ClinVar Miner

List of variants in gene MSH6 reported as uncertain significance for not specified

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 224
Download table as spreadsheet
HGVS dbSNP
NM_000179.2(MSH6):c.-2G>T rs374748889
NM_000179.2(MSH6):c.-8C>T rs565211544
NM_000179.2(MSH6):c.-9G>A
NM_000179.2(MSH6):c.1001A>C (p.Lys334Thr)
NM_000179.2(MSH6):c.1019T>C (p.Phe340Ser) rs61753793
NM_000179.2(MSH6):c.1037C>T (p.Ser346Phe) rs567785169
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.105C>T (p.Ala35=) rs998365223
NM_000179.2(MSH6):c.1078A>G (p.Ser360Gly) rs145994565
NM_000179.2(MSH6):c.1109T>C (p.Leu370Ser) rs587779204
NM_000179.2(MSH6):c.1120_1122delAAG (p.Lys374del) rs587781660
NM_000179.2(MSH6):c.115G>C (p.Gly39Arg) rs751838296
NM_000179.2(MSH6):c.1168G>A (p.Asp390Asn) rs147737737
NM_000179.2(MSH6):c.1170T>C (p.Asp390=) rs55882234
NM_000179.2(MSH6):c.1178C>T (p.Ala393Val)
NM_000179.2(MSH6):c.117G>A (p.Gly39=) rs756673077
NM_000179.2(MSH6):c.118G>A (p.Ala40Thr) rs754231971
NM_000179.2(MSH6):c.1190A>G (p.Tyr397Cys) rs63750065
NM_000179.2(MSH6):c.1214C>G (p.Ser405Cys) rs730881790
NM_000179.2(MSH6):c.1281C>T (p.Tyr427=) rs1553412720
NM_000179.2(MSH6):c.1295T>C (p.Phe432Ser) rs750528093
NM_000179.2(MSH6):c.1395A>G (p.Ala465=)
NM_000179.2(MSH6):c.1402C>T (p.Arg468Cys) rs369456858
NM_000179.2(MSH6):c.1403G>A (p.Arg468His) rs41295268
NM_000179.2(MSH6):c.1474A>G (p.Met492Val) rs61754783
NM_000179.2(MSH6):c.1498G>A (p.Ala500Thr) rs786204127
NM_000179.2(MSH6):c.1526T>C (p.Val509Ala) rs63751005
NM_000179.2(MSH6):c.1561A>C (p.Thr521Pro)
NM_000179.2(MSH6):c.1599G>C (p.Glu533Asp) rs373726731
NM_000179.2(MSH6):c.1646C>A (p.Ser549Tyr) rs200447622
NM_000179.2(MSH6):c.1661G>A (p.Arg554His) rs730881791
NM_000179.2(MSH6):c.1669G>A (p.Gly557Ser) rs1553413048
NM_000179.2(MSH6):c.1729C>G (p.Arg577Gly) rs542838372
NM_000179.2(MSH6):c.1750A>C (p.Thr584Pro) rs1553413123
NM_000179.2(MSH6):c.1757T>C (p.Val586Ala) rs730881792
NM_000179.2(MSH6):c.1793A>G (p.Lys598Arg) rs587779919
NM_000179.2(MSH6):c.184C>T (p.Arg62Cys) rs876659508
NM_000179.2(MSH6):c.1867C>G (p.Pro623Ala) rs3136334
NM_000179.2(MSH6):c.1870G>A (p.Gly624Ser) rs868760377
NM_000179.2(MSH6):c.187T>C (p.Ser63Pro) rs763702846
NM_000179.2(MSH6):c.1885G>T (p.Asp629Tyr) rs1064795030
NM_000179.2(MSH6):c.1894A>G (p.Lys632Glu) rs755847154
NM_000179.2(MSH6):c.1915G>A (p.Glu639Lys) rs143517321
NM_000179.2(MSH6):c.1978A>C (p.Lys660Gln) rs1060502894
NM_000179.2(MSH6):c.2006T>C (p.Ile669Thr) rs555209664
NM_000179.2(MSH6):c.2030G>C (p.Ser677Thr) rs587779224
NM_000179.2(MSH6):c.2053G>C (p.Gly685Arg) rs1553413427
NM_000179.2(MSH6):c.2057G>A (p.Gly686Asp) rs587779227
NM_000179.2(MSH6):c.2061T>G (p.Cys687Trp) rs267608068
NM_000179.2(MSH6):c.2173A>G (p.Ile725Val) rs148898662
NM_000179.2(MSH6):c.2183A>C (p.Lys728Thr) rs35552856
NM_000179.2(MSH6):c.2272C>G (p.Leu758Val) rs56371757
NM_000179.2(MSH6):c.2281A>G (p.Arg761Gly) rs199876321
NM_000179.2(MSH6):c.2300C>G (p.Thr767Ser) rs587781462
NM_000179.2(MSH6):c.2300C>T (p.Thr767Ile) rs587781462
NM_000179.2(MSH6):c.2341C>A (p.Pro781Thr) rs587779235
NM_000179.2(MSH6):c.2342C>T (p.Pro781Leu) rs1553413710
NM_000179.2(MSH6):c.2384T>C (p.Ile795Thr) rs202127474
NM_000179.2(MSH6):c.2398G>C (p.Val800Leu) rs61748083
NM_000179.2(MSH6):c.2408A>G (p.Asp803Gly) rs63751450
NM_000179.2(MSH6):c.2410A>G (p.Lys804Glu) rs1064793552
NM_000179.2(MSH6):c.2419G>A (p.Glu807Lys) rs587779923
NM_000179.2(MSH6):c.241G>A (p.Ala81Thr) rs587779239
NM_000179.2(MSH6):c.2561A>T (p.Lys854Met) rs34374438
NM_000179.2(MSH6):c.2561_2562delAG (p.Lys854Asnfs) rs876660999
NM_000179.2(MSH6):c.2561_2563delAGA (p.Lys854del) rs587782858
NM_000179.2(MSH6):c.2597A>C (p.Lys866Thr) rs190075874
NM_000179.2(MSH6):c.2641delGinsAAAA (p.Gly881delinsLysSer) rs63751408
NM_000179.2(MSH6):c.2664G>C (p.Lys888Asn) rs730881798
NM_000179.2(MSH6):c.2667G>T (p.Gln889His) rs149945495
NM_000179.2(MSH6):c.2668G>T (p.Val890Phe) rs786202628
NM_000179.2(MSH6):c.2677C>G (p.Leu893Val) rs370754319
NM_000179.2(MSH6):c.267C>T (p.Asp89=) rs762818044
NM_000179.2(MSH6):c.2725T>C (p.Leu909=) rs876659785
NM_000179.2(MSH6):c.2762C>T (p.Ala921Val) rs1060502936
NM_000179.2(MSH6):c.2780T>C (p.Ile927Thr) rs587779926
NM_000179.2(MSH6):c.2830A>G (p.Ile944Val) rs878853723
NM_000179.2(MSH6):c.2855T>C (p.Leu952Pro) rs587781743
NM_000179.2(MSH6):c.2857G>A (p.Glu953Lys) rs753034685
NM_000179.2(MSH6):c.2872C>G (p.Gln958Glu) rs1553414236
NM_000179.2(MSH6):c.2876G>A (p.Arg959His) rs757653982
NM_000179.2(MSH6):c.2899A>G (p.Ile967Val) rs876661067
NM_000179.2(MSH6):c.2905T>C (p.Tyr969His) rs1348956744
NM_000179.2(MSH6):c.2927G>A (p.Arg976His) rs63751113
NM_000179.2(MSH6):c.2936T>C (p.Leu979Pro) rs1218426245
NM_000179.2(MSH6):c.2956A>G (p.Thr986Ala) rs1553414327
NM_000179.2(MSH6):c.2959A>G (p.Thr987Ala) rs746631156
NM_000179.2(MSH6):c.2964C>A (p.Arg988=) rs144288981
NM_000179.2(MSH6):c.2979A>T (p.Glu993Asp) rs370462886
NM_000179.2(MSH6):c.2989A>G (p.Lys997Glu) rs1064794943
NM_000179.2(MSH6):c.3024C>T (p.Thr1008=) rs587780675
NM_000179.2(MSH6):c.3047C>T (p.Ala1016Val) rs587779929
NM_000179.2(MSH6):c.3062C>G (p.Ala1021Gly) rs63750287
NM_000179.2(MSH6):c.3071G>A (p.Arg1024Gln) rs372705506
NM_000179.2(MSH6):c.3079G>C (p.Val1027Leu) rs876658397
NM_000179.2(MSH6):c.3097A>G (p.Met1033Val) rs1553414508
NM_000179.2(MSH6):c.3172G>C (p.Asp1058His) rs863225404
NM_000179.2(MSH6):c.3173-10C>T rs587780559
NM_000179.2(MSH6):c.3173-3C>G rs1060502944
NM_000179.2(MSH6):c.3203G>A (p.Arg1068Gln) rs398123230
NM_000179.2(MSH6):c.3217C>T (p.Pro1073Ser) rs142254875
NM_000179.2(MSH6):c.3227G>A (p.Arg1076His) rs779617676
NM_000179.2(MSH6):c.3232G>C (p.Val1078Leu) rs587779932
NM_000179.2(MSH6):c.3233T>C (p.Val1078Ala) rs376452612
NM_000179.2(MSH6):c.3242T>G (p.Leu1081Trp) rs1553331349
NM_000179.2(MSH6):c.3245C>T (p.Pro1082Leu) rs191109849
NM_000179.2(MSH6):c.3246G>A (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3253A>T (p.Thr1085Ser)
NM_000179.2(MSH6):c.3259C>T (p.Pro1087Ser) rs63750998
NM_000179.2(MSH6):c.3260C>A (p.Pro1087His) rs63750753
NM_000179.2(MSH6):c.3260C>G (p.Pro1087Arg) rs63750753
NM_000179.2(MSH6):c.3284G>A (p.Arg1095His) rs63750253
NM_000179.2(MSH6):c.3299C>T (p.Thr1100Met) rs63750442
NM_000179.2(MSH6):c.3334G>A (p.Asp1112Asn) rs773955368
NM_000179.2(MSH6):c.335A>G (p.Asn112Ser) rs587779934
NM_000179.2(MSH6):c.336C>A (p.Asn112Lys) rs1182444882
NM_000179.2(MSH6):c.3399T>C (p.Thr1133=) rs61748084
NM_000179.2(MSH6):c.3425C>T (p.Thr1142Met) rs267608089
NM_000179.2(MSH6):c.3438+16A>G
NM_000179.2(MSH6):c.3439-10T>A rs730881819
NM_000179.2(MSH6):c.3469G>A (p.Gly1157Ser) rs587779264
NM_000179.2(MSH6):c.3478G>A (p.Val1160Ile) rs376799914
NM_000179.2(MSH6):c.3478G>T (p.Val1160Phe) rs376799914
NM_000179.2(MSH6):c.3488A>T (p.Glu1163Val) rs63750252
NM_000179.2(MSH6):c.3527G>A (p.Arg1176Lys) rs876661148
NM_000179.2(MSH6):c.3548T>A (p.Ile1183Lys) rs1459635476
NM_000179.2(MSH6):c.3557G>A (p.Gly1186Asp) rs587781690
NM_000179.2(MSH6):c.3567A>G (p.Thr1189=)
NM_000179.2(MSH6):c.35C>T (p.Pro12Leu)
NM_000179.2(MSH6):c.3600A>G (p.Ile1200Met) rs587781482
NM_000179.2(MSH6):c.3601C>G (p.Leu1201Val) rs182024561
NM_000179.2(MSH6):c.3604A>G (p.Met1202Val) rs369778514
NM_000179.2(MSH6):c.3604A>T (p.Met1202Leu) rs369778514
NM_000179.2(MSH6):c.3634G>A (p.Val1212Met) rs864622748
NM_000179.2(MSH6):c.3647-15A>C rs371171254
NM_000179.2(MSH6):c.3647-15A>G rs371171254
NM_000179.2(MSH6):c.3647-6T>A rs182871847
NM_000179.2(MSH6):c.3649A>G (p.Arg1217Gly) rs587780677
NM_000179.2(MSH6):c.3674C>T (p.Thr1225Met) rs63750370
NM_000179.2(MSH6):c.3675G>A (p.Thr1225=) rs730881820
NM_000179.2(MSH6):c.369A>T (p.Lys123Asn) rs587782106
NM_000179.2(MSH6):c.3724C>A (p.Arg1242Ser) rs587779285
NM_000179.2(MSH6):c.3727A>T (p.Thr1243Ser) rs147453999
NM_000179.2(MSH6):c.3729A>G (p.Thr1243=) rs773807182
NM_000179.2(MSH6):c.3740C>G (p.Thr1247Ser) rs786204182
NM_000179.2(MSH6):c.3744_3773del30 (p.His1248_Ser1257del) rs863225412
NM_000179.2(MSH6):c.3752C>T (p.Ser1251Leu)
NM_000179.2(MSH6):c.3758T>A (p.Val1253Glu) rs202066386
NM_000179.2(MSH6):c.3758T>C (p.Val1253Ala) rs202066386
NM_000179.2(MSH6):c.3762A>T (p.Glu1254Asp) rs375459388
NM_000179.2(MSH6):c.3772C>G (p.Gln1258Glu) rs63750554
NM_000179.2(MSH6):c.3786G>A (p.Val1262=) rs760771483
NM_000179.2(MSH6):c.3800T>C (p.Met1267Thr) rs148445930
NM_000179.2(MSH6):c.3801+4T>C rs758830540
NM_000179.2(MSH6):c.3809T>C (p.Met1270Thr) rs777617756
NM_000179.2(MSH6):c.3824G>A (p.Cys1275Tyr) rs150990541
NM_000179.2(MSH6):c.3843G>T (p.Glu1281Asp) rs864622384
NM_000179.2(MSH6):c.3845C>A (p.Thr1282Asn) rs876660361
NM_000179.2(MSH6):c.3851C>T (p.Thr1284Met) rs63750836
NM_000179.2(MSH6):c.3859T>C (p.Tyr1287His) rs1553333474
NM_000179.2(MSH6):c.3897C>G (p.Gly1299=)
NM_000179.2(MSH6):c.3911G>A (p.Arg1304Lys) rs34625968
NM_000179.2(MSH6):c.3930G>A (p.Glu1310=)
NM_000179.2(MSH6):c.3946G>A (p.Gly1316Arg) rs773675555
NM_000179.2(MSH6):c.3951T>C (p.His1317=) rs764786814
NM_000179.2(MSH6):c.3961A>G (p.Arg1321Gly) rs41295278
NM_000179.2(MSH6):c.3974_3976delAGA (p.Lys1325del) rs587779300
NM_000179.2(MSH6):c.3980A>G (p.Asn1327Ser) rs780187989
NM_000179.2(MSH6):c.3986C>T (p.Ser1329Leu) rs199594809
NM_000179.2(MSH6):c.4000C>T (p.Arg1334Trp) rs773763465
NM_000179.2(MSH6):c.4000_4001+17dup19 rs1064794929
NM_000179.2(MSH6):c.4001+11_4001+35delAACTATAATGGAATTATAACTAACT rs878853743
NM_000179.2(MSH6):c.4001+2_4001+5delTAAC rs267608132
NM_000179.2(MSH6):c.4001+4_4001+8dupACTAA rs587782853
NM_000179.2(MSH6):c.4001G>A (p.Arg1334Gln) rs267608122
NM_000179.2(MSH6):c.4002-10T>A rs545466048
NM_000179.2(MSH6):c.4002-11_4002-10del rs59056100
NM_000179.2(MSH6):c.4002-5_4010dupTTAAGGGAAGTTTG rs876661108
NM_000179.2(MSH6):c.4016_4017dupCT (p.Ser1340Leufs) rs876661127
NM_000179.2(MSH6):c.4039G>C (p.Ala1347Pro) rs730881809
NM_000179.2(MSH6):c.4051_4055dup (p.Lys1352Asnfs) rs1553334033
NM_000179.2(MSH6):c.4061_*23dup rs760782238
NM_000179.2(MSH6):c.4077_4080dupATTA (p.Ter1361Ilefs) rs575068534
NM_000179.2(MSH6):c.4082_*11delAGACTGACTACAT rs1064794082
NM_000179.2(MSH6):c.4083_*1insCTAT rs1064796051
NM_000179.2(MSH6):c.448C>T (p.Pro150Ser) rs587782406
NM_000179.2(MSH6):c.455C>A (p.Thr152Lys) rs1553410385
NM_000179.2(MSH6):c.457+2dupT rs876661224
NM_000179.2(MSH6):c.457+3A>G rs1060502921
NM_000179.2(MSH6):c.457+7G>C rs781280171
NM_000179.2(MSH6):c.491A>C (p.His164Pro) rs146469162
NM_000179.2(MSH6):c.503C>G (p.Ala168Gly) rs774162322
NM_000179.2(MSH6):c.513A>G (p.Glu171=) rs786201116
NM_000179.2(MSH6):c.527T>C (p.Met176Thr) rs1553411432
NM_000179.2(MSH6):c.530A>T (p.Gln177Leu) rs1553411434
NM_000179.2(MSH6):c.532C>T (p.Arg178Cys) rs730881813
NM_000179.2(MSH6):c.533G>A (p.Arg178His) rs786204186
NM_000179.2(MSH6):c.565_624del60 (p.Lys189_Met208del) rs1553411462
NM_000179.2(MSH6):c.59C>T (p.Ala20Val) rs63750664
NM_000179.2(MSH6):c.628-7C>A rs373129248
NM_000179.2(MSH6):c.643G>A (p.Val215Ile) rs145959653
NM_000179.2(MSH6):c.660A>C (p.Glu220Asp) rs1800938
NM_000179.2(MSH6):c.661_672delGAAGATAATGAA (p.Glu221_Glu224del) rs1553412079
NM_000179.2(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000179.2(MSH6):c.67G>A (p.Ala23Thr) rs730881810
NM_000179.2(MSH6):c.680G>A (p.Ser227Asn) rs587779317
NM_000179.2(MSH6):c.713C>A (p.Ser238Tyr) rs587782510
NM_000179.2(MSH6):c.719G>A (p.Arg240Gln) rs542848931
NM_000179.2(MSH6):c.725G>C (p.Ser242Thr) rs1060502925
NM_000179.2(MSH6):c.733A>T (p.Ile245Leu) rs762168786
NM_000179.2(MSH6):c.73G>T (p.Ala25Ser) rs267608026
NM_000179.2(MSH6):c.749T>C (p.Val250Ala) rs587781275
NM_000179.2(MSH6):c.753A>G (p.Ile251Met) rs587779321
NM_000179.2(MSH6):c.768T>C (p.Ser256=)
NM_000179.2(MSH6):c.818G>T (p.Gly273Val) rs769610487
NM_000179.2(MSH6):c.831A>C (p.Glu277Asp) rs374486449
NM_000179.2(MSH6):c.866_867delGCinsAA (p.Gly289Glu) rs267608079
NM_000179.2(MSH6):c.884A>G (p.Lys295Arg) rs267608051
NM_000179.2(MSH6):c.895A>G (p.Lys299Glu) rs1553412326
NM_000179.2(MSH6):c.905G>C (p.Arg302Thr) rs587781510
NM_000179.2(MSH6):c.926C>G (p.Ser309Cys) rs544222338
NM_000179.2(MSH6):c.936_941delGAAAAG (p.Arg312_Lys313del) rs1553412361
NM_000179.2(MSH6):c.945T>G (p.Ser315=) rs761581941
NM_000179.2(MSH6):c.956C>T (p.Thr319Met) rs188252826

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.