000251.2(MSH2):c.715C>G (p.Gln239Glu) rs63750488
NM_000251.2(MSH2):c.715C>T (p.Gln239Ter) rs63750488
NM_000251.2(MSH2):c.716A>G (p.Gln239Arg) rs199676483
NM_000251.2(MSH2):c.719A>C (p.Asp240Ala)
NM_000251.2(MSH2):c.719A>G (p.Asp240Gly) rs878853822
NM_000251.2(MSH2):c.721C>G (p.Leu241Val) rs1410859610
NM_000251.2(MSH2):c.721C>T (p.Leu241Phe) rs1410859610
NM_000251.2(MSH2):c.725A>G (p.Asn242Ser) rs779051492
NM_000251.2(MSH2):c.726C>G (p.Asn242Lys) rs748427458
NM_000251.2(MSH2):c.726C>T (p.Asn242=) rs748427458
NM_000251.2(MSH2):c.727C>T (p.Arg243Trp) rs138857091
NM_000251.2(MSH2):c.728G>A (p.Arg243Gln) rs63751455
NM_000251.2(MSH2):c.735G>C (p.Leu245Phe) rs864622271
NM_000251.2(MSH2):c.736A>G (p.Lys246Glu) rs63750881
NM_000251.2(MSH2):c.73G>T (p.Gly25Cys) rs746259256
NM_000251.2(MSH2):c.741C>G (p.Gly247=) rs747321505
NM_000251.2(MSH2):c.742A>G (p.Lys248Glu) rs587779178
NM_000251.2(MSH2):c.744A>C (p.Lys248Asn) rs1060502022
NM_000251.2(MSH2):c.746A>G (p.Lys249Arg) rs61756464
NM_000251.2(MSH2):c.748G>T (p.Gly250Ter) rs864622183
NM_000251.2(MSH2):c.74G>A (p.Gly25Asp) rs767747378
NM_000251.2(MSH2):c.754C>T (p.Gln252Ter) rs63750347
NM_000251.2(MSH2):c.755A>C (p.Gln252Pro) rs370906735
NM_000251.2(MSH2):c.755A>G (p.Gln252Arg) rs370906735
NM_000251.2(MSH2):c.759G>A (p.Met253Ile) rs1060502021
NM_000251.2(MSH2):c.761A>G (p.Asn254Ser) rs1558462016
NM_000251.2(MSH2):c.762T>C (p.Asn254=) rs587779180
NM_000251.2(MSH2):c.763A>G (p.Ser255Gly) rs761529282
NM_000251.2(MSH2):c.764G>A (p.Ser255Asn) rs763184168
NM_000251.2(MSH2):c.764G>C (p.Ser255Thr) rs763184168
NM_000251.2(MSH2):c.766G>A (p.Ala256Thr) rs377403073
NM_000251.2(MSH2):c.769G>A (p.Val257Ile) rs876659357
NM_000251.2(MSH2):c.76A>C (p.Met26Leu) rs876660371
NM_000251.2(MSH2):c.76A>G (p.Met26Val) rs876660371
NM_000251.2(MSH2):c.775C>T (p.Pro259Ser) rs587781294
NM_000251.2(MSH2):c.781A>G (p.Met261Val) rs786201941
NM_000251.2(MSH2):c.782T>C (p.Met261Thr) rs63749969
NM_000251.2(MSH2):c.782_783insA (p.Met261fs) rs786204144
NM_000251.2(MSH2):c.784G>C (p.Glu262Gln) rs1553351739
NM_000251.2(MSH2):c.785A>T (p.Glu262Val) rs1558462101
NM_000251.2(MSH2):c.786G>T (p.Glu262Asp) rs754820584
NM_000251.2(MSH2):c.788A>G (p.Asn263Ser) rs1553351743
NM_000251.2(MSH2):c.789T>G (p.Asn263Lys) rs878853823
NM_000251.2(MSH2):c.790C>T (p.Gln264Ter) rs878853824
NM_000251.2(MSH2):c.791A>G (p.Gln264Arg) rs730881780
NM_000251.2(MSH2):c.792+1delG rs1064794155
NM_000251.2(MSH2):c.792+4C>T rs1416241924
NM_000251.2(MSH2):c.792+5A>G rs267607935
NM_000251.2(MSH2):c.792+6T>A rs553480072
NM_000251.2(MSH2):c.792G>A (p.Gln264=) rs587779183
NM_000251.2(MSH2):c.793-10T>G rs1060502016
NM_000251.2(MSH2):c.793-1G>A rs863225397
NM_000251.2(MSH2):c.793G>A (p.Val265Ile)
NM_000251.2(MSH2):c.795T>G (p.Val265=) rs63749903
NM_000251.2(MSH2):c.796G>A (p.Ala266Thr) rs1114167887
NM_000251.2(MSH2):c.797C>A (p.Ala266Glu)
NM_000251.2(MSH2):c.797C>T (p.Ala266Val) rs587781745
NM_000251.2(MSH2):c.798A>T (p.Ala266=) rs878853825
NM_000251.2(MSH2):c.79C>A (p.Pro27Thr) rs878853826
NM_000251.2(MSH2):c.79C>G (p.Pro27Ala)
NM_000251.2(MSH2):c.7G>A (p.Val3Met) rs1257347271
NM_000251.2(MSH2):c.802T>G (p.Ser268Ala) rs876659298
NM_000251.2(MSH2):c.803C>T (p.Ser268Leu) rs563410947
NM_000251.2(MSH2):c.806C>T (p.Ser269Leu) rs63750058
NM_000251.2(MSH2):c.808C>G (p.Leu270Val) rs758403441
NM_000251.2(MSH2):c.80C>G (p.Pro27Arg)
NM_000251.2(MSH2):c.80C>T (p.Pro27Leu) rs750746034
NM_000251.2(MSH2):c.811_814del (p.Ser271fs) rs587779185
NM_000251.2(MSH2):c.812C>A (p.Ser271Tyr) rs139891783
NM_000251.2(MSH2):c.812C>G (p.Ser271Cys) rs139891783
NM_000251.2(MSH2):c.812_813del (p.Ser271fs)
NM_000251.2(MSH2):c.813T>C (p.Ser271=) rs1057523559
NM_000251.2(MSH2):c.815C>T (p.Ala272Val) rs34136999
NM_000251.2(MSH2):c.816G>A (p.Ala272=) rs368912987
NM_000251.2(MSH2):c.817G>A (p.Val273Ile) rs530814648
NM_000251.2(MSH2):c.818T>C (p.Val273Ala) rs144288433
NM_000251.2(MSH2):c.819A>G (p.Val273=) rs146577635
NM_000251.2(MSH2):c.819_821delinsTG (p.Ile274fs) rs864622261
NM_000251.2(MSH2):c.81G>A (p.Pro27=) rs1553348766
NM_000251.2(MSH2):c.820A>G (p.Ile274Val) rs371944271
NM_000251.2(MSH2):c.830T>A (p.Leu277Ter) rs786203424
NM_000251.2(MSH2):c.832G>A (p.Glu278Lys) rs1558464008
NM_000251.2(MSH2):c.832G>T (p.Glu278Ter)
NM_000251.2(MSH2):c.835C>G (p.Leu279Val) rs375351205
NM_000251.2(MSH2):c.836T>A (p.Leu279His) rs1024743168
NM_000251.2(MSH2):c.837C>T (p.Leu279=) rs747730026
NM_000251.2(MSH2):c.838T>C (p.Leu280=) rs1553352449
NM_000251.2(MSH2):c.841T>A (p.Ser281Thr)
NM_000251.2(MSH2):c.841T>C (p.Ser281Pro) rs587779977
NM_000251.2(MSH2):c.842C>G (p.Ser281Ter) rs63749991
NM_000251.2(MSH2):c.843A>G (p.Ser281=) rs150197753
NM_000251.2(MSH2):c.843A>T (p.Ser281=) rs150197753
NM_000251.2(MSH2):c.844G>C (p.Asp282His)
NM_000251.2(MSH2):c.845A>G (p.Asp282Gly) rs587779978
NM_000251.2(MSH2):c.846T>G (p.Asp282Glu) rs1254906246
NM_000251.2(MSH2):c.848A>T (p.Asp283Val) rs770643326
NM_000251.2(MSH2):c.849T>C (p.Asp283=) rs876659344
NM_000251.2(MSH2):c.84G>A (p.Glu28=) rs752220575
NM_000251.2(MSH2):c.854A>C (p.Asn285Thr)
NM_000251.2(MSH2):c.854A>G (p.Asn285Ser) rs1060502031
NM_000251.2(MSH2):c.855C>G (p.Asn285Lys) rs759242666
NM_000251.2(MSH2):c.85A>T (p.Lys29Ter) rs1060502001
NM_000251.2(MSH2):c.860G>C (p.Gly287Ala) rs587782567
NM_000251.2(MSH2):c.860dup (p.Gln288fs) rs193922375
NM_000251.2(MSH2):c.862C>T (p.Gln288Ter) rs63750097
NM_000251.2(MSH2):c.865T>C (p.Phe289Leu) rs1060502003
NM_000251.2(MSH2):c.867T>C (p.Phe289=) rs863224342
NM_000251.2(MSH2):c.871C>G (p.Leu291Val) rs878853827
NM_000251.2(MSH2):c.873_876del (p.Thr292fs) rs587779191
NM_000251.2(MSH2):c.874A>C (p.Thr292Pro)
NM_000251.2(MSH2):c.874A>G (p.Thr292Ala) rs104895022
NM_000251.2(MSH2):c.874A>T (p.Thr292Ser) rs104895022
NM_000251.2(MSH2):c.876dup (p.Thr293fs) rs1553352505
NM_000251.2(MSH2):c.877A>G (p.Thr293Ala) rs1296650088
NM_000251.2(MSH2):c.87_90del (p.Thr31fs) rs1060502000
NM_000251.2(MSH2):c.885C>G (p.Asp295Glu) rs201334592
NM_000251.2(MSH2):c.885C>T (p.Asp295=) rs201334592
NM_000251.2(MSH2):c.887T>A (p.Phe296Tyr)
NM_000251.2(MSH2):c.891C>G (p.Ser297Arg) rs551236465
NM_000251.2(MSH2):c.892C>T (p.Gln298Ter) rs63750934
NM_000251.2(MSH2):c.894G>C (p.Gln298His) rs587781397
NM_000251.2(MSH2):c.896A>G (p.Tyr299Cys) rs1558464315
NM_000251.2(MSH2):c.898A>G (p.Met300Val) rs730881753
NM_000251.2(MSH2):c.89C>T (p.Pro30Leu) rs757892928
NM_000251.2(MSH2):c.904T>A (p.Leu302Met) rs876660115
NM_000251.2(MSH2):c.905T>C (p.Leu302Ser) rs63749914
NM_000251.2(MSH2):c.910A>G (p.Ile304Val) rs1558464351
NM_000251.2(MSH2):c.911T>C (p.Ile304Thr) rs1021303606
NM_000251.2(MSH2):c.912dup (p.Ala305fs) rs863224833
NM_000251.2(MSH2):c.913G>A (p.Ala305Thr) rs63751454
NM_000251.2(MSH2):c.915A>C (p.Ala305=) rs757483245
NM_000251.2(MSH2):c.929T>G (p.Leu310Arg) rs63750640
NM_000251.2(MSH2):c.92C>G (p.Thr31Ser) rs746635262
NM_000251.2(MSH2):c.932A>G (p.Asn311Ser) rs1553352559
NM_000251.2(MSH2):c.932del (p.Asn311fs) rs587779979
NM_000251.2(MSH2):c.933C>T (p.Asn311=) rs1060504424
NM_000251.2(MSH2):c.934C>A (p.Leu312Ile) rs756398636
NM_000251.2(MSH2):c.934C>G (p.Leu312Val) rs756398636
NM_000251.2(MSH2):c.934del (p.Leu312fs) rs267607937
NM_000251.2(MSH2):c.938T>C (p.Phe313Ser) rs780656204
NM_000251.2(MSH2):c.939T>C (p.Phe313=) rs970103452
NM_000251.2(MSH2):c.939del (p.Gln314fs) rs796532309
NM_000251.2(MSH2):c.940C>T (p.Gln314Ter) rs1114167845
NM_000251.2(MSH2):c.942+1G>T rs587779193
NM_000251.2(MSH2):c.942+20_942+29del rs11309117
NM_000251.2(MSH2):c.942+2_942+6delTAAAA rs755583143
NM_000251.2(MSH2):c.942+3A>G rs193922376
NM_000251.2(MSH2):c.942+3A>T rs193922376
NM_000251.2(MSH2):c.942+5A>C rs769242733
NM_000251.2(MSH2):c.943-1G>A rs12476364
NM_000251.2(MSH2):c.943-1G>C rs12476364
NM_000251.2(MSH2):c.943-1G>T rs12476364
NM_000251.2(MSH2):c.943-2A>G rs587779198
NM_000251.2(MSH2):c.943-4C>T rs1432053166
NM_000251.2(MSH2):c.943-6T>C rs768644134
NM_000251.2(MSH2):c.944G>T (p.Gly315Val) rs202026056
NM_000251.2(MSH2):c.946T>C (p.Ser316Pro) rs1553353101
NM_000251.2(MSH2):c.948T>C (p.Ser316=) rs1553353102
NM_000251.2(MSH2):c.94A>C (p.Thr32Pro) rs1060502033
NM_000251.2(MSH2):c.951T>A (p.Val317=) rs1553353105
NM_000251.2(MSH2):c.955G>A (p.Asp319Asn) rs876660605
NM_000251.2(MSH2):c.955G>T (p.Asp319Tyr) rs876660605
NM_000251.2(MSH2):c.956A>T (p.Asp319Val) rs786204185
NM_000251.2(MSH2):c.95C>A (p.Thr32Asn) rs552361923
NM_000251.2(MSH2):c.95C>G (p.Thr32Ser) rs552361923
NM_000251.2(MSH2):c.960C>G (p.Thr320=) rs1214000485
NM_000251.2(MSH2):c.961A>T (p.Thr321Ser) rs587781550
NM_000251.2(MSH2):c.961_1006del (p.Thr321fs) rs1553353114
NM_000251.2(MSH2):c.962C>G (p.Thr321Ser) rs1233448699
NM_000251.2(MSH2):c.964G>A (p.Gly322Ser) rs773301485
NM_000251.2(MSH2):c.965G>A (p.Gly322Asp) rs4987188
NM_000251.2(MSH2):c.965G>T (p.Gly322Val) rs4987188
NM_000251.2(MSH2):c.966C>T (p.Gly322=) rs878853829
NM_000251.2(MSH2):c.968C>G (p.Ser323Cys) rs63750732
NM_000251.2(MSH2):c.968C>T (p.Ser323Phe) rs63750732
NM_000251.2(MSH2):c.970C>G (p.Gln324Glu)
NM_000251.2(MSH2):c.972G>A (p.Gln324=) rs63750505
NM_000251.2(MSH2):c.975T>C (p.Ser325=) rs1060504413
NM_000251.2(MSH2):c.976C>T (p.Leu326=) rs1237931528
NM_000251.2(MSH2):c.978G>C (p.Leu326=) rs1060504418
NM_000251.2(MSH2):c.979del (p.Ala327fs) rs1558466434
NM_000251.2(MSH2):c.97A>C (p.Thr33Pro) rs63751107
NM_000251.2(MSH2):c.97A>G (p.Thr33Ala) rs63751107
NM_000251.2(MSH2):c.980C>T (p.Ala327Val) rs1553353141
NM_000251.2(MSH2):c.982G>A (p.Ala328Thr) rs753237286
NM_000251.2(MSH2):c.982G>T (p.Ala328Ser) rs753237286
NM_000251.2(MSH2):c.984C>G (p.Ala328=) rs4987189
NM_000251.2(MSH2):c.984C>T (p.Ala328=) rs4987189
NM_000251.2(MSH2):c.988C>A (p.Leu330Met) rs1553353157
NM_000251.2(MSH2):c.991A>G (p.Asn331Asp) rs267607938
NM_000251.2(MSH2):c.992A>G (p.Asn331Ser) rs779673318
NM_000251.2(MSH2):c.996G>A (p.Lys332=) rs863224343
NM_000251.2(MSH2):c.997T>C (p.Cys333Arg) rs63750468
NM_000251.2(MSH2):c.998G>A (p.Cys333Tyr) rs63750828
NM_000251.2(MSH2):c.998G>T (p.Cys333Phe)
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.