ClinVar Miner

List of variants in gene MSH6 reported as likely benign for Hereditary cancer-predisposing syndrome

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 754
Download table as spreadsheet
HGVS dbSNP
NM_000179.2(MSH6):c.*11T>C
NM_000179.2(MSH6):c.*11_*21dup
NM_000179.2(MSH6):c.*16_*35dup
NM_000179.2(MSH6):c.*2C>T
NM_000179.2(MSH6):c.*4_*6dupGAC rs1451012329
NM_000179.2(MSH6):c.*4_*7dupGACT rs765313977
NM_000179.2(MSH6):c.*8A>G
NM_000179.2(MSH6):c.-11C>T rs1225209597
NM_000179.2(MSH6):c.-12C>G rs766407370
NM_000179.2(MSH6):c.-14T>C rs1057520318
NM_000179.2(MSH6):c.-16C>T rs1064794403
NM_000179.2(MSH6):c.-17C>T rs370816858
NM_000179.2(MSH6):c.-18G>T rs199913053
NM_000179.2(MSH6):c.-19G>C rs761485894
NM_000179.2(MSH6):c.-20G>T rs1406816622
NM_000179.2(MSH6):c.-2G>T rs374748889
NM_000179.2(MSH6):c.-4C>T rs1114167784
NM_000179.2(MSH6):c.-6G>C rs730881822
NM_000179.2(MSH6):c.-6G>T rs730881822
NM_000179.2(MSH6):c.-8C>T rs565211544
NM_000179.2(MSH6):c.1019T>C (p.Phe340Ser) rs61753793
NM_000179.2(MSH6):c.102C>A (p.Ala34=) rs201132087
NM_000179.2(MSH6):c.102C>T (p.Ala34=) rs201132087
NM_000179.2(MSH6):c.1035T>C (p.Asn345=) rs765166082
NM_000179.2(MSH6):c.1037C>T (p.Ser346Phe) rs567785169
NM_000179.2(MSH6):c.1038T>C (p.Ser346=) rs1553412440
NM_000179.2(MSH6):c.1044C>T (p.Ser348=) rs587779202
NM_000179.2(MSH6):c.1047A>G (p.Gln349=) rs876659112
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.1053C>T (p.His351=) rs28903083
NM_000179.2(MSH6):c.1054G>A (p.Val352Ile) rs730881787
NM_000179.2(MSH6):c.105C>G (p.Ala35=)
NM_000179.2(MSH6):c.105C>T (p.Ala35=) rs998365223
NM_000179.2(MSH6):c.1062A>G (p.Gly354=) rs1333491667
NM_000179.2(MSH6):c.1063G>A (p.Gly355Ser) rs587778531
NM_000179.2(MSH6):c.1065T>C (p.Gly355=) rs984907158
NM_000179.2(MSH6):c.1068T>C (p.Gly356=) rs749752524
NM_000179.2(MSH6):c.1086T>C (p.Pro362=) rs1057520472
NM_000179.2(MSH6):c.108T>C (p.Ala36=) rs63750213
NM_000179.2(MSH6):c.1113A>G (p.Glu371=) rs786203202
NM_000179.2(MSH6):c.111C>T (p.Ala37=) rs1011670864
NM_000179.2(MSH6):c.1122G>A (p.Lys374=) rs786203929
NM_000179.2(MSH6):c.1132A>C (p.Arg378=) rs781572949
NM_000179.2(MSH6):c.1143G>A (p.Glu381=) rs1553412538
NM_000179.2(MSH6):c.1144C>T (p.His382Tyr) rs587779207
NM_000179.2(MSH6):c.1147A>C (p.Arg383=) rs780545039
NM_000179.2(MSH6):c.114C>T (p.Pro38=) rs786201700
NM_000179.2(MSH6):c.1153A>C (p.Arg385=) rs781652274
NM_000179.2(MSH6):c.115G>A (p.Gly39Arg) rs751838296
NM_000179.2(MSH6):c.115G>C (p.Gly39Arg) rs751838296
NM_000179.2(MSH6):c.1164C>T (p.His388=) rs55708305
NM_000179.2(MSH6):c.1167C>G (p.Pro389=) rs1042819
NM_000179.2(MSH6):c.1167C>T (p.Pro389=) rs1042819
NM_000179.2(MSH6):c.1170T>C (p.Asp390=) rs55882234
NM_000179.2(MSH6):c.1176T>C (p.Asp392=) rs587779912
NM_000179.2(MSH6):c.1179A>G (p.Ala393=) rs144961390
NM_000179.2(MSH6):c.1179A>T (p.Ala393=) rs144961390
NM_000179.2(MSH6):c.117G>A (p.Gly39=) rs756673077
NM_000179.2(MSH6):c.1185A>C (p.Thr395=) rs1159900857
NM_000179.2(MSH6):c.1185A>T (p.Thr395=) rs1159900857
NM_000179.2(MSH6):c.1188C>G (p.Leu396=) rs786202626
NM_000179.2(MSH6):c.1188C>T (p.Leu396=) rs786202626
NM_000179.2(MSH6):c.1191T>C (p.Tyr397=) rs786201269
NM_000179.2(MSH6):c.1194G>A (p.Val398=) rs148116863
NM_000179.2(MSH6):c.1200G>A (p.Glu400=) rs536884553
NM_000179.2(MSH6):c.1206C>T (p.Phe402=) rs779504190
NM_000179.2(MSH6):c.1209C>G (p.Leu403=) rs748603803
NM_000179.2(MSH6):c.1209C>T (p.Leu403=) rs748603803
NM_000179.2(MSH6):c.120C>G (p.Ala40=) rs777101467
NM_000179.2(MSH6):c.120C>T (p.Ala40=) rs777101467
NM_000179.2(MSH6):c.1224T>G (p.Pro408=) rs786203834
NM_000179.2(MSH6):c.1233G>A (p.Arg411=) rs554843104
NM_000179.2(MSH6):c.1236G>A (p.Lys412=) rs1553412665
NM_000179.2(MSH6):c.1245G>A (p.Gln415=) rs769418914
NM_000179.2(MSH6):c.124C>T (p.Pro42Ser) rs34014629
NM_000179.2(MSH6):c.1260C>T (p.Asn420=) rs1114167752
NM_000179.2(MSH6):c.1269T>G (p.Leu423=) rs774457540
NM_000179.2(MSH6):c.1272C>A (p.Val424=) rs63751452
NM_000179.2(MSH6):c.1275C>A (p.Ile425=) rs786203122
NM_000179.2(MSH6):c.1284G>A (p.Lys428=) rs767746584
NM_000179.2(MSH6):c.129C>T (p.Ser43=) rs1114167742
NM_000179.2(MSH6):c.12G>A (p.Gln4=)
NM_000179.2(MSH6):c.1303C>T (p.Leu435=) rs876660441
NM_000179.2(MSH6):c.1305G>T (p.Leu435=) rs786203803
NM_000179.2(MSH6):c.1311C>T (p.His437=)
NM_000179.2(MSH6):c.131C>T (p.Pro44Leu) rs863224615
NM_000179.2(MSH6):c.132A>C (p.Pro44=) rs1553408257
NM_000179.2(MSH6):c.1339C>T (p.Leu447=) rs369709529
NM_000179.2(MSH6):c.1347G>A (p.Leu449=) rs786201760
NM_000179.2(MSH6):c.135C>A (p.Gly45=) rs876659020
NM_000179.2(MSH6):c.1364A>C (p.Asn455Thr) rs200938360
NM_000179.2(MSH6):c.1371C>G (p.Ala457=) rs1349832206
NM_000179.2(MSH6):c.1386T>C (p.Pro462=) rs786202869
NM_000179.2(MSH6):c.1395A>T (p.Ala465=) rs1057520322
NM_000179.2(MSH6):c.1404T>C (p.Arg468=) rs1553412818
NM_000179.2(MSH6):c.1407T>C (p.Tyr469=) rs587781408
NM_000179.2(MSH6):c.1419G>C (p.Leu473=)
NM_000179.2(MSH6):c.1419G>T (p.Leu473=) rs864622535
NM_000179.2(MSH6):c.1434T>C (p.Tyr478=) rs1057521265
NM_000179.2(MSH6):c.1440A>T (p.Val480=) rs876661088
NM_000179.2(MSH6):c.1444C>A (p.Arg482=) rs63750909
NM_000179.2(MSH6):c.1446A>G (p.Arg482=) rs786202132
NM_000179.2(MSH6):c.1449G>T (p.Val483=) rs35590297
NM_000179.2(MSH6):c.1452A>G (p.Glu484=) rs776633437
NM_000179.2(MSH6):c.1474A>G (p.Met492Val) rs61754783
NM_000179.2(MSH6):c.147C>T (p.Ala49=) rs768803986
NM_000179.2(MSH6):c.1482A>G (p.Ala494=) rs786201736
NM_000179.2(MSH6):c.1483C>A (p.Arg495=) rs587779212
NM_000179.2(MSH6):c.148T>C (p.Trp50Arg) rs374597395
NM_000179.2(MSH6):c.1500A>T (p.Ala500=)
NM_000179.2(MSH6):c.1508C>G (p.Ser503Cys) rs63750897
NM_000179.2(MSH6):c.1509C>G (p.Ser503=) rs545020313
NM_000179.2(MSH6):c.1509C>T (p.Ser503=) rs545020313
NM_000179.2(MSH6):c.1518T>C (p.Asp506=)
NM_000179.2(MSH6):c.1524G>A (p.Val508=) rs878853705
NM_000179.2(MSH6):c.1524G>C (p.Val508=) rs878853705
NM_000179.2(MSH6):c.1526T>C (p.Val509Ala) rs63751005
NM_000179.2(MSH6):c.1530G>A (p.Arg510=) rs1060504758
NM_000179.2(MSH6):c.1539C>T (p.Ile513=) rs876660656
NM_000179.2(MSH6):c.1542T>C (p.Cys514=)
NM_000179.2(MSH6):c.1554C>T (p.Thr518=) rs786201471
NM_000179.2(MSH6):c.1560T>C (p.Gly520=) rs762396230
NM_000179.2(MSH6):c.1565A>G (p.Gln522Arg) rs63751009
NM_000179.2(MSH6):c.1569T>G (p.Thr523=) rs587779214
NM_000179.2(MSH6):c.1572C>T (p.Tyr524=) rs587779215
NM_000179.2(MSH6):c.1579C>T (p.Leu527=) rs1553412969
NM_000179.2(MSH6):c.1581G>A (p.Leu527=) rs775618855
NM_000179.2(MSH6):c.1584A>G (p.Glu528=) rs763342825
NM_000179.2(MSH6):c.1587T>G (p.Gly529=) rs764396869
NM_000179.2(MSH6):c.1593C>T (p.Pro531=)
NM_000179.2(MSH6):c.1611G>A (p.Lys537=) rs786203776
NM_000179.2(MSH6):c.161G>C (p.Gly54Ala) rs63751098
NM_000179.2(MSH6):c.1623C>T (p.Ser541=) rs777678406
NM_000179.2(MSH6):c.1656T>C (p.His552=) rs745937181
NM_000179.2(MSH6):c.1659T>C (p.Thr553=) rs769828338
NM_000179.2(MSH6):c.165T>G (p.Pro55=) rs1553408290
NM_000179.2(MSH6):c.1665A>G (p.Ala555=) rs146785465
NM_000179.2(MSH6):c.1668T>C (p.Tyr556=) rs730882130
NM_000179.2(MSH6):c.1674G>A (p.Val558=) rs762442338
NM_000179.2(MSH6):c.1677C>T (p.Cys559=) rs63749893
NM_000179.2(MSH6):c.168G>A (p.Gly56=) rs1553408296
NM_000179.2(MSH6):c.1698A>C (p.Gly566=) rs764818222
NM_000179.2(MSH6):c.1698A>G (p.Gly566=) rs764818222
NM_000179.2(MSH6):c.1713T>C (p.Gly571=) rs781019496
NM_000179.2(MSH6):c.1713T>G (p.Gly571=) rs781019496
NM_000179.2(MSH6):c.1716G>A (p.Gln572=) rs745772518
NM_000179.2(MSH6):c.172A>C (p.Arg58=) rs1553408313
NM_000179.2(MSH6):c.1740G>A (p.Ser580=) rs762089407
NM_000179.2(MSH6):c.1746T>G (p.Phe582Leu) rs201518545
NM_000179.2(MSH6):c.1752T>G (p.Thr584=) rs1114167777
NM_000179.2(MSH6):c.1770C>T (p.Pro590=) rs267608070
NM_000179.2(MSH6):c.1773A>G (p.Pro591=) rs752239740
NM_000179.2(MSH6):c.1776A>G (p.Val592=) rs56132616
NM_000179.2(MSH6):c.1776A>T (p.Val592=) rs56132616
NM_000179.2(MSH6):c.1785A>G (p.Leu595=) rs767325893
NM_000179.2(MSH6):c.178T>C (p.Leu60=) rs35819209
NM_000179.2(MSH6):c.178T>G (p.Leu60Val)
NM_000179.2(MSH6):c.1794A>G (p.Lys598=) rs786201210
NM_000179.2(MSH6):c.1800T>C (p.Asn600=) rs876660238
NM_000179.2(MSH6):c.1809G>A (p.Lys603=) rs876660790
NM_000179.2(MSH6):c.180G>A (p.Leu60=) rs1030492598
NM_000179.2(MSH6):c.1824T>C (p.Ile608=)
NM_000179.2(MSH6):c.1827A>G (p.Leu609=) rs767064953
NM_000179.2(MSH6):c.1827A>T (p.Leu609=) rs767064953
NM_000179.2(MSH6):c.182C>T (p.Ala61Val)
NM_000179.2(MSH6):c.1830G>A (p.Lys610=) rs201735525
NM_000179.2(MSH6):c.1837T>C (p.Leu613=) rs1057520323
NM_000179.2(MSH6):c.183G>A (p.Ala61=) rs1060504757
NM_000179.2(MSH6):c.1844G>C (p.Cys615Ser) rs730881793
NM_000179.2(MSH6):c.1847C>G (p.Ser616Cys) rs772363120
NM_000179.2(MSH6):c.184C>A (p.Arg62Ser) rs876659508
NM_000179.2(MSH6):c.1867C>G (p.Pro623Ala) rs3136334
NM_000179.2(MSH6):c.1869C>T (p.Pro623=) rs141242295
NM_000179.2(MSH6):c.1870G>A (p.Gly624Ser) rs868760377
NM_000179.2(MSH6):c.1875C>A (p.Ser625=) rs63749886
NM_000179.2(MSH6):c.1875C>T (p.Ser625=) rs63749886
NM_000179.2(MSH6):c.1878G>A (p.Gln626=) rs767285340
NM_000179.2(MSH6):c.187T>C (p.Ser63Pro) rs763702846
NM_000179.2(MSH6):c.1887T>C (p.Asp629=) rs876660921
NM_000179.2(MSH6):c.1899T>C (p.Thr633=) rs876658900
NM_000179.2(MSH6):c.189C>T (p.Ser63=) rs917331457
NM_000179.2(MSH6):c.1900T>C (p.Leu634=) rs876658471
NM_000179.2(MSH6):c.1908T>C (p.Thr636=) rs876658505
NM_000179.2(MSH6):c.1914T>C (p.Leu638=) rs766310490
NM_000179.2(MSH6):c.1917G>A (p.Glu639=) rs368059229
NM_000179.2(MSH6):c.192G>T (p.Ala64=) rs786203178
NM_000179.2(MSH6):c.1932G>A (p.Arg644=) rs34938432
NM_000179.2(MSH6):c.1932G>C (p.Arg644Ser) rs34938432
NM_000179.2(MSH6):c.1937A>G (p.Lys646Arg) rs201096652
NM_000179.2(MSH6):c.1938G>A (p.Lys646=) rs758631207
NM_000179.2(MSH6):c.1950C>G (p.Gly650=)
NM_000179.2(MSH6):c.1950C>T (p.Gly650=) rs747380250
NM_000179.2(MSH6):c.1974G>A (p.Val658=) rs372916347
NM_000179.2(MSH6):c.1983T>C (p.Gly661=) rs1411415960
NM_000179.2(MSH6):c.2013G>A (p.Leu671=) rs765289515
NM_000179.2(MSH6):c.2019A>G (p.Pro673=) rs863224327
NM_000179.2(MSH6):c.201C>G (p.Pro67=) rs1553408363
NM_000179.2(MSH6):c.2025G>A (p.Glu675=) rs587779223
NM_000179.2(MSH6):c.2027A>G (p.Lys676Arg) rs143643688
NM_000179.2(MSH6):c.2030G>C (p.Ser677Thr) rs587779224
NM_000179.2(MSH6):c.2035T>C (p.Leu679=) rs757741943
NM_000179.2(MSH6):c.2040C>T (p.Ala680=) rs746448428
NM_000179.2(MSH6):c.2046T>C (p.Ser682=)
NM_000179.2(MSH6):c.2049T>C (p.Ala683=) rs1553413418
NM_000179.2(MSH6):c.204G>A (p.Lys68=) rs864622565
NM_000179.2(MSH6):c.2052A>G (p.Leu684=) rs772874585
NM_000179.2(MSH6):c.2055T>C (p.Gly685=) rs760299985
NM_000179.2(MSH6):c.2070C>T (p.Tyr690=) rs559125434
NM_000179.2(MSH6):c.2073C>T (p.Leu691=) rs1553413445
NM_000179.2(MSH6):c.207G>A (p.Ala69=) rs757025193
NM_000179.2(MSH6):c.2101T>C (p.Leu701=) rs1057523503
NM_000179.2(MSH6):c.2103A>G (p.Leu701=) rs764244124
NM_000179.2(MSH6):c.2121A>G (p.Glu707=) rs1114167798
NM_000179.2(MSH6):c.2141C>G (p.Ser714Cys) rs730881796
NM_000179.2(MSH6):c.2142T>A (p.Ser714=)
NM_000179.2(MSH6):c.2142T>C (p.Ser714=) rs786201606
NM_000179.2(MSH6):c.2147C>T (p.Thr716Ile) rs587782805
NM_000179.2(MSH6):c.2154C>T (p.Ser718=) rs771662801
NM_000179.2(MSH6):c.2161A>C (p.Arg721=) rs537604099
NM_000179.2(MSH6):c.2169T>C (p.Gly723=) rs769422122
NM_000179.2(MSH6):c.2169T>G (p.Gly723=) rs769422122
NM_000179.2(MSH6):c.2171C>G (p.Ala724Gly) rs587779922
NM_000179.2(MSH6):c.2173A>G (p.Ile725Val) rs148898662
NM_000179.2(MSH6):c.2175C>G (p.Ile725Met) rs63750304
NM_000179.2(MSH6):c.2181C>G (p.Thr727=) rs876659171
NM_000179.2(MSH6):c.2187C>A (p.Ala729=) rs375610656
NM_000179.2(MSH6):c.2193A>G (p.Gln731=) rs1055190211
NM_000179.2(MSH6):c.2194C>A (p.Arg732=) rs63751127
NM_000179.2(MSH6):c.219C>T (p.Asn73=) rs1060504756
NM_000179.2(MSH6):c.21G>T (p.Leu7=) rs757815307
NM_000179.2(MSH6):c.2208T>C (p.Asp736=) rs1175313729
NM_000179.2(MSH6):c.2217A>G (p.Thr739=) rs876658887
NM_000179.2(MSH6):c.2223C>T (p.Asn741=) rs769668640
NM_000179.2(MSH6):c.2226C>T (p.Asn742=) rs587781739
NM_000179.2(MSH6):c.2239C>T (p.Leu747=) rs63751305
NM_000179.2(MSH6):c.2241G>A (p.Leu747=) rs377722465
NM_000179.2(MSH6):c.2241G>C (p.Leu747=) rs377722465
NM_000179.2(MSH6):c.2249C>A (p.Thr750Lys) rs730881817
NM_000179.2(MSH6):c.2256T>C (p.Gly752=) rs786202129
NM_000179.2(MSH6):c.225G>A (p.Gly75=) rs786202321
NM_000179.2(MSH6):c.2265A>G (p.Glu755=) rs1553413644
NM_000179.2(MSH6):c.2268A>C (p.Gly756=) rs142246608
NM_000179.2(MSH6):c.2268A>G (p.Gly756=) rs142246608
NM_000179.2(MSH6):c.2271C>G (p.Thr757=) rs142172006
NM_000179.2(MSH6):c.2271C>T (p.Thr757=) rs142172006
NM_000179.2(MSH6):c.2272C>T (p.Leu758=) rs56371757
NM_000179.2(MSH6):c.2283G>A (p.Arg761=) rs1057523842
NM_000179.2(MSH6):c.2289T>C (p.Asp763=) rs137946937
NM_000179.2(MSH6):c.2292T>C (p.Thr764=) rs1553413668
NM_000179.2(MSH6):c.2295C>T (p.Cys765=) rs63750985
NM_000179.2(MSH6):c.2304T>G (p.Pro768=) rs1553413685
NM_000179.2(MSH6):c.2307T>C (p.Phe769=) rs1276975746
NM_000179.2(MSH6):c.2314C>A (p.Arg772=) rs63750138
NM_000179.2(MSH6):c.2319C>T (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.231G>C (p.Arg77=)
NM_000179.2(MSH6):c.2322A>G (p.Leu774=) rs1057521386
NM_000179.2(MSH6):c.232A>C (p.Arg78=) rs1553408408
NM_000179.2(MSH6):c.2343A>C (p.Pro781=) rs965368508
NM_000179.2(MSH6):c.234A>G (p.Arg78=) rs1553408414
NM_000179.2(MSH6):c.2352C>T (p.Asn784=)
NM_000179.2(MSH6):c.2370T>C (p.Asp790=) rs876658909
NM_000179.2(MSH6):c.237G>C (p.Ser79=) rs1187291533
NM_000179.2(MSH6):c.2384T>C (p.Ile795Thr) rs202127474
NM_000179.2(MSH6):c.2391C>T (p.Asp797=) rs754870044
NM_000179.2(MSH6):c.2394C>A (p.Leu798=) rs1553413752
NM_000179.2(MSH6):c.2398G>C (p.Val800Leu) rs61748083
NM_000179.2(MSH6):c.2400T>C (p.Val800=) rs267608071
NM_000179.2(MSH6):c.2406T>A (p.Pro802=) rs1553413767
NM_000179.2(MSH6):c.240A>G (p.Val80=) rs864622281
NM_000179.2(MSH6):c.2413A>G (p.Ile805Val) rs928923556
NM_000179.2(MSH6):c.2415C>T (p.Ile805=) rs1219649543
NM_000179.2(MSH6):c.2418C>T (p.Ser806=) rs770992427
NM_000179.2(MSH6):c.241G>A (p.Ala81Thr) rs587779239
NM_000179.2(MSH6):c.2424T>G (p.Val808=) rs770208363
NM_000179.2(MSH6):c.242C>T (p.Ala81Val) rs587779924
NM_000179.2(MSH6):c.2436A>G (p.Leu812=) rs897288945
NM_000179.2(MSH6):c.243G>T (p.Ala81=) rs1057523564
NM_000179.2(MSH6):c.2445T>G (p.Leu815=) rs1114167764
NM_000179.2(MSH6):c.2454T>A (p.Leu818=) rs1553413809
NM_000179.2(MSH6):c.2466C>T (p.Leu822=)
NM_000179.2(MSH6):c.246T>C (p.Pro82=) rs786201527
NM_000179.2(MSH6):c.2479A>G (p.Asn827Asp) rs878853716
NM_000179.2(MSH6):c.2493C>T (p.Pro831=) rs778911612
NM_000179.2(MSH6):c.2499G>A (p.Lys833=)
NM_000179.2(MSH6):c.249T>G (p.Ala83=) rs876658308
NM_000179.2(MSH6):c.2508C>T (p.Asn836=) rs758170249
NM_000179.2(MSH6):c.2511C>T (p.His837=) rs587779925
NM_000179.2(MSH6):c.2517C>T (p.Asp839=) rs902748383
NM_000179.2(MSH6):c.251C>T (p.Ala84Val) rs878853717
NM_000179.2(MSH6):c.2520C>T (p.Ser840=) rs781241667
NM_000179.2(MSH6):c.2526T>G (p.Ala842=) rs772394197
NM_000179.2(MSH6):c.2547A>G (p.Thr849=) rs769018957
NM_000179.2(MSH6):c.2547A>T (p.Thr849=) rs769018957
NM_000179.2(MSH6):c.2550C>T (p.Tyr850=) rs374230313
NM_000179.2(MSH6):c.2559G>A (p.Lys853=) rs765873566
NM_000179.2(MSH6):c.255C>A (p.Pro85=) rs587779242
NM_000179.2(MSH6):c.255C>G (p.Pro85=) rs587779242
NM_000179.2(MSH6):c.257C>T (p.Thr86Ile) rs768444916
NM_000179.2(MSH6):c.2580T>C (p.Ser860=) rs751515279
NM_000179.2(MSH6):c.2584C>T (p.Leu862=) rs1187393388
NM_000179.2(MSH6):c.258C>G (p.Thr86=) rs1553408461
NM_000179.2(MSH6):c.260+10T>A rs193922342
NM_000179.2(MSH6):c.260+10T>G rs193922342
NM_000179.2(MSH6):c.260+15G>C rs1350493940
NM_000179.2(MSH6):c.260+15delG rs1553408495
NM_000179.2(MSH6):c.260+16T>G rs1450747755
NM_000179.2(MSH6):c.260+20G>T rs1270637949
NM_000179.2(MSH6):c.260+21T>G rs1465610983
NM_000179.2(MSH6):c.260+21_260+22delTCinsGG rs1553408502
NM_000179.2(MSH6):c.260+265G>A rs3136231
NM_000179.2(MSH6):c.260+279C>T rs869312601
NM_000179.2(MSH6):c.260+3_260+6delinsACC rs1553408478
NM_000179.2(MSH6):c.260+3_260+7delinsACCT rs1553408480
NM_000179.2(MSH6):c.260+4_260+13delinsCCT rs1553408483
NM_000179.2(MSH6):c.260+4_260+9delGCGGGGinsCC rs1553408482
NM_000179.2(MSH6):c.260+6_260+13delinsT rs1553408486
NM_000179.2(MSH6):c.260+6_260+7delinsCT rs1553408484
NM_000179.2(MSH6):c.260+7G>A rs774479750
NM_000179.2(MSH6):c.260+84T>G rs869312603
NM_000179.2(MSH6):c.2604G>A (p.Met868Ile) rs749508276
NM_000179.2(MSH6):c.261-14C>A rs369366445
NM_000179.2(MSH6):c.261-14C>T rs369366445
NM_000179.2(MSH6):c.261-15dup rs1553410187
NM_000179.2(MSH6):c.261-18A>G
NM_000179.2(MSH6):c.261-3611A>G rs528466684
NM_000179.2(MSH6):c.261-565C>T rs553631780
NM_000179.2(MSH6):c.2619G>A (p.Gly873=) rs1315876988
NM_000179.2(MSH6):c.2646T>C (p.Phe882=) rs1190330045
NM_000179.2(MSH6):c.2658C>T (p.Ile886=) rs786201051
NM_000179.2(MSH6):c.2661T>G (p.Leu887=) rs267608069
NM_000179.2(MSH6):c.2673C>T (p.Ile891=) rs146006741
NM_000179.2(MSH6):c.2676T>G (p.Ser892=) rs863224329
NM_000179.2(MSH6):c.2677C>T (p.Leu893=) rs370754319
NM_000179.2(MSH6):c.2682G>A (p.Gln894=) rs756239543
NM_000179.2(MSH6):c.2685A>G (p.Thr895=) rs749539614
NM_000179.2(MSH6):c.2685A>T (p.Thr895=) rs749539614
NM_000179.2(MSH6):c.2688A>G (p.Lys896=) rs876659173
NM_000179.2(MSH6):c.2694T>C (p.Pro898=) rs769668106
NM_000179.2(MSH6):c.2697A>G (p.Glu899=) rs1263132199
NM_000179.2(MSH6):c.2709T>C (p.Pro903=) rs879111473
NM_000179.2(MSH6):c.2713T>C (p.Leu905=) rs747486855
NM_000179.2(MSH6):c.2724A>G (p.Glu908=) rs35389622
NM_000179.2(MSH6):c.2725T>C (p.Leu909=) rs876659785
NM_000179.2(MSH6):c.2730C>T (p.Asn910=) rs773837927
NM_000179.2(MSH6):c.2731C>A (p.Arg911=) rs63751017
NM_000179.2(MSH6):c.2745C>G (p.Ala915=) rs876658904
NM_000179.2(MSH6):c.2751C>T (p.Asp917=) rs753967199
NM_000179.2(MSH6):c.2754T>C (p.His918=) rs1057521383
NM_000179.2(MSH6):c.2764C>A (p.Arg922=) rs587779246
NM_000179.2(MSH6):c.2775A>C (p.Gly925=) rs587779248
NM_000179.2(MSH6):c.2775A>G (p.Gly925=) rs587779248
NM_000179.2(MSH6):c.2780T>C (p.Ile927Thr) rs587779926
NM_000179.2(MSH6):c.2787C>G (p.Pro929=) rs768005323
NM_000179.2(MSH6):c.2796C>A (p.Gly932=) rs774105284
NM_000179.2(MSH6):c.2796C>T (p.Gly932=) rs774105284
NM_000179.2(MSH6):c.2808T>C (p.Asp936=) rs771925410
NM_000179.2(MSH6):c.2817A>G (p.Gln939=) rs1553414180
NM_000179.2(MSH6):c.2820T>A (p.Ala940=) rs878853722
NM_000179.2(MSH6):c.2838A>G (p.Glu946=) rs876660479
NM_000179.2(MSH6):c.2847G>A (p.Gln949=)
NM_000179.2(MSH6):c.2850C>T (p.Ser950=) rs571394629
NM_000179.2(MSH6):c.2853C>A (p.Leu951=) rs876658525
NM_000179.2(MSH6):c.2853C>G (p.Leu951=) rs876658525
NM_000179.2(MSH6):c.2857G>A (p.Glu953Lys) rs753034685
NM_000179.2(MSH6):c.2865A>G (p.Leu955=) rs758675720
NM_000179.2(MSH6):c.2877C>T (p.Arg959=) rs781734958
NM_000179.2(MSH6):c.2883A>G (p.Arg961=) rs1060504747
NM_000179.2(MSH6):c.2889C>T (p.Gly963=) rs771726914
NM_000179.2(MSH6):c.2892T>C (p.Cys964=) rs1482228994
NM_000179.2(MSH6):c.2904C>G (p.Val968=) rs150683226
NM_000179.2(MSH6):c.2907T>C (p.Tyr969=) rs1553414274
NM_000179.2(MSH6):c.2922G>A (p.Arg974=) rs1553414289
NM_000179.2(MSH6):c.2925C>T (p.Asn975=) rs139026662
NM_000179.2(MSH6):c.2934G>A (p.Gln978=) rs751780309
NM_000179.2(MSH6):c.2935C>T (p.Leu979=) rs1356451622
NM_000179.2(MSH6):c.2940A>G (p.Glu980=) rs730881818
NM_000179.2(MSH6):c.2943T>C (p.Ile981=) rs876661170
NM_000179.2(MSH6):c.2946T>G (p.Pro982=) rs751006944
NM_000179.2(MSH6):c.294C>G (p.Ala98=)
NM_000179.2(MSH6):c.2958C>A (p.Thr986=) rs757866392
NM_000179.2(MSH6):c.2958C>T (p.Thr986=) rs757866392
NM_000179.2(MSH6):c.2964C>A (p.Arg988=) rs144288981
NM_000179.2(MSH6):c.2964C>T (p.Arg988=) rs144288981
NM_000179.2(MSH6):c.2973A>G (p.Pro991=) rs1057521349
NM_000179.2(MSH6):c.2979A>G (p.Glu993=) rs370462886
NM_000179.2(MSH6):c.2982C>T (p.Tyr994=) rs367758473
NM_000179.2(MSH6):c.2986T>C (p.Leu996=) rs876658605
NM_000179.2(MSH6):c.2988G>A (p.Leu996=) rs1060504749
NM_000179.2(MSH6):c.2997C>G (p.Thr999=) rs751279827
NM_000179.2(MSH6):c.2997C>T (p.Thr999=) rs751279827
NM_000179.2(MSH6):c.3012A>G (p.Lys1004=) rs864622378
NM_000179.2(MSH6):c.3015A>G (p.Arg1005=) rs990650403
NM_000179.2(MSH6):c.3024C>T (p.Thr1008=) rs587780675
NM_000179.2(MSH6):c.303G>A (p.Glu101=) rs1057521533
NM_000179.2(MSH6):c.3048T>C (p.Ala1016=) rs1553414427
NM_000179.2(MSH6):c.3054C>A (p.Leu1018=) rs772191770
NM_000179.2(MSH6):c.3060T>C (p.Asn1020=) rs1553414441
NM_000179.2(MSH6):c.3066A>G (p.Glu1022=) rs766709747
NM_000179.2(MSH6):c.3069A>G (p.Glu1023=) rs876658356
NM_000179.2(MSH6):c.3072G>A (p.Arg1024=) rs878853728
NM_000179.2(MSH6):c.3079G>C (p.Val1027Leu) rs876658397
NM_000179.2(MSH6):c.3084A>T (p.Ser1028=) rs786201843
NM_000179.2(MSH6):c.3096C>T (p.Cys1032=) rs1553414502
NM_000179.2(MSH6):c.309C>T (p.Tyr103=) rs1553410230
NM_000179.2(MSH6):c.30C>T (p.Phe10=) rs786201869
NM_000179.2(MSH6):c.3106C>T (p.Leu1036=)
NM_000179.2(MSH6):c.3108G>C (p.Leu1036=)
NM_000179.2(MSH6):c.3111C>T (p.Phe1037=) rs587781673
NM_000179.2(MSH6):c.3117C>T (p.Asn1039=) rs1553414533
NM_000179.2(MSH6):c.312C>T (p.Pro104=)
NM_000179.2(MSH6):c.3144G>A (p.Gln1048=) rs1173733811
NM_000179.2(MSH6):c.3153A>G (p.Val1051=) rs1057521587
NM_000179.2(MSH6):c.3159T>C (p.Cys1053=) rs767021188
NM_000179.2(MSH6):c.3160A>T (p.Ile1054Phe) rs267608075
NM_000179.2(MSH6):c.3162C>T (p.Ile1054=) rs149605979
NM_000179.2(MSH6):c.3165A>G (p.Ala1055=) rs1553414590
NM_000179.2(MSH6):c.3168G>C (p.Val1056=) rs1553414594
NM_000179.2(MSH6):c.3172+14C>T rs762990595
NM_000179.2(MSH6):c.3172+15A>G
NM_000179.2(MSH6):c.3172+7C>T rs587780676
NM_000179.2(MSH6):c.3172+875A>C rs187192537
NM_000179.2(MSH6):c.3172+8T>G rs984296149
NM_000179.2(MSH6):c.3172+9_3172+10delTT rs878853730
NM_000179.2(MSH6):c.3173-10C>A rs587780559
NM_000179.2(MSH6):c.3173-10C>T rs587780559
NM_000179.2(MSH6):c.3173-10_3173-9delCT rs746607182
NM_000179.2(MSH6):c.3173-12C>G rs1057517629
NM_000179.2(MSH6):c.3173-12C>T rs1057517629
NM_000179.2(MSH6):c.3173-16C>T rs551949725
NM_000179.2(MSH6):c.3173-18T>A rs189672273
NM_000179.2(MSH6):c.3173-18T>C rs189672273
NM_000179.2(MSH6):c.3173-9_3173-6dup
NM_000179.2(MSH6):c.3183G>C (p.Leu1061=) rs786203197
NM_000179.2(MSH6):c.3183G>T (p.Leu1061=) rs786203197
NM_000179.2(MSH6):c.3186C>T (p.Cys1062=) rs1553331255
NM_000179.2(MSH6):c.3190G>A (p.Ala1064Thr) rs587782492
NM_000179.2(MSH6):c.3198T>C (p.Tyr1066=) rs199643502
NM_000179.2(MSH6):c.3202C>A (p.Arg1068=) rs63749843
NM_000179.2(MSH6):c.3203G>A (p.Arg1068Gln) rs398123230
NM_000179.2(MSH6):c.3207G>A (p.Gly1069=) rs267608074
NM_000179.2(MSH6):c.3207G>C (p.Gly1069=) rs267608074
NM_000179.2(MSH6):c.3213T>C (p.Asp1071=) rs534232216
NM_000179.2(MSH6):c.3217C>T (p.Pro1073Ser) rs142254875
NM_000179.2(MSH6):c.321T>C (p.Pro107=) rs730881823
NM_000179.2(MSH6):c.3228C>T (p.Arg1076=) rs786203698
NM_000179.2(MSH6):c.3231A>G (p.Pro1077=) rs1553331315
NM_000179.2(MSH6):c.3240G>A (p.Leu1080=) rs1114167739
NM_000179.2(MSH6):c.3243G>A (p.Leu1081=) rs1553331352
NM_000179.2(MSH6):c.3246G>A (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3246G>C (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3255C>A (p.Thr1085=) rs371568610
NM_000179.2(MSH6):c.3255C>G (p.Thr1085=) rs371568610
NM_000179.2(MSH6):c.3255C>T (p.Thr1085=) rs371568610
NM_000179.2(MSH6):c.3258C>A (p.Pro1086=) rs863224331
NM_000179.2(MSH6):c.3259C>G (p.Pro1087Ala) rs63750998
NM_000179.2(MSH6):c.3259C>T (p.Pro1087Ser) rs63750998
NM_000179.2(MSH6):c.325C>T (p.Leu109=)
NM_000179.2(MSH6):c.3261C>G (p.Pro1087=) rs370226185
NM_000179.2(MSH6):c.3261C>T (p.Pro1087=) rs370226185
NM_000179.2(MSH6):c.3264C>T (p.Phe1088=) rs35621414
NM_000179.2(MSH6):c.3265T>C (p.Leu1089=) rs34490141
NM_000179.2(MSH6):c.3279A>T (p.Gly1093=) rs876658155
NM_000179.2(MSH6):c.3282A>T (p.Ser1094=) rs372996269
NM_000179.2(MSH6):c.3285C>T (p.Arg1095=) rs786201168
NM_000179.2(MSH6):c.3294C>T (p.Cys1098=) rs766341781
NM_000179.2(MSH6):c.3300G>A (p.Thr1100=) rs540252208
NM_000179.2(MSH6):c.3300G>C (p.Thr1100=) rs540252208
NM_000179.2(MSH6):c.3306T>A (p.Thr1102=) rs2020910
NM_000179.2(MSH6):c.3324T>C (p.Phe1108=) rs864622081
NM_000179.2(MSH6):c.3327T>C (p.Ile1109=) rs878853733
NM_000179.2(MSH6):c.3334G>A (p.Asp1112Asn) rs773955368
NM_000179.2(MSH6):c.333C>T (p.Tyr111=) rs786202772
NM_000179.2(MSH6):c.3354G>A (p.Glu1118=) rs35642130
NM_000179.2(MSH6):c.3366G>A (p.Gln1122=) rs1553331644
NM_000179.2(MSH6):c.3375C>G (p.Gly1125=) rs765577023
NM_000179.2(MSH6):c.3381C>G (p.Ala1127=) rs786202480
NM_000179.2(MSH6):c.3384T>C (p.Tyr1128=) rs544518097
NM_000179.2(MSH6):c.3396T>A (p.Val1132=) rs1026907245
NM_000179.2(MSH6):c.3399T>C (p.Thr1133=) rs61748084
NM_000179.2(MSH6):c.339C>T (p.His113=) rs886056141
NM_000179.2(MSH6):c.33C>T (p.Phe11=)
NM_000179.2(MSH6):c.3420G>A (p.Lys1140=) rs754435507
NM_000179.2(MSH6):c.3426G>A (p.Thr1142=) rs747771350
NM_000179.2(MSH6):c.3429T>C (p.Leu1143=) rs562766087
NM_000179.2(MSH6):c.342C>T (p.Pro114=) rs1057520438
NM_000179.2(MSH6):c.3438+11C>T rs770801666
NM_000179.2(MSH6):c.3438+11_3438+14delCTTA rs377746844
NM_000179.2(MSH6):c.3438+13T>C rs1553331817
NM_000179.2(MSH6):c.3438+13dupT rs267608097
NM_000179.2(MSH6):c.3438+14_3438+18del
NM_000179.2(MSH6):c.3438+14delAinsTT rs1064793191
NM_000179.2(MSH6):c.3438+17G>C rs759737239
NM_000179.2(MSH6):c.3438+6T>C rs370170322
NM_000179.2(MSH6):c.3438+9_3438+15del
NM_000179.2(MSH6):c.3439-10T>A rs730881819
NM_000179.2(MSH6):c.3439-15C>T
NM_000179.2(MSH6):c.3441T>G (p.Ala1147=) rs1389565996
NM_000179.2(MSH6):c.3456A>G (p.Val1152=) rs750998416
NM_000179.2(MSH6):c.3462C>A (p.Ala1154=) rs1553332163
NM_000179.2(MSH6):c.3477C>T (p.Tyr1159=) rs398123231
NM_000179.2(MSH6):c.3478G>A (p.Val1160Ile) rs376799914
NM_000179.2(MSH6):c.3480C>A (p.Val1160=) rs786201385
NM_000179.2(MSH6):c.3480C>G (p.Val1160=) rs786201385
NM_000179.2(MSH6):c.3483T>C (p.Pro1161=) rs757064383
NM_000179.2(MSH6):c.3495C>T (p.Cys1165=) rs780099145
NM_000179.2(MSH6):c.3504A>G (p.Thr1168=)
NM_000179.2(MSH6):c.3510T>C (p.Ile1170=) rs1001812170
NM_000179.2(MSH6):c.3513T>C (p.Asp1171=) rs63749834
NM_000179.2(MSH6):c.3525T>C (p.Thr1175=) rs1553332284
NM_000179.2(MSH6):c.3526A>C (p.Arg1176=) rs786203968
NM_000179.2(MSH6):c.3534T>A (p.Gly1178=) rs876658537
NM_000179.2(MSH6):c.3537C>G (p.Ala1179=) rs200120044
NM_000179.2(MSH6):c.3540A>C (p.Ser1180=) rs777096746
NM_000179.2(MSH6):c.354A>G (p.Thr118=) rs558590898
NM_000179.2(MSH6):c.3556+10T>C rs863224333
NM_000179.2(MSH6):c.3556+10T>G rs863224333
NM_000179.2(MSH6):c.3556+12G>C rs1295637189
NM_000179.2(MSH6):c.3556+12delG rs1553332326
NM_000179.2(MSH6):c.3556+17C>G rs1460878426
NM_000179.2(MSH6):c.3557-14T>G
NM_000179.2(MSH6):c.3557-17A>G rs542542093
NM_000179.2(MSH6):c.3557-17A>T rs542542093
NM_000179.2(MSH6):c.3557-17delA rs778393939
NM_000179.2(MSH6):c.3557-19T>C rs1553332569
NM_000179.2(MSH6):c.3557-20G>C
NM_000179.2(MSH6):c.3557-3A>T rs41295274
NM_000179.2(MSH6):c.3557-40T>A rs189436849
NM_000179.2(MSH6):c.3557-4delT rs267608102
NM_000179.2(MSH6):c.3557-4dupT rs267608102
NM_000179.2(MSH6):c.3558T>C (p.Gly1186=) rs756014227
NM_000179.2(MSH6):c.3561A>G (p.Glu1187=) rs1553332629
NM_000179.2(MSH6):c.3579A>G (p.Glu1193=) rs1060504759
NM_000179.2(MSH6):c.3580T>C (p.Leu1194=) rs1114167787
NM_000179.2(MSH6):c.359T>C (p.Ile120Thr) rs775971872
NM_000179.2(MSH6):c.3605T>C (p.Met1202Thr) rs587779273
NM_000179.2(MSH6):c.3615A>G (p.Thr1205=) rs876660407
NM_000179.2(MSH6):c.3618A>G (p.Ala1206=) rs786202172
NM_000179.2(MSH6):c.3625C>T (p.Leu1209=) rs753675331
NM_000179.2(MSH6):c.363C>T (p.Arg121=) rs587779276
NM_000179.2(MSH6):c.3642A>G (p.Glu1214=) rs765247025
NM_000179.2(MSH6):c.3645A>G (p.Leu1215=) rs267608113
NM_000179.2(MSH6):c.3646+10T>A rs1057520325
NM_000179.2(MSH6):c.3646+11A>G rs1553332780
NM_000179.2(MSH6):c.3646+16_3646+82del
NM_000179.2(MSH6):c.3646+17C>T rs1553332786
NM_000179.2(MSH6):c.3646+19C>T rs370746787
NM_000179.2(MSH6):c.3647-20T>C
NM_000179.2(MSH6):c.3647-6T>A rs182871847
NM_000179.2(MSH6):c.3647-6T>C rs182871847
NM_000179.2(MSH6):c.3647-7T>G rs780269667
NM_000179.2(MSH6):c.3647-9_3647-5dup
NM_000179.2(MSH6):c.364G>A (p.Glu122Lys) rs143036974
NM_000179.2(MSH6):c.3663A>G (p.Thr1221=) rs876660304
NM_000179.2(MSH6):c.366G>A (p.Glu122=) rs774303198
NM_000179.2(MSH6):c.3675G>A (p.Thr1225=) rs730881820
NM_000179.2(MSH6):c.3693T>C (p.Val1231=) rs1553333012
NM_000179.2(MSH6):c.3699A>G (p.Lys1233=) rs876660565
NM_000179.2(MSH6):c.36C>G (p.Pro12=) rs760533525
NM_000179.2(MSH6):c.3705T>C (p.Leu1235=) rs545552712
NM_000179.2(MSH6):c.3711G>A (p.Glu1237=) rs754289472
NM_000179.2(MSH6):c.3714T>G (p.Thr1238=) rs779615974
NM_000179.2(MSH6):c.3720A>G (p.Lys1240=) rs786203260
NM_000179.2(MSH6):c.3723T>C (p.Cys1241=)
NM_000179.2(MSH6):c.3729A>G (p.Thr1243=) rs773807182
NM_000179.2(MSH6):c.3732A>G (p.Leu1244=)
NM_000179.2(MSH6):c.3747C>T (p.Tyr1249=) rs1057520326
NM_000179.2(MSH6):c.3754T>C (p.Leu1252=) rs1415810815
NM_000179.2(MSH6):c.3759A>T (p.Val1253=) rs1553333115
NM_000179.2(MSH6):c.3762A>T (p.Glu1254Asp) rs375459388
NM_000179.2(MSH6):c.3786G>A (p.Val1262=) rs760771483
NM_000179.2(MSH6):c.3790C>T (p.Leu1264=) rs786202696
NM_000179.2(MSH6):c.3792A>C (p.Leu1264=) rs786202051
NM_000179.2(MSH6):c.3792A>G (p.Leu1264=) rs786202051
NM_000179.2(MSH6):c.3795A>G (p.Gly1265=) rs786202166
NM_000179.2(MSH6):c.3801+12_3801+39dup rs1553333219
NM_000179.2(MSH6):c.3801+14G>T rs755626529
NM_000179.2(MSH6):c.3801+14_3801+17dup rs758614117
NM_000179.2(MSH6):c.3801+15T>A rs779720344
NM_000179.2(MSH6):c.3801+15T>C rs779720344
NM_000179.2(MSH6):c.3801+17T>C rs3136365
NM_000179.2(MSH6):c.3801+19T>C rs778693654
NM_000179.2(MSH6):c.3801+21dup rs747031075
NM_000179.2(MSH6):c.3801+4T>C rs758830540
NM_000179.2(MSH6):c.3801+5G>A rs201080919
NM_000179.2(MSH6):c.3801+7G>C
NM_000179.2(MSH6):c.3801+8C>A rs864622734
NM_000179.2(MSH6):c.3802-16A>G rs1454019658
NM_000179.2(MSH6):c.3802-7_3802-4dup rs876661171
NM_000179.2(MSH6):c.3807C>T (p.Cys1269=) rs747924946
NM_000179.2(MSH6):c.381C>T (p.Val127=) rs863224334
NM_000179.2(MSH6):c.3843G>A (p.Glu1281=) rs864622384
NM_000179.2(MSH6):c.3852G>A (p.Thr1284=) rs2229018
NM_000179.2(MSH6):c.3852G>T (p.Thr1284=) rs2229018
NM_000179.2(MSH6):c.3855C>T (p.Phe1285=) rs1553333455
NM_000179.2(MSH6):c.3858C>G (p.Leu1286=) rs1553333468
NM_000179.2(MSH6):c.3861T>C (p.Tyr1287=) rs1060504739
NM_000179.2(MSH6):c.3870T>C (p.Ile1290=) rs1553333487
NM_000179.2(MSH6):c.3876A>C (p.Gly1292=)
NM_000179.2(MSH6):c.3879T>C (p.Ala1293=) rs752369374
NM_000179.2(MSH6):c.3891C>T (p.Ser1297=)
NM_000179.2(MSH6):c.38A>G (p.Lys13Arg) rs41294988
NM_000179.2(MSH6):c.3900T>C (p.Phe1300=) rs1060504751
NM_000179.2(MSH6):c.3909A>G (p.Ala1303=) rs757286252
NM_000179.2(MSH6):c.3911G>A (p.Arg1304Lys) rs34625968
NM_000179.2(MSH6):c.3912G>A (p.Arg1304=) rs786202333
NM_000179.2(MSH6):c.3915T>C (p.Leu1305=) rs1057522349
NM_000179.2(MSH6):c.3921T>C (p.Asn1307=) rs876659660
NM_000179.2(MSH6):c.3927A>G (p.Pro1309=)
NM_000179.2(MSH6):c.3927A>T (p.Pro1309=) rs1553333611
NM_000179.2(MSH6):c.3930G>A (p.Glu1310=)
NM_000179.2(MSH6):c.3936T>C (p.Val1312=) rs61753796
NM_000179.2(MSH6):c.393A>C (p.Val131=) rs752488540
NM_000179.2(MSH6):c.3942A>G (p.Gln1314=) rs768042560
NM_000179.2(MSH6):c.3948A>T (p.Gly1316=) rs786202126
NM_000179.2(MSH6):c.3960A>G (p.Ala1320=) rs373425206
NM_000179.2(MSH6):c.3986C>T (p.Ser1329Leu) rs199594809
NM_000179.2(MSH6):c.3988C>T (p.Leu1330=) rs768944975
NM_000179.2(MSH6):c.4001+10dupT rs730882138
NM_000179.2(MSH6):c.4001+11_4001+15dupAACTA rs587779302
NM_000179.2(MSH6):c.4001+11_4001+35delAACTATAATGGAATTATAACTAACT rs878853743
NM_000179.2(MSH6):c.4001+12_4001+15dupACTA rs267608132
NM_000179.2(MSH6):c.4001+15A>G rs202176821
NM_000179.2(MSH6):c.4001+15_4001+35dup
NM_000179.2(MSH6):c.4001+16T>C
NM_000179.2(MSH6):c.4001+19_4001+32delTGGAATTATAACTA
NM_000179.2(MSH6):c.4001+19_4001+32dup
NM_000179.2(MSH6):c.4001+21_4001+23delGAA rs1553333801
NM_000179.2(MSH6):c.4001+2_4001+5delTAAC rs267608132
NM_000179.2(MSH6):c.4001+4_4001+8dupACTAA rs587782853
NM_000179.2(MSH6):c.4002-10T>A rs545466048
NM_000179.2(MSH6):c.4002-14T>C rs587781041
NM_000179.2(MSH6):c.4002-14_4002-9delTTTTTA rs1553333934
NM_000179.2(MSH6):c.4002-16T>G rs1057520798
NM_000179.2(MSH6):c.4002-18T>G
NM_000179.2(MSH6):c.4002-19T>C rs730881821
NM_000179.2(MSH6):c.4002-20T>G rs370707739
NM_000179.2(MSH6):c.4002-4T>C rs370428032
NM_000179.2(MSH6):c.4002-8A>C rs778957100
NM_000179.2(MSH6):c.4002-9A>T rs755141440
NM_000179.2(MSH6):c.4008T>G (p.Val1336=) rs1553333982
NM_000179.2(MSH6):c.4014G>C (p.Leu1338=) rs61748086
NM_000179.2(MSH6):c.4026G>A (p.Arg1342=)
NM_000179.2(MSH6):c.4059G>A (p.Leu1353=) rs1553334048
NM_000179.2(MSH6):c.4062G>C (p.Leu1354=) rs863224335
NM_000179.2(MSH6):c.4062G>T (p.Leu1354=) rs863224335
NM_000179.2(MSH6):c.4065T>C (p.Thr1355=)
NM_000179.2(MSH6):c.4065_4066insTTGG (p.Ile1357Valfs) rs1553334057
NM_000179.2(MSH6):c.4068G>A (p.Leu1356=) rs192740549
NM_000179.2(MSH6):c.4068_4071dupGATT (p.Lys1358Aspfs) rs55740729
NM_000179.2(MSH6):c.4074G>A (p.Lys1358=) rs759392159
NM_000179.2(MSH6):c.408C>T (p.Asp136=) rs878853746
NM_000179.2(MSH6):c.417A>G (p.Thr139=) rs758390144
NM_000179.2(MSH6):c.423C>G (p.Gly141=) rs777587467
NM_000179.2(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000179.2(MSH6):c.432C>T (p.Ser144=) rs1046304919
NM_000179.2(MSH6):c.457+13A>G rs1800933
NM_000179.2(MSH6):c.457+19A>G rs866845682
NM_000179.2(MSH6):c.457+19_457+20delAT rs1491215647
NM_000179.2(MSH6):c.457+29_457+30del
NM_000179.2(MSH6):c.457+7G>C rs781280171
NM_000179.2(MSH6):c.458-1174T>C rs869312602
NM_000179.2(MSH6):c.458-14_458-11delACAT
NM_000179.2(MSH6):c.458-509G>A rs556222101
NM_000179.2(MSH6):c.458-518G>T rs869312600
NM_000179.2(MSH6):c.458-5delT rs587781955
NM_000179.2(MSH6):c.471G>A (p.Lys157=) rs786202690
NM_000179.2(MSH6):c.476C>T (p.Ala159Val) rs587778528
NM_000179.2(MSH6):c.483G>A (p.Lys161=) rs63751030
NM_000179.2(MSH6):c.486A>T (p.Gly162=) rs1553411402
NM_000179.2(MSH6):c.489T>A (p.Gly163=) rs745399921
NM_000179.2(MSH6):c.48G>C (p.Ala16=) rs1250671114
NM_000179.2(MSH6):c.491A>C (p.His164Pro) rs146469162
NM_000179.2(MSH6):c.495T>C (p.Phe165=) rs876659670
NM_000179.2(MSH6):c.503C>G (p.Ala168Gly) rs774162322
NM_000179.2(MSH6):c.504A>G (p.Ala168=) rs1057520319
NM_000179.2(MSH6):c.504A>T (p.Ala168=)
NM_000179.2(MSH6):c.513A>G (p.Glu171=) rs786201116
NM_000179.2(MSH6):c.532C>T (p.Arg178Cys) rs730881813
NM_000179.2(MSH6):c.537A>G (p.Ala179=)
NM_000179.2(MSH6):c.552T>C (p.Asn184=) rs786203679
NM_000179.2(MSH6):c.564T>C (p.Ile188=)
NM_000179.2(MSH6):c.577T>C (p.Leu193=) rs587779944
NM_000179.2(MSH6):c.57T>C (p.Asp19=) rs752794296
NM_000179.2(MSH6):c.597C>G (p.Pro199=) rs1553411498
NM_000179.2(MSH6):c.597C>T (p.Pro199=) rs1553411498
NM_000179.2(MSH6):c.59C>T (p.Ala20Val) rs63750664
NM_000179.2(MSH6):c.603G>A (p.Glu201=) rs587779314
NM_000179.2(MSH6):c.609A>G (p.Glu203=) rs536686679
NM_000179.2(MSH6):c.60C>G (p.Ala20=) rs878853749
NM_000179.2(MSH6):c.60C>T (p.Ala20=) rs878853749
NM_000179.2(MSH6):c.618A>G (p.Glu206=) rs758635514
NM_000179.2(MSH6):c.627+10G>A rs1346594345
NM_000179.2(MSH6):c.627+14A>G rs748977698
NM_000179.2(MSH6):c.627+16C>A rs1553411527
NM_000179.2(MSH6):c.627+17A>C rs768348101
NM_000179.2(MSH6):c.627+20C>T rs376929025
NM_000179.2(MSH6):c.627+267G>A rs772499816
NM_000179.2(MSH6):c.627+566T>G rs869312604
NM_000179.2(MSH6):c.627+9C>G rs373155872
NM_000179.2(MSH6):c.627+9C>T rs373155872
NM_000179.2(MSH6):c.628-10T>C rs779603037
NM_000179.2(MSH6):c.628-12C>T rs752105994
NM_000179.2(MSH6):c.628-13C>G rs538280815
NM_000179.2(MSH6):c.628-13C>T rs538280815
NM_000179.2(MSH6):c.628-17C>T rs369971640
NM_000179.2(MSH6):c.628-19C>T
NM_000179.2(MSH6):c.628-19_628-18delCT rs765266356
NM_000179.2(MSH6):c.628-7C>A rs373129248
NM_000179.2(MSH6):c.630A>T (p.Val210=) rs1553412038
NM_000179.2(MSH6):c.631G>A (p.Gly211Ser) rs786204153
NM_000179.2(MSH6):c.63C>G (p.Asn21Lys) rs876660097
NM_000179.2(MSH6):c.643G>A (p.Val215Ile) rs145959653
NM_000179.2(MSH6):c.657T>C (p.Ser219=) rs1460925251
NM_000179.2(MSH6):c.660A>C (p.Glu220Asp) rs1800938
NM_000179.2(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000179.2(MSH6):c.696G>A (p.Gln232=) rs777770119
NM_000179.2(MSH6):c.732A>G (p.Gln244=) rs774496371
NM_000179.2(MSH6):c.73G>T (p.Ala25Ser) rs267608026
NM_000179.2(MSH6):c.75C>T (p.Ala25=) rs1045981031
NM_000179.2(MSH6):c.78G>A (p.Arg26=) rs1395190094
NM_000179.2(MSH6):c.801A>C (p.Pro267=) rs1453889992
NM_000179.2(MSH6):c.816A>G (p.Glu272=) rs863224631
NM_000179.2(MSH6):c.81C>G (p.Ala27=) rs781496151
NM_000179.2(MSH6):c.846G>C (p.Val282=) rs573638836
NM_000179.2(MSH6):c.849G>A (p.Gly283=) rs1057520439
NM_000179.2(MSH6):c.852T>C (p.Asp284=) rs1057520320
NM_000179.2(MSH6):c.866G>A (p.Gly289Asp)
NM_000179.2(MSH6):c.866_867delGCinsAA (p.Gly289Glu) rs267608079
NM_000179.2(MSH6):c.867C>A (p.Gly289=) rs267608047
NM_000179.2(MSH6):c.869T>C (p.Leu290Pro) rs751309721
NM_000179.2(MSH6):c.873C>T (p.Asn291=) rs876660529
NM_000179.2(MSH6):c.87C>G (p.Arg29=) rs778354962
NM_000179.2(MSH6):c.884A>G (p.Lys295Arg) rs267608051
NM_000179.2(MSH6):c.897G>A (p.Lys299=) rs755878786
NM_000179.2(MSH6):c.903G>A (p.Lys301=) rs1553412337
NM_000179.2(MSH6):c.905G>A (p.Arg302Lys) rs587781510
NM_000179.2(MSH6):c.90A>G (p.Glu30=) rs1060504760
NM_000179.2(MSH6):c.921T>C (p.Asn307=) rs876659492
NM_000179.2(MSH6):c.926C>G (p.Ser309Cys) rs544222338
NM_000179.2(MSH6):c.927T>C (p.Ser309=) rs771288794
NM_000179.2(MSH6):c.930T>G (p.Leu310=) rs1456412042
NM_000179.2(MSH6):c.942C>G (p.Ser314Arg) rs150440246
NM_000179.2(MSH6):c.942C>T (p.Ser314=) rs150440246
NM_000179.2(MSH6):c.945T>G (p.Ser315=) rs761581941
NM_000179.2(MSH6):c.956C>T (p.Thr319Met) rs188252826
NM_000179.2(MSH6):c.957G>A (p.Thr319=) rs375210430
NM_000179.2(MSH6):c.957G>C (p.Thr319=) rs375210430
NM_000179.2(MSH6):c.960C>G (p.Pro320=)
NM_000179.2(MSH6):c.960C>T (p.Pro320=) rs575325950
NM_000179.2(MSH6):c.972A>G (p.Lys324=) rs876658610
NM_000179.2(MSH6):c.984C>T (p.Ser328=) rs138143769
NM_000179.2(MSH6):c.9A>G (p.Arg3=) rs1553408080
NM_000179.2:c.4071_4072insGATTGATT

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.