ClinVar Miner

List of variants in gene MSH6 reported by GeneDx

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 1071
Download table as spreadsheet
HGVS dbSNP
GRCh38/hg38 2p16.3(chr2:47663853-47785728)x1
NC_000002.12:g.47806445_47806448dup
NM_000179.2 (MSH6):c.3984_3987dupGTCA (p.Leu1330Valfs) rs267608121
NM_000179.2(MSH6):c.*10A>G rs757778351
NM_000179.2(MSH6):c.*17G>A rs876661000
NM_000179.2(MSH6):c.*4_*6dupGAC rs1451012329
NM_000179.2(MSH6):c.*9C>T rs371301277
NM_000179.2(MSH6):c.-12C>G rs766407370
NM_000179.2(MSH6):c.-14T>C rs1057520318
NM_000179.2(MSH6):c.-16C>A rs1064794403
NM_000179.2(MSH6):c.-17C>T rs370816858
NM_000179.2(MSH6):c.-18G>T rs199913053
NM_000179.2(MSH6):c.-19G>C rs761485894
NM_000179.2(MSH6):c.-1T>C rs1057522403
NM_000179.2(MSH6):c.-24G>A rs876661137
NM_000179.2(MSH6):c.-25C>T rs1064793670
NM_000179.2(MSH6):c.-26A>G rs773995995
NM_000179.2(MSH6):c.-28G>C rs1057522699
NM_000179.2(MSH6):c.-2G>T rs374748889
NM_000179.2(MSH6):c.-34C>G rs771435695
NM_000179.2(MSH6):c.-34C>T rs771435695
NM_000179.2(MSH6):c.-37C>A rs747521149
NM_000179.2(MSH6):c.-38C>G rs185538282
NM_000179.2(MSH6):c.-44G>T rs1064793549
NM_000179.2(MSH6):c.-45A>G rs1057520317
NM_000179.2(MSH6):c.-45A>T rs1057520317
NM_000179.2(MSH6):c.-46T>G rs748339592
NM_000179.2(MSH6):c.-47T>C rs1057521187
NM_000179.2(MSH6):c.-48T>A rs964962194
NM_000179.2(MSH6):c.-50C>G rs755310531
NM_000179.2(MSH6):c.-6G>T rs730881822
NM_000179.2(MSH6):c.-7T>A rs1057523142
NM_000179.2(MSH6):c.-8C>T rs565211544
NM_000179.2(MSH6):c.-9_-2dup rs760027265
NM_000179.2(MSH6):c.1005T>C (p.Asn335=) rs767011067
NM_000179.2(MSH6):c.100G>A (p.Ala34Thr) rs1553408194
NM_000179.2(MSH6):c.1019T>C (p.Phe340Ser) rs61753793
NM_000179.2(MSH6):c.1025C>T (p.Ala342Val) rs753617680
NM_000179.2(MSH6):c.1028C>G (p.Pro343Arg) rs548898238
NM_000179.2(MSH6):c.1028C>T (p.Pro343Leu) rs548898238
NM_000179.2(MSH6):c.1030C>G (p.Gln344Glu) rs730881815
NM_000179.2(MSH6):c.1035T>C (p.Asn345=) rs765166082
NM_000179.2(MSH6):c.1037C>G (p.Ser346Cys) rs567785169
NM_000179.2(MSH6):c.1037C>T (p.Ser346Phe) rs567785169
NM_000179.2(MSH6):c.1046A>G (p.Gln349Arg) rs869312797
NM_000179.2(MSH6):c.1049C>T (p.Ala350Val) rs587782331
NM_000179.2(MSH6):c.104C>T (p.Ala35Val) rs776547943
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.1051C>T (p.His351Tyr) rs587779911
NM_000179.2(MSH6):c.1052A>G (p.His351Arg) rs730881786
NM_000179.2(MSH6):c.1053C>T (p.His351=) rs28903083
NM_000179.2(MSH6):c.1054G>A (p.Val352Ile) rs730881787
NM_000179.2(MSH6):c.1059dup (p.Gly354fs) rs876658728
NM_000179.2(MSH6):c.1061G>T (p.Gly354Val) rs730881788
NM_000179.2(MSH6):c.1063G>A (p.Gly355Ser) rs587778531
NM_000179.2(MSH6):c.1065T>C (p.Gly355=) rs984907158
NM_000179.2(MSH6):c.1069G>A (p.Asp357Asn) rs771529531
NM_000179.2(MSH6):c.1069G>C (p.Asp357His) rs771529531
NM_000179.2(MSH6):c.1074C>T (p.Asp358=) rs760311819
NM_000179.2(MSH6):c.1078A>G (p.Ser360Gly) rs145994565
NM_000179.2(MSH6):c.107C>T (p.Ala36Val) rs61756469
NM_000179.2(MSH6):c.1082G>A (p.Arg361His) rs63750440
NM_000179.2(MSH6):c.1086T>C (p.Pro362=) rs1057520472
NM_000179.2(MSH6):c.1089T>C (p.Thr363=) rs1553412484
NM_000179.2(MSH6):c.10C>T (p.Gln4Ter) rs786201042
NM_000179.2(MSH6):c.1106C>T (p.Thr369Ile) rs375974046
NM_000179.2(MSH6):c.1109T>C (p.Leu370Ser) rs587779204
NM_000179.2(MSH6):c.111C>T (p.Ala37=) rs1011670864
NM_000179.2(MSH6):c.1120_1122del (p.Lys374del) rs587781660
NM_000179.2(MSH6):c.112C>T (p.Pro38Ser) rs764009461
NM_000179.2(MSH6):c.1130_1134AGAGA[1] (p.Arg378_Arg379insTer) rs267608077
NM_000179.2(MSH6):c.1132A>C (p.Arg378=) rs781572949
NM_000179.2(MSH6):c.1133G>A (p.Arg378Lys) rs587779205
NM_000179.2(MSH6):c.1138G>C (p.Asp380His) rs1064793521
NM_000179.2(MSH6):c.1144C>T (p.His382Tyr) rs587779207
NM_000179.2(MSH6):c.1151G>T (p.Arg384Met) rs730881789
NM_000179.2(MSH6):c.1155G>A (p.Arg385=) rs991563019
NM_000179.2(MSH6):c.115G>C (p.Gly39Arg) rs751838296
NM_000179.2(MSH6):c.1162C>G (p.His388Asp) rs770386388
NM_000179.2(MSH6):c.1168G>A (p.Asp390Asn) rs147737737
NM_000179.2(MSH6):c.1168_1170delinsAA (p.Asp390fs) rs863225398
NM_000179.2(MSH6):c.116G>C (p.Gly39Ala) rs1042821
NM_000179.2(MSH6):c.1170T>C (p.Asp390=) rs55882234
NM_000179.2(MSH6):c.1175A>T (p.Asp392Val) rs1064794625
NM_000179.2(MSH6):c.1176T>A (p.Asp392Glu) rs587779912
NM_000179.2(MSH6):c.1176T>C (p.Asp392=) rs587779912
NM_000179.2(MSH6):c.117G>A (p.Gly39=) rs756673077
NM_000179.2(MSH6):c.1184C>T (p.Thr395Ile) rs767658494
NM_000179.2(MSH6):c.1186C>G (p.Leu396Val) rs2020908
NM_000179.2(MSH6):c.1188C>G (p.Leu396=) rs786202626
NM_000179.2(MSH6):c.1189T>C (p.Tyr397His) rs587779913
NM_000179.2(MSH6):c.1189dup (p.Tyr397fs) rs1553412609
NM_000179.2(MSH6):c.1190A>G (p.Tyr397Cys) rs63750065
NM_000179.2(MSH6):c.1190_1191del (p.Tyr397fs) rs63750439
NM_000179.2(MSH6):c.1191T>C (p.Tyr397=) rs786201269
NM_000179.2(MSH6):c.1198_1219delinsTCATC (p.Glu400fs) rs1064795790
NM_000179.2(MSH6):c.1200G>A (p.Glu400=) rs536884553
NM_000179.2(MSH6):c.1209C>G (p.Leu403=) rs748603803
NM_000179.2(MSH6):c.1209C>T (p.Leu403=) rs748603803
NM_000179.2(MSH6):c.1211A>G (p.Asn404Ser) rs768740986
NM_000179.2(MSH6):c.1214C>G (p.Ser405Cys) rs730881790
NM_000179.2(MSH6):c.1216T>G (p.Cys406Gly) rs1064794198
NM_000179.2(MSH6):c.1231A>T (p.Arg411Trp) rs202219685
NM_000179.2(MSH6):c.1233G>A (p.Arg411=) rs554843104
NM_000179.2(MSH6):c.1241G>A (p.Trp414Ter) rs587779914
NM_000179.2(MSH6):c.1243C>T (p.Gln415Ter) rs1114167756
NM_000179.2(MSH6):c.1245G>A (p.Gln415=) rs769418914
NM_000179.2(MSH6):c.124C>T (p.Pro42Ser) rs34014629
NM_000179.2(MSH6):c.1254T>G (p.Ser418=) rs576815110
NM_000179.2(MSH6):c.1255_1268del (p.Gln419fs) rs876661251
NM_000179.2(MSH6):c.1272C>T (p.Val424=) rs63751452
NM_000179.2(MSH6):c.1275C>A (p.Ile425=) rs786203122
NM_000179.2(MSH6):c.1284G>A (p.Lys428=) rs767746584
NM_000179.2(MSH6):c.1288G>A (p.Gly430Arg) rs587779915
NM_000179.2(MSH6):c.1295T>C (p.Phe432Ser) rs750528093
NM_000179.2(MSH6):c.1296T>G (p.Phe432Leu) rs863224614
NM_000179.2(MSH6):c.1299T>C (p.Tyr433=) rs267608055
NM_000179.2(MSH6):c.1304T>C (p.Leu435Pro) rs63751405
NM_000179.2(MSH6):c.1305G>C (p.Leu435=)
NM_000179.2(MSH6):c.1308C>T (p.Tyr436=) rs761037236
NM_000179.2(MSH6):c.1320T>G (p.Ala440=) rs1553412747
NM_000179.2(MSH6):c.1325T>C (p.Ile442Thr) rs587779210
NM_000179.2(MSH6):c.1339C>T (p.Leu447=) rs369709529
NM_000179.2(MSH6):c.1345C>T (p.Leu449=) rs3136333
NM_000179.2(MSH6):c.1347G>A (p.Leu449=) rs786201760
NM_000179.2(MSH6):c.1349T>C (p.Val450Ala) rs1064794705
NM_000179.2(MSH6):c.1352del (p.Phe451fs) rs869312769
NM_000179.2(MSH6):c.1355T>C (p.Met452Thr) rs1064793364
NM_000179.2(MSH6):c.1364A>C (p.Asn455Thr) rs200938360
NM_000179.2(MSH6):c.1365C>G (p.Asn455Lys) rs1064793186
NM_000179.2(MSH6):c.1367G>A (p.Trp456Ter) rs587780538
NM_000179.2(MSH6):c.136G>A (p.Gly46Arg) rs863224616
NM_000179.2(MSH6):c.1376C>G (p.Ser459Cys) rs587782346
NM_000179.2(MSH6):c.1382T>G (p.Phe461Cys) rs1064793187
NM_000179.2(MSH6):c.1395A>T (p.Ala465=) rs1057520322
NM_000179.2(MSH6):c.1402C>T (p.Arg468Cys) rs369456858
NM_000179.2(MSH6):c.1403G>C (p.Arg468Pro) rs41295268
NM_000179.2(MSH6):c.1406A>G (p.Tyr469Cys) rs748165218
NM_000179.2(MSH6):c.1407T>C (p.Tyr469=) rs587781408
NM_000179.2(MSH6):c.1430dup (p.Tyr478fs) rs1114167746
NM_000179.2(MSH6):c.1434T>C (p.Tyr478=) rs1057521265
NM_000179.2(MSH6):c.1440A>T (p.Val480=) rs876661088
NM_000179.2(MSH6):c.1444C>A (p.Arg482=) rs63750909
NM_000179.2(MSH6):c.1444C>G (p.Arg482Gly) rs63750909
NM_000179.2(MSH6):c.1444C>T (p.Arg482Ter) rs63750909
NM_000179.2(MSH6):c.1449G>T (p.Val483=) rs35590297
NM_000179.2(MSH6):c.1450G>C (p.Glu484Gln) rs587782706
NM_000179.2(MSH6):c.1452A>G (p.Glu484=) rs776633437
NM_000179.2(MSH6):c.1467A>G (p.Pro489=) rs1288566407
NM_000179.2(MSH6):c.1471_1473ATG[1] (p.Met492del) rs587782576
NM_000179.2(MSH6):c.1474A>G (p.Met492Val) rs61754783
NM_000179.2(MSH6):c.1483C>T (p.Arg495Ter) rs587779212
NM_000179.2(MSH6):c.1498G>A (p.Ala500Thr) rs786204127
NM_000179.2(MSH6):c.1498G>T (p.Ala500Ser) rs786204127
NM_000179.2(MSH6):c.1502_1511del (p.His501fs) rs876661044
NM_000179.2(MSH6):c.1505T>C (p.Ile502Thr) rs749012012
NM_000179.2(MSH6):c.1508C>G (p.Ser503Cys) rs63750897
NM_000179.2(MSH6):c.1509C>A (p.Ser503=) rs545020313
NM_000179.2(MSH6):c.1509C>T (p.Ser503=) rs545020313
NM_000179.2(MSH6):c.1524G>A (p.Val508=) rs878853705
NM_000179.2(MSH6):c.1524G>C (p.Val508=) rs878853705
NM_000179.2(MSH6):c.1525G>C (p.Val509Leu) rs876660317
NM_000179.2(MSH6):c.1526T>C (p.Val509Ala) rs63751005
NM_000179.2(MSH6):c.1538T>C (p.Ile513Thr) rs1060502908
NM_000179.2(MSH6):c.1539C>A (p.Ile513=) rs876660656
NM_000179.2(MSH6):c.1554C>G (p.Thr518=) rs786201471
NM_000179.2(MSH6):c.1554C>T (p.Thr518=) rs786201471
NM_000179.2(MSH6):c.1556A>G (p.Lys519Arg) rs1285168531
NM_000179.2(MSH6):c.1560T>C (p.Gly520=) rs762396230
NM_000179.2(MSH6):c.1561A>T (p.Thr521Ser) rs587779916
NM_000179.2(MSH6):c.1565A>G (p.Gln522Arg) rs63751009
NM_000179.2(MSH6):c.1571dup (p.Tyr524Ter) rs1553412966
NM_000179.2(MSH6):c.1572C>A (p.Tyr524Ter) rs587779215
NM_000179.2(MSH6):c.1572C>T (p.Tyr524=) rs587779215
NM_000179.2(MSH6):c.1576G>A (p.Val526Met) rs1060502899
NM_000179.2(MSH6):c.1596_1597del (p.Asn534fs) rs1064794388
NM_000179.2(MSH6):c.1599G>C (p.Glu533Asp) rs373726731
NM_000179.2(MSH6):c.159_164TGGGCC[3] (p.54_55GP[3]) rs767894453
NM_000179.2(MSH6):c.1602C>G (p.Asn534Lys) rs763712971
NM_000179.2(MSH6):c.1606_1609AGTA[1] (p.Lys537fs) rs771764652
NM_000179.2(MSH6):c.1615_1617CTT[1] (p.Leu540del) rs1064793600
NM_000179.2(MSH6):c.1618C>A (p.Leu540Ile) rs201996928
NM_000179.2(MSH6):c.1618C>G (p.Leu540Val) rs201996928
NM_000179.2(MSH6):c.1619_1620del (p.Leu540fs) rs1553413006
NM_000179.2(MSH6):c.161G>C (p.Gly54Ala) rs63751098
NM_000179.2(MSH6):c.1633A>G (p.Lys545Glu) rs1064793403
NM_000179.2(MSH6):c.1634_1635del (p.Lys545fs) rs267608064
NM_000179.2(MSH6):c.1634_1637del (p.Lys545fs) rs63749874
NM_000179.2(MSH6):c.1635_1636AG[1] (p.Glu546fs) rs267608076
NM_000179.2(MSH6):c.1637A>G (p.Glu546Gly) rs373554374
NM_000179.2(MSH6):c.1645del (p.Ser549fs) rs876661033
NM_000179.2(MSH6):c.1646C>A (p.Ser549Tyr) rs200447622
NM_000179.2(MSH6):c.1652G>A (p.Gly551Asp) rs587779917
NM_000179.2(MSH6):c.1655A>G (p.His552Arg) rs1064793423
NM_000179.2(MSH6):c.1661G>A (p.Arg554His) rs730881791
NM_000179.2(MSH6):c.1665A>G (p.Ala555=) rs146785465
NM_000179.2(MSH6):c.1667A>G (p.Tyr556Cys) rs63751312
NM_000179.2(MSH6):c.1668T>C (p.Tyr556=) rs730882130
NM_000179.2(MSH6):c.166_171dup (p.54_55GP[3]) rs786201776
NM_000179.2(MSH6):c.1674G>A (p.Val558=) rs762442338
NM_000179.2(MSH6):c.1676G>A (p.Cys559Tyr) rs63750595
NM_000179.2(MSH6):c.1677C>T (p.Cys559=) rs63749893
NM_000179.2(MSH6):c.1690T>A (p.Ser564Thr) rs876661163
NM_000179.2(MSH6):c.1691C>A (p.Ser564Ter) rs864622153
NM_000179.2(MSH6):c.1691C>G (p.Ser564Ter) rs864622153
NM_000179.2(MSH6):c.1693C>T (p.Leu565=) rs1168297520
NM_000179.2(MSH6):c.1696G>A (p.Gly566Arg) rs63749973
NM_000179.2(MSH6):c.1698A>C (p.Gly566=) rs764818222
NM_000179.2(MSH6):c.170C>T (p.Pro57Leu) rs1064793657
NM_000179.2(MSH6):c.1714C>T (p.Gln572Ter) rs1064795256
NM_000179.2(MSH6):c.1716G>T (p.Gln572His) rs745772518
NM_000179.2(MSH6):c.1729C>G (p.Arg577Gly) rs542838372
NM_000179.2(MSH6):c.1729C>T (p.Arg577Cys) rs542838372
NM_000179.2(MSH6):c.172_177dup (p.Arg58_Pro59dup) rs876661161
NM_000179.2(MSH6):c.1730G>A (p.Arg577His) rs376220212
NM_000179.2(MSH6):c.1739C>T (p.Ser580Leu) rs41295270
NM_000179.2(MSH6):c.173G>A (p.Arg58Lys) rs1064795187
NM_000179.2(MSH6):c.1746T>G (p.Phe582Leu) rs201518545
NM_000179.2(MSH6):c.1754T>C (p.Leu585Pro) rs587779220
NM_000179.2(MSH6):c.1757T>C (p.Val586Ala) rs730881792
NM_000179.2(MSH6):c.175C>T (p.Pro59Ser) rs761033647
NM_000179.2(MSH6):c.1762_1763insT (p.His588fs) rs1553413138
NM_000179.2(MSH6):c.1764C>T (p.His588=) rs1553413140
NM_000179.2(MSH6):c.1786T>A (p.Phe596Ile) rs587779918
NM_000179.2(MSH6):c.1787T>C (p.Phe596Ser) rs1064793774
NM_000179.2(MSH6):c.1789G>T (p.Glu597Ter) rs1553413178
NM_000179.2(MSH6):c.178T>C (p.Leu60=) rs35819209
NM_000179.2(MSH6):c.1793A>G (p.Lys598Arg) rs587779919
NM_000179.2(MSH6):c.1794A>G (p.Lys598=) rs786201210
NM_000179.2(MSH6):c.1795G>T (p.Gly599Ter) rs756043669
NM_000179.2(MSH6):c.1805C>G (p.Ser602Ter) rs730881816
NM_000179.2(MSH6):c.1806A>C (p.Ser602=) rs1057520981
NM_000179.2(MSH6):c.1814C>G (p.Thr605Ser) rs587781616
NM_000179.2(MSH6):c.1815_1816del (p.Lys606fs) rs1060502886
NM_000179.2(MSH6):c.1819dup (p.Thr607fs) rs587779221
NM_000179.2(MSH6):c.1822A>G (p.Ile608Val) rs201613780
NM_000179.2(MSH6):c.1827A>C (p.Leu609=) rs767064953
NM_000179.2(MSH6):c.1827A>G (p.Leu609=) rs767064953
NM_000179.2(MSH6):c.1830G>C (p.Lys610Asn) rs201735525
NM_000179.2(MSH6):c.1836A>C (p.Ser612=) rs779035516
NM_000179.2(MSH6):c.1837T>C (p.Leu613=) rs1057520323
NM_000179.2(MSH6):c.1842C>G (p.Ser614=) rs1057523520
NM_000179.2(MSH6):c.1842del (p.Cys615fs) rs730881825
NM_000179.2(MSH6):c.1844G>C (p.Cys615Ser) rs730881793
NM_000179.2(MSH6):c.1844G>T (p.Cys615Phe) rs730881793
NM_000179.2(MSH6):c.184C>A (p.Arg62Ser) rs876659508
NM_000179.2(MSH6):c.1857A>C (p.Glu619Asp) rs63751121
NM_000179.2(MSH6):c.1858G>A (p.Gly620Ser) rs876661043
NM_000179.2(MSH6):c.1867C>G (p.Pro623Ala) rs3136334
NM_000179.2(MSH6):c.1869C>T (p.Pro623=) rs141242295
NM_000179.2(MSH6):c.186C>G (p.Arg62=) rs1042820
NM_000179.2(MSH6):c.1870G>A (p.Gly624Ser) rs868760377
NM_000179.2(MSH6):c.1871G>T (p.Gly624Val) rs763606858
NM_000179.2(MSH6):c.1876C>T (p.Gln626Ter) rs1553413253
NM_000179.2(MSH6):c.187T>C (p.Ser63Pro) rs763702846
NM_000179.2(MSH6):c.1885G>A (p.Asp629Asn) rs1064795030
NM_000179.2(MSH6):c.188C>A (p.Ser63Tyr) rs587779920
NM_000179.2(MSH6):c.1893C>G (p.Ser631=)
NM_000179.2(MSH6):c.189C>T (p.Ser63=) rs917331457
NM_000179.2(MSH6):c.190G>C (p.Ala64Pro) rs587779921
NM_000179.2(MSH6):c.1915G>A (p.Glu639Lys) rs143517321
NM_000179.2(MSH6):c.1917G>A (p.Glu639=) rs368059229
NM_000179.2(MSH6):c.1921G>T (p.Glu641Ter) rs1553413305
NM_000179.2(MSH6):c.1923A>G (p.Glu641=) rs1057523276
NM_000179.2(MSH6):c.1929T>C (p.Phe643=) rs1057523080
NM_000179.2(MSH6):c.1932G>C (p.Arg644Ser) rs34938432
NM_000179.2(MSH6):c.1933G>T (p.Glu645Ter) rs1064795591
NM_000179.2(MSH6):c.1937A>G (p.Lys646Arg) rs201096652
NM_000179.2(MSH6):c.1938G>A (p.Lys646=) rs758631207
NM_000179.2(MSH6):c.1943G>T (p.Ser648Ile) rs876661082
NM_000179.2(MSH6):c.1945G>T (p.Asp649Tyr) rs1064793188
NM_000179.2(MSH6):c.194C>T (p.Ser65Leu) rs41294984
NM_000179.2(MSH6):c.1957G>A (p.Val653Met) rs768095444
NM_000179.2(MSH6):c.1969C>T (p.Gln657Ter) rs1114167709
NM_000179.2(MSH6):c.1969del (p.Gln657fs) rs876661205
NM_000179.2(MSH6):c.1974G>A (p.Val658=) rs372916347
NM_000179.2(MSH6):c.1978A>C (p.Lys660Gln) rs1060502894
NM_000179.2(MSH6):c.197C>A (p.Pro66Gln) rs730881812
NM_000179.2(MSH6):c.197C>T (p.Pro66Leu) rs730881812
NM_000179.2(MSH6):c.1983T>C (p.Gly661=) rs1411415960
NM_000179.2(MSH6):c.1989T>C (p.Thr663=) rs1057520324
NM_000179.2(MSH6):c.1989T>G (p.Thr663=) rs1057520324
NM_000179.2(MSH6):c.1991C>T (p.Ser664Leu) rs1553413355
NM_000179.2(MSH6):c.1998_1999del (p.Asp667fs) rs1064794028
NM_000179.2(MSH6):c.1999G>C (p.Asp667His) rs151086192
NM_000179.2(MSH6):c.19C>A (p.Leu7Met) rs1064795094
NM_000179.2(MSH6):c.2002T>C (p.Ser668Pro) rs876661080
NM_000179.2(MSH6):c.2010G>A (p.Gly670=) rs1553413390
NM_000179.2(MSH6):c.2013G>A (p.Leu671=) rs765289515
NM_000179.2(MSH6):c.2021G>T (p.Gly674Val) rs1064795598
NM_000179.2(MSH6):c.2027A>G (p.Lys676Arg) rs143643688
NM_000179.2(MSH6):c.2028_2029del (p.Lys676_Ser677insTer) rs1064794055
NM_000179.2(MSH6):c.2030G>C (p.Ser677Thr) rs587779224
NM_000179.2(MSH6):c.204G>A (p.Lys68=) rs864622565
NM_000179.2(MSH6):c.2050C>G (p.Leu684Val) rs771445440
NM_000179.2(MSH6):c.2057G>A (p.Gly686Asp) rs587779227
NM_000179.2(MSH6):c.2061T>A (p.Cys687Ter) rs267608068
NM_000179.2(MSH6):c.2064C>G (p.Val688=) rs1057524297
NM_000179.2(MSH6):c.2069A>T (p.Tyr690Phe) rs730881794
NM_000179.2(MSH6):c.2079dup (p.Cys694fs) rs267608083
NM_000179.2(MSH6):c.207G>A (p.Ala69=) rs757025193
NM_000179.2(MSH6):c.2092C>G (p.Gln698Glu) rs63750832
NM_000179.2(MSH6):c.2101T>C (p.Leu701=) rs1057523503
NM_000179.2(MSH6):c.2107A>G (p.Met703Val) rs751867550
NM_000179.2(MSH6):c.2108T>C (p.Met703Thr) rs1064793189
NM_000179.2(MSH6):c.2122G>T (p.Glu708Ter) rs1064795960
NM_000179.2(MSH6):c.2138A>G (p.Asp713Gly) rs730881795
NM_000179.2(MSH6):c.2141C>G (p.Ser714Cys) rs730881796
NM_000179.2(MSH6):c.2142T>C (p.Ser714=) rs786201606
NM_000179.2(MSH6):c.2147C>G (p.Thr716Arg) rs587782805
NM_000179.2(MSH6):c.2147C>T (p.Thr716Ile) rs587782805
NM_000179.2(MSH6):c.2150_2153del (p.Val717fs) rs267608058
NM_000179.2(MSH6):c.2154C>T (p.Ser718=) rs771662801
NM_000179.2(MSH6):c.2162G>T (p.Arg721Ile) rs876660319
NM_000179.2(MSH6):c.2167G>C (p.Gly723Arg) rs1064793492
NM_000179.2(MSH6):c.2169T>C (p.Gly723=) rs769422122
NM_000179.2(MSH6):c.216C>G (p.Leu72=) rs963404377
NM_000179.2(MSH6):c.2171C>G (p.Ala724Gly) rs587779922
NM_000179.2(MSH6):c.2173A>G (p.Ile725Val) rs148898662
NM_000179.2(MSH6):c.2181C>G (p.Thr727=) rs876659171
NM_000179.2(MSH6):c.2183A>C (p.Lys728Thr) rs35552856
NM_000179.2(MSH6):c.2187C>A (p.Ala729=) rs375610656
NM_000179.2(MSH6):c.2187C>T (p.Ala729=) rs375610656
NM_000179.2(MSH6):c.2193A>G (p.Gln731=) rs1055190211
NM_000179.2(MSH6):c.2194C>A (p.Arg732=) rs63751127
NM_000179.2(MSH6):c.2194C>T (p.Arg732Ter) rs63751127
NM_000179.2(MSH6):c.2195G>A (p.Arg732Gln) rs749746725
NM_000179.2(MSH6):c.2195G>C (p.Arg732Pro) rs749746725
NM_000179.2(MSH6):c.21G>T (p.Leu7=) rs757815307
NM_000179.2(MSH6):c.2208T>C (p.Asp736=) rs1175313729
NM_000179.2(MSH6):c.2217A>G (p.Thr739=) rs876658887
NM_000179.2(MSH6):c.2226C>T (p.Asn742=) rs587781739
NM_000179.2(MSH6):c.2227T>C (p.Leu743=) rs749308906
NM_000179.2(MSH6):c.2229G>A (p.Leu743=) rs1057521504
NM_000179.2(MSH6):c.2230dup (p.Glu744fs) rs786201050
NM_000179.2(MSH6):c.2239C>T (p.Leu747=) rs63751305
NM_000179.2(MSH6):c.2241G>A (p.Leu747=) rs377722465
NM_000179.2(MSH6):c.2241G>C (p.Leu747=) rs377722465
NM_000179.2(MSH6):c.2249C>A (p.Thr750Lys) rs730881817
NM_000179.2(MSH6):c.225G>A (p.Gly75=) rs786202321
NM_000179.2(MSH6):c.2260A>C (p.Thr754Pro) rs545057945
NM_000179.2(MSH6):c.2269_2270del (p.Thr757fs) rs876661025
NM_000179.2(MSH6):c.2271C>T (p.Thr757=) rs142172006
NM_000179.2(MSH6):c.2281A>G (p.Arg761Gly) rs199876321
NM_000179.2(MSH6):c.2283G>A (p.Arg761=) rs1057523842
NM_000179.2(MSH6):c.2289T>C (p.Asp763=) rs137946937
NM_000179.2(MSH6):c.2290dup (p.Thr764fs) rs1553413663
NM_000179.2(MSH6):c.2291C>A (p.Thr764Asn) rs561198849
NM_000179.2(MSH6):c.2291C>T (p.Thr764Ile) rs561198849
NM_000179.2(MSH6):c.2300C>G (p.Thr767Ser) rs587781462
NM_000179.2(MSH6):c.2302C>G (p.Pro768Ala) rs35946687
NM_000179.2(MSH6):c.2314C>A (p.Arg772=) rs63750138
NM_000179.2(MSH6):c.2314C>T (p.Arg772Trp) rs63750138
NM_000179.2(MSH6):c.2315G>A (p.Arg772Gln) rs63750725
NM_000179.2(MSH6):c.2317C>G (p.Leu773Val) rs1064793871
NM_000179.2(MSH6):c.2319C>A (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2319C>T (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2322A>G (p.Leu774=) rs1057521386
NM_000179.2(MSH6):c.2334T>C (p.Leu778=) rs1057523588
NM_000179.2(MSH6):c.233_254dup (p.Thr86fs) rs1553408413
NM_000179.2(MSH6):c.2341C>A (p.Pro781Thr) rs587779235
NM_000179.2(MSH6):c.2343A>C (p.Pro781=) rs965368508
NM_000179.2(MSH6):c.2348_2349del (p.Leu782_Cys783insTer) rs267608065
NM_000179.2(MSH6):c.2354_2355insAGCATTGGCTTTGTGCCCCACTCTGTAACCA (p.His785delinsGlnAlaLeuAlaLeuCysProThrLeuTer) rs876661193
NM_000179.2(MSH6):c.2370T>C (p.Asp790=) rs876658909
NM_000179.2(MSH6):c.2371del (p.Arg791fs) rs886041913
NM_000179.2(MSH6):c.2373T>C (p.Arg791=) rs543201797
NM_000179.2(MSH6):c.2384T>C (p.Ile795Thr) rs202127474
NM_000179.2(MSH6):c.2391C>T (p.Asp797=) rs754870044
NM_000179.2(MSH6):c.2398G>C (p.Val800Leu) rs61748083
NM_000179.2(MSH6):c.2400T>C (p.Val800=) rs267608071
NM_000179.2(MSH6):c.2400T>G (p.Val800=) rs267608071
NM_000179.2(MSH6):c.2408A>G (p.Asp803Gly) rs63751450
NM_000179.2(MSH6):c.2410A>G (p.Lys804Glu) rs1064793552
NM_000179.2(MSH6):c.2412A>G (p.Lys804=) rs201460265
NM_000179.2(MSH6):c.2417C>G (p.Ser806Cys) rs372990379
NM_000179.2(MSH6):c.2418C>T (p.Ser806=) rs770992427
NM_000179.2(MSH6):c.2419G>A (p.Glu807Lys) rs587779923
NM_000179.2(MSH6):c.242C>T (p.Ala81Val) rs587779924
NM_000179.2(MSH6):c.2434C>A (p.Leu812Ile) rs876661054
NM_000179.2(MSH6):c.2436A>G (p.Leu812=) rs897288945
NM_000179.2(MSH6):c.243G>T (p.Ala81=) rs1057523564
NM_000179.2(MSH6):c.2440A>C (p.Lys814Gln) rs1064793190
NM_000179.2(MSH6):c.2454T>C (p.Leu818=)
NM_000179.2(MSH6):c.2459G>T (p.Arg820Met) rs876661204
NM_000179.2(MSH6):c.2467A>G (p.Ser823Gly) rs267608032
NM_000179.2(MSH6):c.246T>C (p.Pro82=) rs786201527
NM_000179.2(MSH6):c.2479A>G (p.Asn827Asp) rs878853716
NM_000179.2(MSH6):c.248C>A (p.Ala83Asp) rs876661197
NM_000179.2(MSH6):c.248C>G (p.Ala83Gly) rs876661197
NM_000179.2(MSH6):c.2493C>T (p.Pro831=) rs778911612
NM_000179.2(MSH6):c.2494C>T (p.Leu832=) rs1057521330
NM_000179.2(MSH6):c.2498_2499AG[1] (p.Gln835fs) rs1064794164
NM_000179.2(MSH6):c.2503C>T (p.Gln835Ter) rs63751321
NM_000179.2(MSH6):c.2508C>T (p.Asn836=) rs758170249
NM_000179.2(MSH6):c.2511C>G (p.His837Gln) rs587779925
NM_000179.2(MSH6):c.2525C>G (p.Ala842Gly) rs876660180
NM_000179.2(MSH6):c.2526T>G (p.Ala842=) rs772394197
NM_000179.2(MSH6):c.2534A>G (p.Tyr845Cys) rs1064794190
NM_000179.2(MSH6):c.253C>T (p.Pro85Ser) rs779664343
NM_000179.2(MSH6):c.2547A>G (p.Thr849=) rs769018957
NM_000179.2(MSH6):c.2550C>T (p.Tyr850=) rs374230313
NM_000179.2(MSH6):c.2555_2557AGA[2] (p.Lys854del) rs587782858
NM_000179.2(MSH6):c.255C>G (p.Pro85=) rs587779242
NM_000179.2(MSH6):c.255del (p.Thr86fs) rs1064793183
NM_000179.2(MSH6):c.2561A>T (p.Lys854Met) rs34374438
NM_000179.2(MSH6):c.2562_2563del (p.Lys854fs) rs876660999
NM_000179.2(MSH6):c.2565T>G (p.Ile855Met) rs1064793456
NM_000179.2(MSH6):c.2567T>C (p.Ile856Thr) rs1064794084
NM_000179.2(MSH6):c.2579C>T (p.Ser860Phe) rs370412074
NM_000179.2(MSH6):c.2584C>T (p.Leu862=) rs1187393388
NM_000179.2(MSH6):c.2597A>C (p.Lys866Thr) rs190075874
NM_000179.2(MSH6):c.259A>T (p.Ser87Cys) rs1064793939
NM_000179.2(MSH6):c.25A>G (p.Ser9Gly) rs41294986
NM_000179.2(MSH6):c.260+10T>G rs193922342
NM_000179.2(MSH6):c.260+17G>A rs760760489
NM_000179.2(MSH6):c.260+2_260+3delTAinsAG rs1064794075
NM_000179.2(MSH6):c.260+4_260+5delGCinsTT rs1064795936
NM_000179.2(MSH6):c.260+7G>A rs774479750
NM_000179.2(MSH6):c.2600T>G (p.Val867Gly) rs139598980
NM_000179.2(MSH6):c.261-10T>C rs1355406935
NM_000179.2(MSH6):c.261-14C>A rs369366445
NM_000179.2(MSH6):c.261-14C>T rs369366445
NM_000179.2(MSH6):c.2615T>C (p.Ile872Thr) rs1064793342
NM_000179.2(MSH6):c.261T>C (p.Ser87=) rs1553410199
NM_000179.2(MSH6):c.2629G>A (p.Glu877Lys) rs730881797
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000179.2(MSH6):c.2641delinsAAAA (p.Gly881delinsLysSer) rs63751408
NM_000179.2(MSH6):c.2648A>C (p.Lys883Thr) rs764816440
NM_000179.2(MSH6):c.2653A>T (p.Lys885Ter) rs587782593
NM_000179.2(MSH6):c.2658C>T (p.Ile886=) rs786201051
NM_000179.2(MSH6):c.2661T>G (p.Leu887=) rs267608069
NM_000179.2(MSH6):c.2664G>C (p.Lys888Asn) rs730881798
NM_000179.2(MSH6):c.2665dup (p.Gln889fs) rs1553413985
NM_000179.2(MSH6):c.2667G>T (p.Gln889His) rs149945495
NM_000179.2(MSH6):c.2673C>G (p.Ile891Met) rs146006741
NM_000179.2(MSH6):c.267C>G (p.Asp89Glu) rs762818044
NM_000179.2(MSH6):c.267C>T (p.Asp89=) rs762818044
NM_000179.2(MSH6):c.2688A>G (p.Lys896=) rs876659173
NM_000179.2(MSH6):c.2689A>T (p.Asn897Tyr) rs1064794771
NM_000179.2(MSH6):c.2690dup (p.Asn897fs) rs1553414010
NM_000179.2(MSH6):c.2693C>G (p.Pro898Arg) rs876661281
NM_000179.2(MSH6):c.2700T>C (p.Gly900=) rs1042816
NM_000179.2(MSH6):c.2703T>G (p.Arg901=) rs1064795083
NM_000179.2(MSH6):c.2708C>A (p.Pro903His) rs1060502919
NM_000179.2(MSH6):c.2712T>G (p.Asp904Glu) rs374401174
NM_000179.2(MSH6):c.2724A>G (p.Glu908=) rs35389622
NM_000179.2(MSH6):c.2725T>C (p.Leu909=) rs876659785
NM_000179.2(MSH6):c.2725_2729del (p.Leu909fs) rs1553414058
NM_000179.2(MSH6):c.2727G>A (p.Leu909=) rs768356593
NM_000179.2(MSH6):c.2731C>T (p.Arg911Ter) rs63751017
NM_000179.2(MSH6):c.2732G>T (p.Arg911Leu) rs761622304
NM_000179.2(MSH6):c.2751C>T (p.Asp917=) rs753967199
NM_000179.2(MSH6):c.2753A>G (p.His918Arg) rs754948438
NM_000179.2(MSH6):c.2754T>C (p.His918=) rs1057521383
NM_000179.2(MSH6):c.2765G>A (p.Arg922Gln) rs752839086
NM_000179.2(MSH6):c.2770A>T (p.Thr924Ser) rs758873844
NM_000179.2(MSH6):c.2775A>G (p.Gly925=) rs587779248
NM_000179.2(MSH6):c.2776C>T (p.Leu926Phe) rs587781318
NM_000179.2(MSH6):c.2779dup (p.Ile927fs) rs587782277
NM_000179.2(MSH6):c.2780T>C (p.Ile927Thr) rs587779926
NM_000179.2(MSH6):c.2787C>G (p.Pro929=) rs768005323
NM_000179.2(MSH6):c.2805dup (p.Asp936Ter) rs876659189
NM_000179.2(MSH6):c.2827G>T (p.Asp943Tyr) rs143520357
NM_000179.2(MSH6):c.2832_2833del (p.Ile944fs) rs730881827
NM_000179.2(MSH6):c.2838A>G (p.Glu946=) rs876660479
NM_000179.2(MSH6):c.2841T>C (p.Asn947=) rs1057522717
NM_000179.2(MSH6):c.2846_2847AG[1] (p.Ser950fs) rs869312770
NM_000179.2(MSH6):c.2853C>G (p.Leu951=) rs876658525
NM_000179.2(MSH6):c.2857G>A (p.Glu953Lys) rs753034685
NM_000179.2(MSH6):c.2862C>G (p.Tyr954Ter) rs1064793671
NM_000179.2(MSH6):c.2869A>G (p.Lys957Glu) rs876661255
NM_000179.2(MSH6):c.2875C>T (p.Arg959Cys) rs751973865
NM_000179.2(MSH6):c.2877C>T (p.Arg959=) rs781734958
NM_000179.2(MSH6):c.2879A>G (p.Asn960Ser) rs746341645
NM_000179.2(MSH6):c.2880C>T (p.Asn960=) rs1057520440
NM_000179.2(MSH6):c.2898C>G (p.Thr966=) rs772786755
NM_000179.2(MSH6):c.2899A>G (p.Ile967Val) rs876661067
NM_000179.2(MSH6):c.2904C>G (p.Val968=) rs150683226
NM_000179.2(MSH6):c.2906A>G (p.Tyr969Cys) rs63749919
NM_000179.2(MSH6):c.2910G>A (p.Trp970Ter) rs765411990
NM_000179.2(MSH6):c.2919T>G (p.Gly973=) rs1057522150
NM_000179.2(MSH6):c.2925C>T (p.Asn975=) rs139026662
NM_000179.2(MSH6):c.2926C>T (p.Arg976Cys) rs587782386
NM_000179.2(MSH6):c.2928T>C (p.Arg976=) rs764440377
NM_000179.2(MSH6):c.2932C>T (p.Gln978Ter) rs587781372
NM_000179.2(MSH6):c.2940A>G (p.Glu980=) rs730881818
NM_000179.2(MSH6):c.2941A>G (p.Ile981Val) rs730881799
NM_000179.2(MSH6):c.2943T>G (p.Ile981Met) rs876661170
NM_000179.2(MSH6):c.2946T>G (p.Pro982=) rs751006944
NM_000179.2(MSH6):c.2950A>G (p.Asn984Asp) rs146359682
NM_000179.2(MSH6):c.2951A>C (p.Asn984Thr) rs587779927
NM_000179.2(MSH6):c.2958C>A (p.Thr986=) rs757866392
NM_000179.2(MSH6):c.2959A>G (p.Thr987Ala) rs746631156
NM_000179.2(MSH6):c.2960C>G (p.Thr987Ser) rs587779928
NM_000179.2(MSH6):c.2960C>T (p.Thr987Ile) rs587779928
NM_000179.2(MSH6):c.2962C>T (p.Arg988Cys) rs61753795
NM_000179.2(MSH6):c.2963G>A (p.Arg988His) rs115386788
NM_000179.2(MSH6):c.2964C>A (p.Arg988=) rs144288981
NM_000179.2(MSH6):c.2972C>T (p.Pro991Leu) rs375966384
NM_000179.2(MSH6):c.2973A>G (p.Pro991=) rs1057521349
NM_000179.2(MSH6):c.2974G>A (p.Glu992Lys) rs774755404
NM_000179.2(MSH6):c.2979A>G (p.Glu993=) rs370462886
NM_000179.2(MSH6):c.2986T>C (p.Leu996=) rs876658605
NM_000179.2(MSH6):c.2989A>T (p.Lys997Ter) rs1064794943
NM_000179.2(MSH6):c.2992T>A (p.Ser998Thr) rs730881800
NM_000179.2(MSH6):c.2996C>A (p.Thr999Asn) rs1064794488
NM_000179.2(MSH6):c.3005G>A (p.Gly1002Asp) rs1064794070
NM_000179.2(MSH6):c.3012A>G (p.Lys1004=) rs864622378
NM_000179.2(MSH6):c.3013C>T (p.Arg1005Ter) rs63750563
NM_000179.2(MSH6):c.3015A>G (p.Arg1005=) rs990650403
NM_000179.2(MSH6):c.3024C>T (p.Thr1008=) rs587780675
NM_000179.2(MSH6):c.3026A>T (p.Lys1009Ile) rs587781593
NM_000179.2(MSH6):c.3030T>C (p.Thr1010=) rs1060504753
NM_000179.2(MSH6):c.3037_3039AAG[1] (p.Lys1014del) rs267608073
NM_000179.2(MSH6):c.3037_3041del (p.Lys1013fs) rs587782712
NM_000179.2(MSH6):c.303G>A (p.Glu101=) rs1057521533
NM_000179.2(MSH6):c.3047C>T (p.Ala1016Val) rs587779929
NM_000179.2(MSH6):c.3048T>C (p.Ala1016=) rs1553414427
NM_000179.2(MSH6):c.3054C>A (p.Leu1018=) rs772191770
NM_000179.2(MSH6):c.3062C>G (p.Ala1021Gly) rs63750287
NM_000179.2(MSH6):c.3071G>A (p.Arg1024Gln) rs372705506
NM_000179.2(MSH6):c.3076G>C (p.Asp1026His) rs267608054
NM_000179.2(MSH6):c.3076G>T (p.Asp1026Tyr) rs267608054
NM_000179.2(MSH6):c.3083C>G (p.Ser1028Ter) rs876660853
NM_000179.2(MSH6):c.3098T>A (p.Met1033Lys) rs751035257
NM_000179.2(MSH6):c.3100C>G (p.Arg1034Gly) rs587779930
NM_000179.2(MSH6):c.3100C>T (p.Arg1034Trp) rs587779930
NM_000179.2(MSH6):c.3103C>T (p.Arg1035Ter) rs63749999
NM_000179.2(MSH6):c.3104G>A (p.Arg1035Gln) rs730881801
NM_000179.2(MSH6):c.3104G>T (p.Arg1035Leu) rs730881801
NM_000179.2(MSH6):c.3111C>A (p.Phe1037Leu) rs587781673
NM_000179.2(MSH6):c.3111C>G (p.Phe1037Leu) rs587781673
NM_000179.2(MSH6):c.3113A>G (p.Tyr1038Cys) rs773357672
NM_000179.2(MSH6):c.3119_3120del (p.Asn1039_Phe1040insTer) rs267608042
NM_000179.2(MSH6):c.3120T>C (p.Phe1040=) rs1553414538
NM_000179.2(MSH6):c.3134_3140del (p.Lys1045fs) rs1553414544
NM_000179.2(MSH6):c.3137A>G (p.Asp1046Gly) rs587779931
NM_000179.2(MSH6):c.3140G>A (p.Trp1047Ter) rs1064794302
NM_000179.2(MSH6):c.3142C>T (p.Gln1048Ter) rs200492211
NM_000179.2(MSH6):c.3151G>A (p.Val1051Ile) rs576269342
NM_000179.2(MSH6):c.3153A>G (p.Val1051=) rs1057521587
NM_000179.2(MSH6):c.3153_3154AG[1] (p.Glu1052fs) rs63750833
NM_000179.2(MSH6):c.3160A>T (p.Ile1054Phe) rs267608075
NM_000179.2(MSH6):c.3162C>T (p.Ile1054=) rs149605979
NM_000179.2(MSH6):c.3163G>A (p.Ala1055Thr) rs587779254
NM_000179.2(MSH6):c.3163dup (p.Ala1055fs) rs878853729
NM_000179.2(MSH6):c.3172+11G>A rs1057523866
NM_000179.2(MSH6):c.3172+11G>T rs1057523866
NM_000179.2(MSH6):c.3172+122A>T
NM_000179.2(MSH6):c.3172+14C>T rs762990595
NM_000179.2(MSH6):c.3172+20T>C rs3136335
NM_000179.2(MSH6):c.3173-10C>A rs587780559
NM_000179.2(MSH6):c.3173-10C>T rs587780559
NM_000179.2(MSH6):c.3173-10_3173-6del rs781520783
NM_000179.2(MSH6):c.3173-10_3173-9delCT rs746607182
NM_000179.2(MSH6):c.3173-12C>T rs1057517629
NM_000179.2(MSH6):c.3173-18T>A rs189672273
NM_000179.2(MSH6):c.3173-2A>T rs1553331242
NM_000179.2(MSH6):c.3191C>T (p.Ala1064Val) rs369042519
NM_000179.2(MSH6):c.3200G>C (p.Ser1067Thr) rs730881803
NM_000179.2(MSH6):c.3202C>T (p.Arg1068Ter) rs63749843
NM_000179.2(MSH6):c.3203G>A (p.Arg1068Gln) rs398123230
NM_000179.2(MSH6):c.3203G>T (p.Arg1068Leu) rs398123230
NM_000179.2(MSH6):c.3205G>C (p.Gly1069Arg) rs764113705
NM_000179.2(MSH6):c.3209G>A (p.Gly1070Asp) rs751475855
NM_000179.2(MSH6):c.3213T>C (p.Asp1071=) rs534232216
NM_000179.2(MSH6):c.3215G>T (p.Gly1072Val) rs781243845
NM_000179.2(MSH6):c.3217C>T (p.Pro1073Ser) rs142254875
NM_000179.2(MSH6):c.3218C>G (p.Pro1073Arg) rs587779257
NM_000179.2(MSH6):c.321T>C (p.Pro107=) rs730881823
NM_000179.2(MSH6):c.3220A>G (p.Met1074Val) rs730881804
NM_000179.2(MSH6):c.3220A>T (p.Met1074Leu) rs730881804
NM_000179.2(MSH6):c.3226C>T (p.Arg1076Cys) rs63750617
NM_000179.2(MSH6):c.3226dup (p.Arg1076fs) rs1553331304
NM_000179.2(MSH6):c.3231A>G (p.Pro1077=) rs1553331315
NM_000179.2(MSH6):c.3232G>C (p.Val1078Leu) rs587779932
NM_000179.2(MSH6):c.3233T>C (p.Val1078Ala) rs376452612
NM_000179.2(MSH6):c.3235A>C (p.Ile1079Leu) rs587779933
NM_000179.2(MSH6):c.3240G>A (p.Leu1080=) rs1114167739
NM_000179.2(MSH6):c.3244C>T (p.Pro1082Ser) rs186240214
NM_000179.2(MSH6):c.3245C>T (p.Pro1082Leu) rs191109849
NM_000179.2(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3248A>G (p.Glu1083Gly) rs1064796068
NM_000179.2(MSH6):c.3254C>G (p.Thr1085Ser) rs761724581
NM_000179.2(MSH6):c.3254C>T (p.Thr1085Ile) rs761724581
NM_000179.2(MSH6):c.3254_3255delinsT (p.Thr1085fs) rs1553331378
NM_000179.2(MSH6):c.3255C>G (p.Thr1085=) rs371568610
NM_000179.2(MSH6):c.3256C>G (p.Pro1086Ala) rs756108143
NM_000179.2(MSH6):c.3257C>A (p.Pro1086His) rs780345806
NM_000179.2(MSH6):c.3257C>T (p.Pro1086Leu) rs780345806
NM_000179.2(MSH6):c.3259C>A (p.Pro1087Thr) rs63750998
NM_000179.2(MSH6):c.3259C>G (p.Pro1087Ala) rs63750998
NM_000179.2(MSH6):c.3259C>T (p.Pro1087Ser) rs63750998
NM_000179.2(MSH6):c.325C>G (p.Leu109Val) rs1064793870
NM_000179.2(MSH6):c.3260C>A (p.Pro1087His) rs63750753
NM_000179.2(MSH6):c.3260C>G (p.Pro1087Arg) rs63750753
NM_000179.2(MSH6):c.3261C>T (p.Pro1087=) rs370226185
NM_000179.2(MSH6):c.3261del (p.Phe1088fs) rs267608078
NM_000179.2(MSH6):c.3261dup (p.Phe1088fs) rs267608078
NM_000179.2(MSH6):c.3262T>C (p.Phe1088Leu) rs866793892
NM_000179.2(MSH6):c.3264C>T (p.Phe1088=) rs35621414
NM_000179.2(MSH6):c.3267dup (p.Glu1090fs) rs1553331434
NM_000179.2(MSH6):c.3268_3274del (p.Glu1090fs) rs587779259
NM_000179.2(MSH6):c.3276A>G (p.Lys1092=)
NM_000179.2(MSH6):c.3278G>T (p.Gly1093Val) rs876661048
NM_000179.2(MSH6):c.3279A>T (p.Gly1093=) rs876658155
NM_000179.2(MSH6):c.3282A>T (p.Ser1094=) rs372996269
NM_000179.2(MSH6):c.3283C>T (p.Arg1095Cys) rs376243329
NM_000179.2(MSH6):c.3284G>A (p.Arg1095His) rs63750253
NM_000179.2(MSH6):c.3294C>T (p.Cys1098=) rs766341781
NM_000179.2(MSH6):c.3295A>G (p.Ile1099Val) rs1064795895
NM_000179.2(MSH6):c.3299C>G (p.Thr1100Arg) rs63750442
NM_000179.2(MSH6):c.3299C>T (p.Thr1100Met) rs63750442
NM_000179.2(MSH6):c.3300G>A (p.Thr1100=) rs540252208
NM_000179.2(MSH6):c.3300G>C (p.Thr1100=) rs540252208
NM_000179.2(MSH6):c.3304A>G (p.Thr1102Ala) rs758782048
NM_000179.2(MSH6):c.3312T>A (p.Phe1104Leu) rs747441460
NM_000179.2(MSH6):c.3316_3318GAT[1] (p.Asp1107del) rs1064795429
NM_000179.2(MSH6):c.3324T>C (p.Phe1108=) rs864622081
NM_000179.2(MSH6):c.3339T>C (p.Ile1113=) rs786202044
NM_000179.2(MSH6):c.333C>T (p.Tyr111=) rs786202772
NM_000179.2(MSH6):c.3340C>A (p.Leu1114Ile) rs1064793520
NM_000179.2(MSH6):c.3350G>A (p.Cys1117Tyr) rs773245315
NM_000179.2(MSH6):c.3350G>T (p.Cys1117Phe) rs773245315
NM_000179.2(MSH6):c.3354G>A (p.Glu1118=) rs35642130
NM_000179.2(MSH6):c.3356A>G (p.Glu1119Gly) rs876661138
NM_000179.2(MSH6):c.335A>G (p.Asn112Ser) rs587779934
NM_000179.2(MSH6):c.3361G>A (p.Glu1121Lys) rs587781609
NM_000179.2(MSH6):c.3375C>G (p.Gly1125=) rs765577023
NM_000179.2(MSH6):c.3379_3438+5del65 rs1553331676
NM_000179.2(MSH6):c.3384T>C (p.Tyr1128=) rs544518097
NM_000179.2(MSH6):c.3388G>A (p.Val1130Met) rs752164796
NM_000179.2(MSH6):c.3398C>T (p.Thr1133Ile) rs730881805
NM_000179.2(MSH6):c.3399T>C (p.Thr1133=) rs61748084
NM_000179.2(MSH6):c.339C>T (p.His113=) rs886056141
NM_000179.2(MSH6):c.33C>G (p.Phe11Leu) rs747802641
NM_000179.2(MSH6):c.3400G>C (p.Gly1134Arg) rs1114167697
NM_000179.2(MSH6):c.3416del (p.Gly1139fs) rs587781544
NM_000179.2(MSH6):c.3422del (p.Ser1141fs) rs1553331760
NM_000179.2(MSH6):c.3425C>T (p.Thr1142Met) rs267608089
NM_000179.2(MSH6):c.342C>T (p.Pro114=) rs1057520438
NM_000179.2(MSH6):c.3431T>G (p.Met1144Arg) rs864622607
NM_000179.2(MSH6):c.3436C>T (p.Gln1146Ter) rs63750356
NM_000179.2(MSH6):c.3438+11_3438+14delCTTA rs377746844
NM_000179.2(MSH6):c.3438+12T>C rs1057522790
NM_000179.2(MSH6):c.3438+14A>T rs2020911
NM_000179.2(MSH6):c.3438+14delAinsTT rs1064793191
NM_000179.2(MSH6):c.3438+17G>C rs759737239
NM_000179.2(MSH6):c.3438+6T>C rs370170322
NM_000179.2(MSH6):c.3438+8dupA rs878853734
NM_000179.2(MSH6):c.3439-10T>A rs730881819
NM_000179.2(MSH6):c.3439-16C>T rs192614006
NM_000179.2(MSH6):c.3439-1G>T rs587779263
NM_000179.2(MSH6):c.3439-20T>G rs1553332128
NM_000179.2(MSH6):c.3439-2A>G rs267608098
NM_000179.2(MSH6):c.3441T>G (p.Ala1147=) rs1389565996
NM_000179.2(MSH6):c.3442G>A (p.Gly1148Ser) rs63750257
NM_000179.2(MSH6):c.3449T>A (p.Leu1150Ter) rs1057517763
NM_000179.2(MSH6):c.3450A>C (p.Leu1150Phe) rs762134820
NM_000179.2(MSH6):c.3452C>G (p.Ala1151Gly) rs587782625
NM_000179.2(MSH6):c.3452C>T (p.Ala1151Val) rs587782625
NM_000179.2(MSH6):c.3456A>G (p.Val1152=) rs750998416
NM_000179.2(MSH6):c.3467T>C (p.Met1156Thr) rs876659549
NM_000179.2(MSH6):c.3476dup (p.Tyr1159Ter) rs587782111
NM_000179.2(MSH6):c.3477C>G (p.Tyr1159Ter) rs398123231
NM_000179.2(MSH6):c.3478G>A (p.Val1160Ile) rs376799914
NM_000179.2(MSH6):c.3480C>G (p.Val1160=) rs786201385
NM_000179.2(MSH6):c.3482_3484CTG[1] (p.Ala1162del) rs63751427
NM_000179.2(MSH6):c.3483T>C (p.Pro1161=) rs757064383
NM_000179.2(MSH6):c.3483T>G (p.Pro1161=) rs757064383
NM_000179.2(MSH6):c.3485C>A (p.Ala1162Asp) rs587779935
NM_000179.2(MSH6):c.3487G>T (p.Glu1163Ter) rs587779267
NM_000179.2(MSH6):c.3488A>T (p.Glu1163Val) rs63750252
NM_000179.2(MSH6):c.34C>A (p.Pro12Thr) rs587782084
NM_000179.2(MSH6):c.3509_3518del (p.Ile1170fs) rs1553332228
NM_000179.2(MSH6):c.3510T>C (p.Ile1170=) rs1001812170
NM_000179.2(MSH6):c.3513T>C (p.Asp1171=) rs63749834
NM_000179.2(MSH6):c.3513_3514del (p.Asp1171fs) rs63750194
NM_000179.2(MSH6):c.3514_3515AG[1] (p.Arg1172fs) rs398123232
NM_000179.2(MSH6):c.3517G>A (p.Val1173Met) rs730881806
NM_000179.2(MSH6):c.3523_3524dup (p.Arg1176fs) rs730881828
NM_000179.2(MSH6):c.3524C>G (p.Thr1175Ser) rs369583604
NM_000179.2(MSH6):c.3524C>T (p.Thr1175Ile) rs369583604
NM_000179.2(MSH6):c.3527G>A (p.Arg1176Lys) rs876661148
NM_000179.2(MSH6):c.3528_3532del (p.Leu1177fs) rs863225408
NM_000179.2(MSH6):c.3529C>G (p.Leu1177Val) rs748398941
NM_000179.2(MSH6):c.3534T>A (p.Gly1178=) rs876658537
NM_000179.2(MSH6):c.3543C>G (p.Asp1181Glu) rs267608100
NM_000179.2(MSH6):c.3556+1delG rs1064793489
NM_000179.2(MSH6):c.3556+3G>T rs1057521667
NM_000179.2(MSH6):c.3557-7_3557-4delTTTT rs267608102
NM_000179.2(MSH6):c.3557G>A (p.Gly1186Asp) rs587781690
NM_000179.2(MSH6):c.3560A>G (p.Glu1187Gly) rs150632241
NM_000179.2(MSH6):c.3563G>A (p.Ser1188Asn) rs587779272
NM_000179.2(MSH6):c.3563dup (p.Ser1188fs) rs1553332639
NM_000179.2(MSH6):c.3565A>G (p.Thr1189Ala) rs753778809
NM_000179.2(MSH6):c.3571T>C (p.Phe1191Leu) rs752857771
NM_000179.2(MSH6):c.3573dup (p.Val1192fs) rs1057517764
NM_000179.2(MSH6):c.3577_3581del (p.Glu1193fs) rs1060502881
NM_000179.2(MSH6):c.3591T>C (p.Thr1197=) rs771340721
NM_000179.2(MSH6):c.3596G>C (p.Ser1199Thr) rs773185557
NM_000179.2(MSH6):c.359T>C (p.Ile120Thr) rs775971872
NM_000179.2(MSH6):c.3600A>G (p.Ile1200Met) rs587781482
NM_000179.2(MSH6):c.3601C>G (p.Leu1201Val) rs182024561
NM_000179.2(MSH6):c.3603_3605dup (p.Met1202_His1203insIle) rs1064796248
NM_000179.2(MSH6):c.3604A>G (p.Met1202Val) rs369778514
NM_000179.2(MSH6):c.3605T>C (p.Met1202Thr) rs587779273
NM_000179.2(MSH6):c.3615A>G (p.Thr1205=) rs876660407
NM_000179.2(MSH6):c.3619C>G (p.His1207Asp) rs760391254
NM_000179.2(MSH6):c.361C>T (p.Arg121Cys) rs763593669
NM_000179.2(MSH6):c.3621T>G (p.His1207Gln) rs766075233
NM_000179.2(MSH6):c.3622dup (p.Ser1208fs) rs1553332733
NM_000179.2(MSH6):c.3625C>T (p.Leu1209=) rs753675331
NM_000179.2(MSH6):c.363C>T (p.Arg121=) rs587779276
NM_000179.2(MSH6):c.3646+10T>A rs1057520325
NM_000179.2(MSH6):c.3646+154_3646+168delATAAAAGGTGATATT
NM_000179.2(MSH6):c.3646+166A>C
NM_000179.2(MSH6):c.3646+16_3646+18delTCT rs1553332784
NM_000179.2(MSH6):c.3646+19C>T rs370746787
NM_000179.2(MSH6):c.3646+7C>T rs1057522750
NM_000179.2(MSH6):c.3647-10A>G rs756569687
NM_000179.2(MSH6):c.3647-17A>G rs767828284
NM_000179.2(MSH6):c.3647-6T>A rs182871847
NM_000179.2(MSH6):c.3647-9_3647-5delCTTTA rs759094365
NM_000179.2(MSH6):c.3647delG rs1064795629
NM_000179.2(MSH6):c.3649A>G (p.Arg1217Gly) rs587780677
NM_000179.2(MSH6):c.364G>A (p.Glu122Lys) rs143036974
NM_000179.2(MSH6):c.3662C>G (p.Thr1221Arg) rs876661139
NM_000179.2(MSH6):c.3666T>C (p.Phe1222=)
NM_000179.2(MSH6):c.3674C>T (p.Thr1225Met) rs63750370
NM_000179.2(MSH6):c.3675G>A (p.Thr1225=) rs730881820
NM_000179.2(MSH6):c.3676G>A (p.Ala1226Thr) rs1064794746
NM_000179.2(MSH6):c.3679A>T (p.Ile1227Leu) rs587779282
NM_000179.2(MSH6):c.3686A>G (p.Asn1229Ser) rs730881807
NM_000179.2(MSH6):c.3690del (p.Val1231fs) rs730881829
NM_000179.2(MSH6):c.3691_3693GTT[1] (p.Val1232del) rs587779284
NM_000179.2(MSH6):c.3699_3702del (p.Lys1233fs) rs193922343
NM_000179.2(MSH6):c.369A>T (p.Lys123Asn) rs587782106
NM_000179.2(MSH6):c.3703C>G (p.Leu1235Val) rs876661084
NM_000179.2(MSH6):c.3713C>G (p.Thr1238Ser) rs755349360
NM_000179.2(MSH6):c.3714_3715TA[1] (p.Ile1239fs) rs1064794384
NM_000179.2(MSH6):c.3716T>C (p.Ile1239Thr) rs786203816
NM_000179.2(MSH6):c.3724C>A (p.Arg1242Ser) rs587779285
NM_000179.2(MSH6):c.3724_3726del (p.Arg1242del) rs63749942
NM_000179.2(MSH6):c.3725G>A (p.Arg1242His) rs63750119
NM_000179.2(MSH6):c.3727A>T (p.Thr1243Ser) rs147453999
NM_000179.2(MSH6):c.3732_3735dup (p.Ser1246fs) rs1553333072
NM_000179.2(MSH6):c.3739A>G (p.Thr1247Ala) rs769360577
NM_000179.2(MSH6):c.3740C>G (p.Thr1247Ser) rs786204182
NM_000179.2(MSH6):c.3743_3744insT (p.Tyr1249fs) rs786201084
NM_000179.2(MSH6):c.3744_3753dup (p.Val1253fs) rs1553333078
NM_000179.2(MSH6):c.3744_3773del (p.His1248_Ser1257del) rs863225412
NM_000179.2(MSH6):c.3746_3749dup (p.His1250fs) rs587779936
NM_000179.2(MSH6):c.3747C>T (p.Tyr1249=) rs1057520326
NM_000179.2(MSH6):c.3753_3756dup (p.Val1253fs) rs876661222
NM_000179.2(MSH6):c.3758T>A (p.Val1253Glu) rs202066386
NM_000179.2(MSH6):c.3758T>C (p.Val1253Ala) rs202066386
NM_000179.2(MSH6):c.3759A>T (p.Val1253=) rs1553333115
NM_000179.2(MSH6):c.3759_3761AGA[1] (p.Glu1254del) rs587779937
NM_000179.2(MSH6):c.3762A>T (p.Glu1254Asp) rs375459388
NM_000179.2(MSH6):c.3762_3763delinsTT (p.Glu1254_Asp1255delinsAspTyr) rs878853738
NM_000179.2(MSH6):c.3766dup (p.Tyr1256fs) rs1553333127
NM_000179.2(MSH6):c.3768T>G (p.Tyr1256Ter) rs63751058
NM_000179.2(MSH6):c.3772C>G (p.Gln1258Glu) rs63750554
NM_000179.2(MSH6):c.3787C>T (p.Arg1263Cys) rs367912290
NM_000179.2(MSH6):c.3788G>A (p.Arg1263His) rs147852216
NM_000179.2(MSH6):c.3792A>G (p.Leu1264=) rs786202051
NM_000179.2(MSH6):c.3797A>G (p.His1266Arg) rs760023025
NM_000179.2(MSH6):c.3797_3798AT[1] (p.Met1267fs) rs267608114
NM_000179.2(MSH6):c.3799A>G (p.Met1267Val) rs1553333177
NM_000179.2(MSH6):c.37A>G (p.Lys13Glu) rs942019524
NM_000179.2(MSH6):c.3800T>C (p.Met1267Thr) rs148445930
NM_000179.2(MSH6):c.3801+14G>T rs755626529
NM_000179.2(MSH6):c.3801+14_3801+17dup rs758614117
NM_000179.2(MSH6):c.3801+14delG rs1064794387
NM_000179.2(MSH6):c.3801+15T>C rs779720344
NM_000179.2(MSH6):c.3801+17T>C rs3136365
NM_000179.2(MSH6):c.3801+19T>C rs778693654
NM_000179.2(MSH6):c.3801+5G>A rs201080919
NM_000179.2(MSH6):c.3801+7G>T rs1553333205
NM_000179.2(MSH6):c.3801+8C>A rs864622734
NM_000179.2(MSH6):c.3802-12T>G
NM_000179.2(MSH6):c.3802-16A>G rs1454019658
NM_000179.2(MSH6):c.3802-18A>T rs1553333276
NM_000179.2(MSH6):c.3802-7_3802-4delTCTT rs876661171
NM_000179.2(MSH6):c.3802-8T>G rs864622195
NM_000179.2(MSH6):c.3802-8_3802-4dupTTCTT rs745801834
NM_000179.2(MSH6):c.3803C>T (p.Ala1268Val) rs587779293
NM_000179.2(MSH6):c.3804dup (p.Cys1269fs) rs267608118
NM_000179.2(MSH6):c.3824G>A (p.Cys1275Tyr) rs150990541
NM_000179.2(MSH6):c.3825T>C (p.Cys1275=) rs1553333352
NM_000179.2(MSH6):c.3831C>T (p.Asp1277=) rs775752224
NM_000179.2(MSH6):c.3832C>A (p.Pro1278Thr) rs587782109
NM_000179.2(MSH6):c.3833C>G (p.Pro1278Arg) rs201191389
NM_000179.2(MSH6):c.3836G>A (p.Ser1279Asn) rs864622400
NM_000179.2(MSH6):c.3836_3849dup (p.Thr1284fs) rs1553333377
NM_000179.2(MSH6):c.3837C>G (p.Ser1279Arg) rs876661245
NM_000179.2(MSH6):c.383G>T (p.Arg128Leu) rs63750143
NM_000179.2(MSH6):c.3840_3846del (p.Glu1281fs) rs63751319
NM_000179.2(MSH6):c.3843G>A (p.Glu1281=) rs864622384
NM_000179.2(MSH6):c.3845C>A (p.Thr1282Asn) rs876660361
NM_000179.2(MSH6):c.3847_3850dup (p.Thr1284fs) rs267608128
NM_000179.2(MSH6):c.3848_3850dup (p.Ile1283dup) rs1553333420
NM_000179.2(MSH6):c.3849del (p.Thr1284fs) rs1064793781
NM_000179.2(MSH6):c.3850dup (p.Thr1284fs) rs1553333421
NM_000179.2(MSH6):c.3851C>T (p.Thr1284Met) rs63750836
NM_000179.2(MSH6):c.3852G>A (p.Thr1284=) rs2229018
NM_000179.2(MSH6):c.3878_3881dup (p.Pro1295fs) rs1553333500
NM_000179.2(MSH6):c.3882del (p.Pro1295fs) rs876658817
NM_000179.2(MSH6):c.3893A>G (p.Tyr1298Cys) rs786202520
NM_000179.2(MSH6):c.3897_3931dup (p.Glu1311fs) rs1064793895
NM_000179.2(MSH6):c.389A>G (p.His130Arg) rs1064793184
NM_000179.2(MSH6):c.38A>C (p.Lys13Thr) rs41294988
NM_000179.2(MSH6):c.3904_3921dup (p.Ala1302_Asn1307dup) rs876661157
NM_000179.2(MSH6):c.3909A>G (p.Ala1303=) rs757286252
NM_000179.2(MSH6):c.390T>C (p.His130=)
NM_000179.2(MSH6):c.3911G>A (p.Arg1304Lys) rs34625968
NM_000179.2(MSH6):c.3915T>C (p.Leu1305=) rs1057522349
NM_000179.2(MSH6):c.3919A>C (p.Asn1307His) rs730881808
NM_000179.2(MSH6):c.3920_3927dup (p.Glu1310fs) rs587779295
NM_000179.2(MSH6):c.3921T>C (p.Asn1307=) rs876659660
NM_000179.2(MSH6):c.3932_3935dup (p.Ile1313fs) rs267608127
NM_000179.2(MSH6):c.3934_3937dup (p.Ile1313fs) rs760190301
NM_000179.2(MSH6):c.3936T>C (p.Val1312=) rs61753796
NM_000179.2(MSH6):c.3939_3940dup (p.Gln1314fs) rs730881830
NM_000179.2(MSH6):c.3939_3957dup (p.Ala1320delinsSerLysGlyThrTer) rs63750767
NM_000179.2(MSH6):c.393A>C (p.Val131=) rs752488540
NM_000179.2(MSH6):c.3946G>C (p.Gly1316Arg) rs773675555
NM_000179.2(MSH6):c.3947G>C (p.Gly1316Ala) rs876661174
NM_000179.2(MSH6):c.3949C>G (p.His1317Asp) rs759092293
NM_000179.2(MSH6):c.3951T>C (p.His1317=) rs764786814
NM_000179.2(MSH6):c.3951dup (p.Arg1318Ter) rs1553333690
NM_000179.2(MSH6):c.3959_3962del (p.Ala1320fs) rs267608120
NM_000179.2(MSH6):c.3960A>G (p.Ala1320=) rs373425206
NM_000179.2(MSH6):c.3961A>G (p.Arg1321Gly) rs41295278
NM_000179.2(MSH6):c.3962G>T (p.Arg1321Ile) rs1064795473
NM_000179.2(MSH6):c.3966A>T (p.Glu1322Asp) rs1064794745
NM_000179.2(MSH6):c.3969T>C (p.Phe1323=) rs1057520473
NM_000179.2(MSH6):c.3969T>G (p.Phe1323Leu) rs1057520473
NM_000179.2(MSH6):c.3971_3973AGA[1] (p.Lys1325del) rs587779300
NM_000179.2(MSH6):c.3972G>C (p.Glu1324Asp) rs587779938
NM_000179.2(MSH6):c.3974A>G (p.Lys1325Arg) rs876658189
NM_000179.2(MSH6):c.3974A>T (p.Lys1325Met) rs876658189
NM_000179.2(MSH6):c.3976A>T (p.Met1326Leu) rs587779939
NM_000179.2(MSH6):c.3977T>C (p.Met1326Thr) rs757089977
NM_000179.2(MSH6):c.3978G>C (p.Met1326Ile) rs141464646
NM_000179.2(MSH6):c.3979A>C (p.Asn1327His) rs756216566
NM_000179.2(MSH6):c.3980A>G (p.Asn1327Ser) rs780187989
NM_000179.2(MSH6):c.3980_3983dup (p.Leu1330fs) rs1553333738
NM_000179.2(MSH6):c.3983A>G (p.Gln1328Arg) rs587779940
NM_000179.2(MSH6):c.3983A>T (p.Gln1328Leu) rs587779940
NM_000179.2(MSH6):c.3986C>T (p.Ser1329Leu) rs199594809
NM_000179.2(MSH6):c.3988C>T (p.Leu1330=) rs768944975
NM_000179.2(MSH6):c.3991C>T (p.Arg1331Ter) rs267608094
NM_000179.2(MSH6):c.3992G>A (p.Arg1331Gln) rs184131049
NM_000179.2(MSH6):c.399T>C (p.Phe133=) rs1057522556
NM_000179.2(MSH6):c.3G>T (p.Met1Ile) rs876660095
NM_000179.2(MSH6):c.4000C>T (p.Arg1334Trp) rs773763465
NM_000179.2(MSH6):c.4000_4001+17dup19 rs1064794929
NM_000179.2(MSH6):c.4001+11_4001+15dupAACTA rs587779302
NM_000179.2(MSH6):c.4001+11_4001+35delAACTATAATGGAATTATAACTAACT rs878853743
NM_000179.2(MSH6):c.4001+12_4001+15del rs267608132
NM_000179.2(MSH6):c.4001+12_4001+15dupACTA rs267608132
NM_000179.2(MSH6):c.4001+15_4001+35del21 rs576893678
NM_000179.2(MSH6):c.4001+48_4001+49insCTAACTGACCTTAAGTTTCAA
NM_000179.2(MSH6):c.4001+5C>G rs786202305
NM_000179.2(MSH6):c.4001G>A (p.Arg1334Gln) rs267608122
NM_000179.2(MSH6):c.4002-10T>A rs545466048
NM_000179.2(MSH6):c.4002-10T>G rs545466048
NM_000179.2(MSH6):c.4002-11_4002-10del rs59056100
NM_000179.2(MSH6):c.4002-13_4002-12insAA rs1553333941
NM_000179.2(MSH6):c.4002-14T>C rs587781041
NM_000179.2(MSH6):c.4002-16T>G rs1057520798
NM_000179.2(MSH6):c.4002-18T>C rs1553333928
NM_000179.2(MSH6):c.4002-19T>C rs730881821
NM_000179.2(MSH6):c.4002-20T>G rs370707739
NM_000179.2(MSH6):c.4002-22_4002-10delinsAAGGG rs878853744
NM_000179.2(MSH6):c.4002-4T>C rs370428032
NM_000179.2(MSH6):c.4002-5_4010dupTTAAGGGAAGTTTG rs876661108
NM_000179.2(MSH6):c.4002-8A>T rs778957100
NM_000179.2(MSH6):c.4002-9A>T rs755141440
NM_000179.2(MSH6):c.4004A>C (p.Glu1335Ala) rs564434147
NM_000179.2(MSH6):c.4016_4017dup (p.Ser1340fs) rs876661127
NM_000179.2(MSH6):c.4016dup (p.Ala1339_Ser1340insTer) rs1553333996
NM_000179.2(MSH6):c.4022_4077dup (p.Leu1360delinsLysGlyGlnLeuTer) rs1553334006
NM_000179.2(MSH6):c.4039G>C (p.Ala1347Pro) rs730881809
NM_000179.2(MSH6):c.4050C>T (p.Val1350=) rs1057523455
NM_000179.2(MSH6):c.4060C>T (p.Leu1354=) rs1057521054
NM_000179.2(MSH6):c.4062G>C (p.Leu1354=) rs863224335
NM_000179.2(MSH6):c.4064C>G (p.Thr1355Ser) rs863224627
NM_000179.2(MSH6):c.4067_4071inv (p.Leu1356_Ile1357delinsTer) rs1064793369
NM_000179.2(MSH6):c.4068G>C (p.Leu1356Phe) rs192740549
NM_000179.2(MSH6):c.4068_4071dup (p.Lys1358delinsAspTer) rs55740729
NM_000179.2(MSH6):c.4073_4080dup (p.Ter1361ArgextTer?) rs587782547
NM_000179.2(MSH6):c.4074G>A (p.Lys1358=) rs759392159
NM_000179.2(MSH6):c.4077_4080dup (p.Ter1361IleextTer?) rs575068534
NM_000179.2(MSH6):c.4079_4081dup (p.Leu1360dup) rs1553334041
NM_000179.2(MSH6):c.4081T>C (p.Ter1361Gln) rs765098678
NM_000179.2(MSH6):c.4082_*11del (p.Ter1361LeuextTer?) rs1064794082
NM_000179.2(MSH6):c.4082del (p.Leu1360_Ter1361insTer) rs1553334124
NM_000179.2(MSH6):c.4083_*1insCTAT rs1064796051
NM_000179.2(MSH6):c.4083_*3GACT[3] (p.Ter1361=) rs765313977
NM_000179.2(MSH6):c.408C>T (p.Asp136=) rs878853746
NM_000179.2(MSH6):c.415A>G (p.Thr139Ala) rs991924818
NM_000179.2(MSH6):c.419G>T (p.Arg140Met) rs876661293
NM_000179.2(MSH6):c.420G>A (p.Arg140=) rs1553410345
NM_000179.2(MSH6):c.427G>A (p.Val143Ile) rs876661110
NM_000179.2(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000179.2(MSH6):c.432C>T (p.Ser144=) rs1046304919
NM_000179.2(MSH6):c.443dup (p.Leu148fs) rs1060502875
NM_000179.2(MSH6):c.457+13A>G rs1800933
NM_000179.2(MSH6):c.457+14C>A rs267608033
NM_000179.2(MSH6):c.457+17C>T rs1553410394
NM_000179.2(MSH6):c.457+1delG rs876661125
NM_000179.2(MSH6):c.457+2dupT rs876661224
NM_000179.2(MSH6):c.457+7G>C rs781280171
NM_000179.2(MSH6):c.458-133A>G
NM_000179.2(MSH6):c.458-13C>A rs1057522695
NM_000179.2(MSH6):c.458-8C>G rs372091232
NM_000179.2(MSH6):c.458-9T>C
NM_000179.2(MSH6):c.458-9delT rs1064796117
NM_000179.2(MSH6):c.467C>G (p.Ser156Ter) rs63749873
NM_000179.2(MSH6):c.468_471del (p.Glu158fs) rs587779941
NM_000179.2(MSH6):c.469_470dup (p.Glu158fs) rs1553411392
NM_000179.2(MSH6):c.474A>G (p.Glu158=) rs878853747
NM_000179.2(MSH6):c.483G>A (p.Lys161=) rs63751030
NM_000179.2(MSH6):c.491A>C (p.His164Pro) rs146469162
NM_000179.2(MSH6):c.498C>T (p.Tyr166=) rs587779313
NM_000179.2(MSH6):c.503C>G (p.Ala168Gly) rs774162322
NM_000179.2(MSH6):c.504A>G (p.Ala168=) rs1057520319
NM_000179.2(MSH6):c.512A>G (p.Glu171Gly) rs876661145
NM_000179.2(MSH6):c.515T>C (p.Ile172Thr) rs587779942
NM_000179.2(MSH6):c.532C>T (p.Arg178Cys) rs730881813
NM_000179.2(MSH6):c.533G>A (p.Arg178His) rs786204186
NM_000179.2(MSH6):c.546C>T (p.Ala182=) rs1057522452
NM_000179.2(MSH6):c.548_551TAAA[1] (p.Asn184fs) rs1023534466
NM_000179.2(MSH6):c.558C>G (p.Asp186Glu) rs587779943
NM_000179.2(MSH6):c.577T>G (p.Leu193Val) rs587779944
NM_000179.2(MSH6):c.578del (p.Leu193fs) rs587782281
NM_000179.2(MSH6):c.57T>C (p.Asp19=) rs752794296
NM_000179.2(MSH6):c.599C>G (p.Ser200Ter) rs63751077
NM_000179.2(MSH6):c.59C>T (p.Ala20Val) rs63750664
NM_000179.2(MSH6):c.600_601AG[1] (p.Glu201fs) rs587779945
NM_000179.2(MSH6):c.603G>A (p.Glu201=) rs587779314
NM_000179.2(MSH6):c.604C>G (p.Pro202Ala) rs1064794301
NM_000179.2(MSH6):c.627+157A>G
NM_000179.2(MSH6):c.627+20C>G rs376929025
NM_000179.2(MSH6):c.627+20C>T rs376929025
NM_000179.2(MSH6):c.627+3G>A rs876659495
NM_000179.2(MSH6):c.627+3G>C rs876659495
NM_000179.2(MSH6):c.627+6A>G
NM_000179.2(MSH6):c.627+9C>T rs373155872
NM_000179.2(MSH6):c.628-12C>T rs752105994
NM_000179.2(MSH6):c.628-13C>G rs538280815
NM_000179.2(MSH6):c.628-13C>T rs538280815
NM_000179.2(MSH6):c.628-14T>G rs1282546478
NM_000179.2(MSH6):c.628-17C>A rs369971640
NM_000179.2(MSH6):c.628-188T>C
NM_000179.2(MSH6):c.628-18T>C rs752800026
NM_000179.2(MSH6):c.628-7C>T rs373129248
NM_000179.2(MSH6):c.628-8C>G rs767991179
NM_000179.2(MSH6):c.628-8C>T rs767991179
NM_000179.2(MSH6):c.628-9G>A rs748816043
NM_000179.2(MSH6):c.63C>G (p.Asn21Lys) rs876660097
NM_000179.2(MSH6):c.642C>G (p.Tyr214Ter) rs1800937
NM_000179.2(MSH6):c.644T>G (p.Val215Gly) rs587779946
NM_000179.2(MSH6):c.648_649delinsTT (p.Asp217Tyr) rs63750471
NM_000179.2(MSH6):c.650A>G (p.Asp217Gly) rs554012110
NM_000179.2(MSH6):c.651dup (p.Lys218Ter) rs63750955
NM_000179.2(MSH6):c.657T>C (p.Ser219=) rs1460925251
NM_000179.2(MSH6):c.660A>C (p.Glu220Asp) rs1800938
NM_000179.2(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000179.2(MSH6):c.663_667delinsTAC (p.Glu221fs) rs1553412090
NM_000179.2(MSH6):c.678_683del (p.Ser227_Glu228del) rs1064793553
NM_000179.2(MSH6):c.67G>A (p.Ala23Thr) rs730881810
NM_000179.2(MSH6):c.67G>C (p.Ala23Pro) rs730881810
NM_000179.2(MSH6):c.680G>A (p.Ser227Asn) rs587779317
NM_000179.2(MSH6):c.682G>A (p.Glu228Lys) rs587779947
NM_000179.2(MSH6):c.685G>A (p.Glu229Lys) rs876660694
NM_000179.2(MSH6):c.687G>A (p.Glu229=) rs758120391
NM_000179.2(MSH6):c.690A>G (p.Glu230=) rs1064795970
NM_000179.2(MSH6):c.694C>T (p.Gln232Ter) rs587779318
NM_000179.2(MSH6):c.698C>G (p.Pro233Arg) rs142949377
NM_000179.2(MSH6):c.69C>G (p.Ala23=) rs1057522077
NM_000179.2(MSH6):c.702_703insT (p.Thr235fs) rs730881826
NM_000179.2(MSH6):c.713C>A (p.Ser238Tyr) rs587782510
NM_000179.2(MSH6):c.718C>T (p.Arg240Ter) rs63750019
NM_000179.2(MSH6):c.719G>A (p.Arg240Gln) rs542848931
NM_000179.2(MSH6):c.727C>T (p.Arg243Cys) rs377216828
NM_000179.2(MSH6):c.728G>A (p.Arg243His) rs370157832
NM_000179.2(MSH6):c.729C>T (p.Arg243=) rs1553412161
NM_000179.2(MSH6):c.732A>G (p.Gln244=) rs774496371
NM_000179.2(MSH6):c.733A>T (p.Ile245Leu) rs762168786
NM_000179.2(MSH6):c.73G>T (p.Ala25Ser) rs267608026
NM_000179.2(MSH6):c.742C>T (p.Arg248Ter) rs63749980
NM_000179.2(MSH6):c.742del (p.Arg248fs) rs587781691
NM_000179.2(MSH6):c.743G>C (p.Arg248Pro) rs764870249
NM_000179.2(MSH6):c.749T>C (p.Val250Ala) rs587781275
NM_000179.2(MSH6):c.74C>T (p.Ala25Val) rs35462442
NM_000179.2(MSH6):c.751A>G (p.Ile251Val) rs554884560
NM_000179.2(MSH6):c.75C>G (p.Ala25=) rs1045981031
NM_000179.2(MSH6):c.762T>C (p.Ser254=) rs1553412191
NM_000179.2(MSH6):c.763G>A (p.Glu255Lys) rs876661129
NM_000179.2(MSH6):c.782C>T (p.Ser261Phe) rs876661250
NM_000179.2(MSH6):c.787G>C (p.Val263Leu) rs1064794127
NM_000179.2(MSH6):c.792A>C (p.Glu264Asp) rs876661253
NM_000179.2(MSH6):c.806C>T (p.Thr269Ile) rs587779322
NM_000179.2(MSH6):c.807T>C (p.Thr269=) rs1057522991
NM_000179.2(MSH6):c.817G>A (p.Gly273Arg) rs587779948
NM_000179.2(MSH6):c.817G>T (p.Gly273Ter) rs587779948
NM_000179.2(MSH6):c.821G>A (p.Ser274Asn) rs587779949
NM_000179.2(MSH6):c.822C>T (p.Ser274=) rs768654339
NM_000179.2(MSH6):c.831A>C (p.Glu277Asp) rs374486449
NM_000179.2(MSH6):c.836G>A (p.Ser279Asn) rs876661292
NM_000179.2(MSH6):c.840T>C (p.Ser280=) rs767974147
NM_000179.2(MSH6):c.846G>A (p.Val282=) rs573638836
NM_000179.2(MSH6):c.846G>C (p.Val282=) rs573638836
NM_000179.2(MSH6):c.849G>A (p.Gly283=) rs1057520439
NM_000179.2(MSH6):c.852T>C (p.Asp284=) rs1057520320
NM_000179.2(MSH6):c.853dup (p.Ser285fs) rs1553412289
NM_000179.2(MSH6):c.854G>T (p.Ser285Ile) rs63750878
NM_000179.2(MSH6):c.856G>T (p.Glu286Ter) rs1057520605
NM_000179.2(MSH6):c.864_865del (p.Gly289fs) rs1553412294
NM_000179.2(MSH6):c.866G>C (p.Gly289Ala) rs368318845
NM_000179.2(MSH6):c.866_867delinsAA (p.Gly289Glu) rs267608079
NM_000179.2(MSH6):c.867C>A (p.Gly289=) rs267608047
NM_000179.2(MSH6):c.87C>G (p.Arg29=) rs778354962
NM_000179.2(MSH6):c.883A>G (p.Lys295Glu) rs373958499
NM_000179.2(MSH6):c.884A>G (p.Lys295Arg) rs267608051
NM_000179.2(MSH6):c.892C>T (p.Arg298Ter) rs146816935
NM_000179.2(MSH6):c.893G>A (p.Arg298Gln) rs765237563
NM_000179.2(MSH6):c.898C>T (p.Arg300Trp) rs779858670
NM_000179.2(MSH6):c.899G>A (p.Arg300Gln) rs55760494
NM_000179.2(MSH6):c.905G>A (p.Arg302Lys) rs587781510
NM_000179.2(MSH6):c.905G>C (p.Arg302Thr) rs587781510
NM_000179.2(MSH6):c.908dup (p.Met303fs) rs1057517551
NM_000179.2(MSH6):c.910G>A (p.Val304Met) rs876661207
NM_000179.2(MSH6):c.921T>C (p.Asn307=) rs876659492
NM_000179.2(MSH6):c.926C>G (p.Ser309Cys) rs544222338
NM_000179.2(MSH6):c.930T>G (p.Leu310=) rs1456412042
NM_000179.2(MSH6):c.931A>G (p.Lys311Glu) rs1323987464
NM_000179.2(MSH6):c.933A>T (p.Lys311Asn) rs730881785
NM_000179.2(MSH6):c.93C>T (p.Gly31=) rs370817805
NM_000179.2(MSH6):c.942C>G (p.Ser314Arg) rs150440246
NM_000179.2(MSH6):c.945T>G (p.Ser315=) rs761581941
NM_000179.2(MSH6):c.94G>T (p.Gly32Cys) rs776859837
NM_000179.2(MSH6):c.950A>G (p.Lys317Arg) rs876661282
NM_000179.2(MSH6):c.952_962del (p.Glu318fs) rs1064793185
NM_000179.2(MSH6):c.956C>T (p.Thr319Met) rs188252826
NM_000179.2(MSH6):c.957G>A (p.Thr319=) rs375210430
NM_000179.2(MSH6):c.957G>C (p.Thr319=) rs375210430
NM_000179.2(MSH6):c.95G>A (p.Gly32Asp) rs771426932
NM_000179.2(MSH6):c.95G>T (p.Gly32Val) rs771426932
NM_000179.2(MSH6):c.960C>T (p.Pro320=) rs575325950
NM_000179.2(MSH6):c.966C>T (p.Ala322=) rs1231712557
NM_000179.2(MSH6):c.969C>G (p.Thr323=) rs903038441
NM_000179.2(MSH6):c.972A>C (p.Lys324Asn) rs876658610
NM_000179.2(MSH6):c.975A>G (p.Gln325=) rs193922345
NM_000179.2(MSH6):c.979A>G (p.Thr327Ala) rs730881814
NM_000179.2(MSH6):c.97C>G (p.Arg33Gly) rs730881811
NM_000179.2(MSH6):c.97C>T (p.Arg33Cys) rs730881811
NM_000179.2(MSH6):c.980C>G (p.Thr327Ser) rs369568820
NM_000179.2(MSH6):c.984C>G (p.Ser328Arg) rs138143769
NM_000179.2(MSH6):c.984C>T (p.Ser328=) rs138143769
NM_000179.2(MSH6):c.98G>C (p.Arg33Pro) rs878853751
NM_000179.2(MSH6):c.990A>G (p.Ser330=) rs1553412417
NM_000179.2(MSH6):c.998C>T (p.Thr333Ile) rs587781983
NM_000179.2(MSH6):c.999del (p.Lys334fs) rs1060502932
NM_000179.2:c.3557-4insT
NM_001281492.1(MSH6):c.3611+4_3611+8dup rs587782853

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.