ClinVar Miner

List of variants in gene MSH6 reported by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 2257
Download table as spreadsheet
HGVS dbSNP
NC_000002.11:g.(?_48010221)_(48010632_?)dup
NC_000002.11:g.(?_48010221)_(48032166_?)dup
NC_000002.11:g.(?_48010363)_(48010642_?)del
NC_000002.11:g.(?_48010363)_(48010642_?)dup
NC_000002.11:g.(?_48010363)_(48018272_?)del
NC_000002.11:g.(?_48010363)_(48018272_?)dup
NC_000002.11:g.(?_48010363)_(48034009_?)del
NC_000002.11:g.(?_48010363)_(48034009_?)dup
NC_000002.11:g.(?_48010367)_(48018268_?)del
NC_000002.11:g.(?_48010367)_(48034005_?)del
NC_000002.11:g.(?_48010367)_(48034005_?)dup
NC_000002.11:g.(?_48018056)_(48018272_?)del
NC_000002.11:g.(?_48018056)_(48028304_?)del
NC_000002.11:g.(?_48018060)_(48034005_?)dup
NC_000002.11:g.(?_48018066)_(48018262_?)del
NC_000002.11:g.(?_48018066)_(48028294_?)del
NC_000002.11:g.(?_48023027)_(48030830_?)del
NC_000002.11:g.(?_48025740)_(48028304_?)del
NC_000002.11:g.(?_48029101)_(48033445_?)del
NC_000002.11:g.(?_48030549)_(48032176_?)del
NC_000002.11:g.(?_48030553)_(48030830_?)del
NC_000002.11:g.(?_48030559)_(48032166_?)del
NC_000002.11:g.(?_48032039)_(48032856_?)del
NC_000002.11:g.(?_48032043)_(48032852_?)del
NM_000179.2 (MSH6):c.3984_3987dupGTCA (p.Leu1330Valfs) rs267608121
NM_000179.2(MSH6):c.(?_-1)_457+?del
NM_000179.2(MSH6):c.-152-?_4001+?dup
NM_000179.2(MSH6):c.-2G>T rs374748889
NM_000179.2(MSH6):c.1006A>C (p.Thr336Pro)
NM_000179.2(MSH6):c.1015G>C (p.Ala339Pro) rs772760681
NM_000179.2(MSH6):c.1016C>A (p.Ala339Asp) rs587780669
NM_000179.2(MSH6):c.1016C>G (p.Ala339Gly) rs587780669
NM_000179.2(MSH6):c.1016C>T (p.Ala339Val) rs587780669
NM_000179.2(MSH6):c.1019T>C (p.Phe340Ser) rs61753793
NM_000179.2(MSH6):c.1025C>G (p.Ala342Gly)
NM_000179.2(MSH6):c.1025C>T (p.Ala342Val) rs753617680
NM_000179.2(MSH6):c.1027C>T (p.Pro343Ser)
NM_000179.2(MSH6):c.1028C>T (p.Pro343Leu) rs548898238
NM_000179.2(MSH6):c.102C>A (p.Ala34=) rs201132087
NM_000179.2(MSH6):c.102C>T (p.Ala34=) rs201132087
NM_000179.2(MSH6):c.1030C>G (p.Gln344Glu) rs730881815
NM_000179.2(MSH6):c.1032A>C (p.Gln344His)
NM_000179.2(MSH6):c.1034A>G (p.Asn345Ser) rs864622377
NM_000179.2(MSH6):c.1035T>A (p.Asn345Lys) rs765166082
NM_000179.2(MSH6):c.1035T>C (p.Asn345=) rs765166082
NM_000179.2(MSH6):c.1035T>G (p.Asn345Lys) rs765166082
NM_000179.2(MSH6):c.1037C>G (p.Ser346Cys) rs567785169
NM_000179.2(MSH6):c.1037C>T (p.Ser346Phe) rs567785169
NM_000179.2(MSH6):c.1039_1040insC (p.Glu347fs) rs1553412441
NM_000179.2(MSH6):c.103_113del (p.Ala35fs)
NM_000179.2(MSH6):c.1043C>T (p.Ser348Phe) rs758432113
NM_000179.2(MSH6):c.1045C>G (p.Gln349Glu) rs863224473
NM_000179.2(MSH6):c.1045C>T (p.Gln349Ter) rs863224473
NM_000179.2(MSH6):c.1046A>G (p.Gln349Arg) rs869312797
NM_000179.2(MSH6):c.1049C>T (p.Ala350Val) rs587782331
NM_000179.2(MSH6):c.104C>T (p.Ala35Val) rs776547943
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.1053C>A (p.His351Gln) rs28903083
NM_000179.2(MSH6):c.1053C>T (p.His351=) rs28903083
NM_000179.2(MSH6):c.1054G>A (p.Val352Ile) rs730881787
NM_000179.2(MSH6):c.105C>T (p.Ala35=) rs998365223
NM_000179.2(MSH6):c.1061G>T (p.Gly354Val) rs730881788
NM_000179.2(MSH6):c.1063G>A (p.Gly355Ser) rs587778531
NM_000179.2(MSH6):c.1063G>C (p.Gly355Arg) rs587778531
NM_000179.2(MSH6):c.1064G>A (p.Gly355Asp)
NM_000179.2(MSH6):c.1065T>C (p.Gly355=) rs984907158
NM_000179.2(MSH6):c.1068T>C (p.Gly356=) rs749752524
NM_000179.2(MSH6):c.1069G>A (p.Asp357Asn) rs771529531
NM_000179.2(MSH6):c.1075A>G (p.Ser359Gly) rs1553412468
NM_000179.2(MSH6):c.1076G>A (p.Ser359Asn) rs1278591662
NM_000179.2(MSH6):c.1078A>C (p.Ser360Arg) rs145994565
NM_000179.2(MSH6):c.1078A>G (p.Ser360Gly) rs145994565
NM_000179.2(MSH6):c.1079G>T (p.Ser360Ile) rs267608060
NM_000179.2(MSH6):c.107C>T (p.Ala36Val) rs61756469
NM_000179.2(MSH6):c.1081C>T (p.Arg361Cys) rs587782651
NM_000179.2(MSH6):c.1082G>A (p.Arg361His) rs63750440
NM_000179.2(MSH6):c.1087_1089dup (p.Thr363dup) rs1060502874
NM_000179.2(MSH6):c.1090G>A (p.Val364Ile) rs1437629945
NM_000179.2(MSH6):c.1094G>C (p.Trp365Ser) rs587780558
NM_000179.2(MSH6):c.10C>T (p.Gln4Ter) rs786201042
NM_000179.2(MSH6):c.1102_1162dup (p.His388delinsArgAsnPheArgMetAlaTer) rs1553412502
NM_000179.2(MSH6):c.1103A>G (p.Glu368Gly)
NM_000179.2(MSH6):c.1106C>G (p.Thr369Ser) rs375974046
NM_000179.2(MSH6):c.1106C>T (p.Thr369Ile) rs375974046
NM_000179.2(MSH6):c.1108_1109delTT (p.Leu370Argfs) rs786204252
NM_000179.2(MSH6):c.1109T>C (p.Leu370Ser) rs587779204
NM_000179.2(MSH6):c.110C>T (p.Ala37Val) rs763104308
NM_000179.2(MSH6):c.1111G>A (p.Glu371Lys) rs1336187952
NM_000179.2(MSH6):c.1115G>C (p.Trp372Ser) rs1114167731
NM_000179.2(MSH6):c.1117C>T (p.Leu373Phe) rs1060502915
NM_000179.2(MSH6):c.111C>A (p.Ala37=) rs1011670864
NM_000179.2(MSH6):c.111C>T (p.Ala37=) rs1011670864
NM_000179.2(MSH6):c.1120A>G (p.Lys374Glu) rs1558660575
NM_000179.2(MSH6):c.1120_1122del (p.Lys374del) rs587781660
NM_000179.2(MSH6):c.1125G>A (p.Glu375=) rs1060504741
NM_000179.2(MSH6):c.1127A>G (p.Glu376Gly) rs764150912
NM_000179.2(MSH6):c.1130A>C (p.Lys377Thr) rs550221570
NM_000179.2(MSH6):c.1130_1134AGAGA[1] (p.Arg378_Arg379insTer) rs267608077
NM_000179.2(MSH6):c.1131G>T (p.Lys377Asn) rs878853699
NM_000179.2(MSH6):c.1132A>C (p.Arg378=) rs781572949
NM_000179.2(MSH6):c.1133G>A (p.Arg378Lys) rs587779205
NM_000179.2(MSH6):c.1134A>C (p.Arg378Ser) rs878853700
NM_000179.2(MSH6):c.1139A>T (p.Asp380Val) rs1114167779
NM_000179.2(MSH6):c.1139_1143del (p.Asp380fs) rs587779206
NM_000179.2(MSH6):c.113C>T (p.Pro38Leu) rs1553408211
NM_000179.2(MSH6):c.1140T>C (p.Asp380=) rs1553412534
NM_000179.2(MSH6):c.1141G>A (p.Glu381Lys) rs142111387
NM_000179.2(MSH6):c.1144C>T (p.His382Tyr) rs587779207
NM_000179.2(MSH6):c.1145A>C (p.His382Pro) rs1558660701
NM_000179.2(MSH6):c.1146C>G (p.His382Gln)
NM_000179.2(MSH6):c.1149G>T (p.Arg383Ser) rs749800983
NM_000179.2(MSH6):c.1151G>A (p.Arg384Lys) rs730881789
NM_000179.2(MSH6):c.1151G>T (p.Arg384Met) rs730881789
NM_000179.2(MSH6):c.1153A>C (p.Arg385=) rs781652274
NM_000179.2(MSH6):c.1153A>T (p.Arg385Trp)
NM_000179.2(MSH6):c.1158T>G (p.Pro386=) rs1553412550
NM_000179.2(MSH6):c.1159G>A (p.Asp387Asn) rs746532720
NM_000179.2(MSH6):c.115G>A (p.Gly39Arg) rs751838296
NM_000179.2(MSH6):c.115G>C (p.Gly39Arg) rs751838296
NM_000179.2(MSH6):c.1162C>G (p.His388Asp) rs770386388
NM_000179.2(MSH6):c.1163A>C (p.His388Pro) rs786201185
NM_000179.2(MSH6):c.1164C>T (p.His388=) rs55708305
NM_000179.2(MSH6):c.1167C>T (p.Pro389=) rs1042819
NM_000179.2(MSH6):c.1168G>A (p.Asp390Asn) rs147737737
NM_000179.2(MSH6):c.1168G>T (p.Asp390Tyr) rs147737737
NM_000179.2(MSH6):c.1168_1170delinsAA (p.Asp390fs) rs863225398
NM_000179.2(MSH6):c.116G>A (p.Gly39Glu) rs1042821
NM_000179.2(MSH6):c.116G>C (p.Gly39Ala) rs1042821
NM_000179.2(MSH6):c.1170T>C (p.Asp390=) rs55882234
NM_000179.2(MSH6):c.1175A>T (p.Asp392Val) rs1064794625
NM_000179.2(MSH6):c.1176T>C (p.Asp392=) rs587779912
NM_000179.2(MSH6):c.1178C>G (p.Ala393Gly) rs764110569
NM_000179.2(MSH6):c.117G>A (p.Gly39=) rs756673077
NM_000179.2(MSH6):c.1180T>C (p.Ser394Pro) rs1553412587
NM_000179.2(MSH6):c.1181C>A (p.Ser394Tyr) rs1410933611
NM_000179.2(MSH6):c.1182T>C (p.Ser394=) rs863224325
NM_000179.2(MSH6):c.1183A>G (p.Thr395Ala) rs1553412594
NM_000179.2(MSH6):c.1184C>T (p.Thr395Ile) rs767658494
NM_000179.2(MSH6):c.1186C>G (p.Leu396Val) rs2020908
NM_000179.2(MSH6):c.1188C>T (p.Leu396=) rs786202626
NM_000179.2(MSH6):c.1189T>C (p.Tyr397His) rs587779913
NM_000179.2(MSH6):c.118G>A (p.Ala40Thr) rs754231971
NM_000179.2(MSH6):c.118G>C (p.Ala40Pro) rs754231971
NM_000179.2(MSH6):c.118G>T (p.Ala40Ser) rs754231971
NM_000179.2(MSH6):c.1190A>C (p.Tyr397Ser) rs63750065
NM_000179.2(MSH6):c.1190A>G (p.Tyr397Cys) rs63750065
NM_000179.2(MSH6):c.1191T>C (p.Tyr397=) rs786201269
NM_000179.2(MSH6):c.1192G>C (p.Val398Leu)
NM_000179.2(MSH6):c.1194G>A (p.Val398=) rs148116863
NM_000179.2(MSH6):c.1196C>T (p.Pro399Leu) rs878853701
NM_000179.2(MSH6):c.11A>G (p.Gln4Arg)
NM_000179.2(MSH6):c.1200G>A (p.Glu400=) rs536884553
NM_000179.2(MSH6):c.1206C>T (p.Phe402=) rs779504190
NM_000179.2(MSH6):c.1207C>T (p.Leu403Phe) rs876659223
NM_000179.2(MSH6):c.1209C>G (p.Leu403=) rs748603803
NM_000179.2(MSH6):c.1209C>T (p.Leu403=) rs748603803
NM_000179.2(MSH6):c.120C>G (p.Ala40=) rs777101467
NM_000179.2(MSH6):c.1211A>G (p.Asn404Ser) rs768740986
NM_000179.2(MSH6):c.1214C>G (p.Ser405Cys) rs730881790
NM_000179.2(MSH6):c.1216T>C (p.Cys406Arg) rs1064794198
NM_000179.2(MSH6):c.1216T>G (p.Cys406Gly) rs1064794198
NM_000179.2(MSH6):c.1222C>T (p.Pro408Ser) rs1553412644
NM_000179.2(MSH6):c.1223C>G (p.Pro408Arg) rs767404845
NM_000179.2(MSH6):c.1223del (p.Pro408fs) rs1553412649
NM_000179.2(MSH6):c.1231A>T (p.Arg411Trp) rs202219685
NM_000179.2(MSH6):c.1233G>C (p.Arg411Ser)
NM_000179.2(MSH6):c.1236G>A (p.Lys412=) rs1553412665
NM_000179.2(MSH6):c.1238G>C (p.Trp413Ser) rs786201049
NM_000179.2(MSH6):c.1239G>C (p.Trp413Cys) rs1114167736
NM_000179.2(MSH6):c.1241G>A (p.Trp414Ter) rs587779914
NM_000179.2(MSH6):c.1241G>T (p.Trp414Leu)
NM_000179.2(MSH6):c.1243C>T (p.Gln415Ter) rs1114167756
NM_000179.2(MSH6):c.1245G>A (p.Gln415=) rs769418914
NM_000179.2(MSH6):c.1248T>G (p.Ile416Met)
NM_000179.2(MSH6):c.1248dup (p.Lys417Ter)
NM_000179.2(MSH6):c.124C>G (p.Pro42Ala) rs34014629
NM_000179.2(MSH6):c.124C>T (p.Pro42Ser) rs34014629
NM_000179.2(MSH6):c.1255C>G (p.Gln419Glu) rs762814792
NM_000179.2(MSH6):c.1264G>T (p.Asp422Tyr)
NM_000179.2(MSH6):c.1267C>A (p.Leu423Ile) rs587781657
NM_000179.2(MSH6):c.1267C>G (p.Leu423Val) rs587781657
NM_000179.2(MSH6):c.1269T>G (p.Leu423=) rs774457540
NM_000179.2(MSH6):c.1270G>A (p.Val424Ile) rs768299607
NM_000179.2(MSH6):c.1272C>A (p.Val424=) rs63751452
NM_000179.2(MSH6):c.1272C>G (p.Val424=) rs63751452
NM_000179.2(MSH6):c.1272C>T (p.Val424=) rs63751452
NM_000179.2(MSH6):c.1275C>A (p.Ile425=) rs786203122
NM_000179.2(MSH6):c.1281C>G (p.Tyr427Ter)
NM_000179.2(MSH6):c.1282A>G (p.Lys428Glu) rs761822293
NM_000179.2(MSH6):c.1293A>G (p.Lys431=) rs1553412731
NM_000179.2(MSH6):c.1295T>C (p.Phe432Ser) rs750528093
NM_000179.2(MSH6):c.1295T>G (p.Phe432Cys)
NM_000179.2(MSH6):c.1295_1296insAA (p.Phe432fs) rs1060502946
NM_000179.2(MSH6):c.1296T>G (p.Phe432Leu) rs863224614
NM_000179.2(MSH6):c.1299del (p.Phe432_Tyr433insTer) rs1553412735
NM_000179.2(MSH6):c.1304T>C (p.Leu435Pro) rs63751405
NM_000179.2(MSH6):c.1308C>G (p.Tyr436Ter) rs761037236
NM_000179.2(MSH6):c.1308C>T (p.Tyr436=) rs761037236
NM_000179.2(MSH6):c.130C>A (p.Pro44Thr) rs1558645097
NM_000179.2(MSH6):c.1312A>G (p.Met438Val) rs1553412742
NM_000179.2(MSH6):c.1316A>G (p.Asp439Gly) rs786202363
NM_000179.2(MSH6):c.131C>T (p.Pro44Leu) rs863224615
NM_000179.2(MSH6):c.1321C>G (p.Leu441Val) rs1553412749
NM_000179.2(MSH6):c.1321C>T (p.Leu441Phe) rs1553412749
NM_000179.2(MSH6):c.1323_1324insCAAA (p.Ile442fs) rs1558661368
NM_000179.2(MSH6):c.1325T>C (p.Ile442Thr) rs587779210
NM_000179.2(MSH6):c.1326del (p.Ile442fs) rs1558661380
NM_000179.2(MSH6):c.1328dup (p.Val444fs) rs1553412755
NM_000179.2(MSH6):c.1333_1334del (p.Val444_Ser445insTer) rs1060502940
NM_000179.2(MSH6):c.1335T>G (p.Ser445Arg)
NM_000179.2(MSH6):c.1339C>T (p.Leu447=) rs369709529
NM_000179.2(MSH6):c.133G>C (p.Gly45Arg) rs978968846
NM_000179.2(MSH6):c.1343G>A (p.Gly448Glu) rs1553412772
NM_000179.2(MSH6):c.1345C>T (p.Leu449=) rs3136333
NM_000179.2(MSH6):c.1346T>C (p.Leu449Pro) rs63750741
NM_000179.2(MSH6):c.1347G>A (p.Leu449=) rs786201760
NM_000179.2(MSH6):c.1347G>T (p.Leu449=) rs786201760
NM_000179.2(MSH6):c.1348G>T (p.Val450Leu) rs878993430
NM_000179.2(MSH6):c.1349T>C (p.Val450Ala) rs1064794705
NM_000179.2(MSH6):c.1350_1351del (p.Phe451fs) rs878853702
NM_000179.2(MSH6):c.1351T>C (p.Phe451Leu) rs1558661442
NM_000179.2(MSH6):c.1352del (p.Phe451fs) rs869312769
NM_000179.2(MSH6):c.1359A>G (p.Lys453=) rs864622147
NM_000179.2(MSH6):c.135C>A (p.Gly45=) rs876659020
NM_000179.2(MSH6):c.1364A>C (p.Asn455Thr) rs200938360
NM_000179.2(MSH6):c.1367G>A (p.Trp456Ter) rs587780538
NM_000179.2(MSH6):c.136G>A (p.Gly46Arg) rs863224616
NM_000179.2(MSH6):c.136G>C (p.Gly46Arg) rs863224616
NM_000179.2(MSH6):c.136_260+1875del
NM_000179.2(MSH6):c.1376C>G (p.Ser459Cys) rs587782346
NM_000179.2(MSH6):c.1379G>A (p.Gly460Asp)
NM_000179.2(MSH6):c.1382T>G (p.Phe461Cys) rs1064793187
NM_000179.2(MSH6):c.1384C>A (p.Pro462Thr) rs876658726
NM_000179.2(MSH6):c.1385C>T (p.Pro462Leu) rs1558661506
NM_000179.2(MSH6):c.1387G>T (p.Glu463Ter) rs864622435
NM_000179.2(MSH6):c.1390A>T (p.Ile464Phe) rs201892477
NM_000179.2(MSH6):c.1394C>T (p.Ala465Val) rs1553412811
NM_000179.2(MSH6):c.1395A>T (p.Ala465=) rs1057520322
NM_000179.2(MSH6):c.1402C>T (p.Arg468Cys) rs369456858
NM_000179.2(MSH6):c.1403G>A (p.Arg468His) rs41295268
NM_000179.2(MSH6):c.1403G>C (p.Arg468Pro) rs41295268
NM_000179.2(MSH6):c.1406A>G (p.Tyr469Cys) rs748165218
NM_000179.2(MSH6):c.1406A>T (p.Tyr469Phe)
NM_000179.2(MSH6):c.1407T>C (p.Tyr469=) rs587781408
NM_000179.2(MSH6):c.1410A>G (p.Ser470=) rs863224326
NM_000179.2(MSH6):c.1415C>G (p.Ser472Cys) rs864622741
NM_000179.2(MSH6):c.1417C>G (p.Leu473Val) rs1060502924
NM_000179.2(MSH6):c.1419G>T (p.Leu473=) rs864622535
NM_000179.2(MSH6):c.1421_1422dup (p.Gln475fs) rs63750854
NM_000179.2(MSH6):c.1423C>T (p.Gln475Ter) rs1553412835
NM_000179.2(MSH6):c.1426A>G (p.Lys476Glu) rs1229494027
NM_000179.2(MSH6):c.1429G>A (p.Gly477Ser) rs1251859821
NM_000179.2(MSH6):c.1433A>G (p.Tyr478Cys) rs1343978618
NM_000179.2(MSH6):c.1434T>C (p.Tyr478=) rs1057521265
NM_000179.2(MSH6):c.143C>T (p.Ala48Val)
NM_000179.2(MSH6):c.1443A>G (p.Ala481=) rs878853703
NM_000179.2(MSH6):c.1444C>A (p.Arg482=) rs63750909
NM_000179.2(MSH6):c.1444C>T (p.Arg482Ter) rs63750909
NM_000179.2(MSH6):c.1445G>A (p.Arg482Gln) rs773226008
NM_000179.2(MSH6):c.1447G>C (p.Val483Leu) rs786204084
NM_000179.2(MSH6):c.1449G>T (p.Val483=) rs35590297
NM_000179.2(MSH6):c.1449_1462delinsAGC (p.Glu484fs) rs1114167715
NM_000179.2(MSH6):c.1450G>A (p.Glu484Lys) rs587782706
NM_000179.2(MSH6):c.1450G>C (p.Glu484Gln) rs587782706
NM_000179.2(MSH6):c.1452A>G (p.Glu484=) rs776633437
NM_000179.2(MSH6):c.1454A>C (p.Gln485Pro) rs1553412866
NM_000179.2(MSH6):c.1457C>G (p.Thr486Ser) rs577713548
NM_000179.2(MSH6):c.1457C>T (p.Thr486Ile)
NM_000179.2(MSH6):c.1460A>T (p.Glu487Val) rs1558661766
NM_000179.2(MSH6):c.1463C>A (p.Thr488Asn) rs1453645523
NM_000179.2(MSH6):c.1463C>T (p.Thr488Ile) rs1453645523
NM_000179.2(MSH6):c.1465C>G (p.Pro489Ala) rs1553412879
NM_000179.2(MSH6):c.146C>T (p.Ala49Val) rs775498550
NM_000179.2(MSH6):c.1471_1473ATG[1] (p.Met492del) rs587782576
NM_000179.2(MSH6):c.1474A>G (p.Met492Val) rs61754783
NM_000179.2(MSH6):c.1476G>T (p.Met492Ile)
NM_000179.2(MSH6):c.147C>T (p.Ala49=) rs768803986
NM_000179.2(MSH6):c.1480G>T (p.Ala494Ser) rs758699749
NM_000179.2(MSH6):c.1481C>T (p.Ala494Val) rs1264762735
NM_000179.2(MSH6):c.1483C>T (p.Arg495Ter) rs587779212
NM_000179.2(MSH6):c.1486T>C (p.Cys496Arg) rs1558661860
NM_000179.2(MSH6):c.1487G>A (p.Cys496Tyr) rs764593111
NM_000179.2(MSH6):c.148T>C (p.Trp50Arg) rs374597395
NM_000179.2(MSH6):c.1494G>C (p.Lys498Asn)
NM_000179.2(MSH6):c.1495A>G (p.Met499Val) rs1114167745
NM_000179.2(MSH6):c.1496T>C (p.Met499Thr)
NM_000179.2(MSH6):c.1498G>A (p.Ala500Thr) rs786204127
NM_000179.2(MSH6):c.1499C>T (p.Ala500Val) rs1114167795
NM_000179.2(MSH6):c.14G>A (p.Ser5Asn) rs532585602
NM_000179.2(MSH6):c.1501C>T (p.His501Tyr) rs779411998
NM_000179.2(MSH6):c.1505T>C (p.Ile502Thr) rs749012012
NM_000179.2(MSH6):c.1508C>G (p.Ser503Cys) rs63750897
NM_000179.2(MSH6):c.1509C>T (p.Ser503=) rs545020313
NM_000179.2(MSH6):c.150G>C (p.Trp50Cys) rs876659674
NM_000179.2(MSH6):c.1510A>C (p.Lys504Gln) rs1553412902
NM_000179.2(MSH6):c.1512del (p.Lys504fs)
NM_000179.2(MSH6):c.1513T>C (p.Tyr505His) rs1558661932
NM_000179.2(MSH6):c.1515T>A (p.Tyr505Ter)
NM_000179.2(MSH6):c.1515T>C (p.Tyr505=) rs878853704
NM_000179.2(MSH6):c.1515T>G (p.Tyr505Ter)
NM_000179.2(MSH6):c.1519A>G (p.Arg507Gly) rs1553412915
NM_000179.2(MSH6):c.151A>G (p.Ser51Gly) rs1553408276
NM_000179.2(MSH6):c.1524G>A (p.Val508=) rs878853705
NM_000179.2(MSH6):c.1524G>C (p.Val508=) rs878853705
NM_000179.2(MSH6):c.1525G>C (p.Val509Leu) rs876660317
NM_000179.2(MSH6):c.1526T>C (p.Val509Ala) rs63751005
NM_000179.2(MSH6):c.1527G>A (p.Val509=) rs878853706
NM_000179.2(MSH6):c.1528_1530AGG[1] (p.Arg511del) rs993163672
NM_000179.2(MSH6):c.1529G>A (p.Arg510Lys) rs864622572
NM_000179.2(MSH6):c.1530G>A (p.Arg510=) rs1060504758
NM_000179.2(MSH6):c.1534G>A (p.Glu512Lys)
NM_000179.2(MSH6):c.1535A>G (p.Glu512Gly) rs1060502930
NM_000179.2(MSH6):c.1537A>G (p.Ile513Val) rs746897461
NM_000179.2(MSH6):c.1538T>C (p.Ile513Thr) rs1060502908
NM_000179.2(MSH6):c.153C>G (p.Ser51Arg) rs762061869
NM_000179.2(MSH6):c.154G>C (p.Glu52Gln)
NM_000179.2(MSH6):c.1554C>T (p.Thr518=) rs786201471
NM_000179.2(MSH6):c.1556A>G (p.Lys519Arg) rs1285168531
NM_000179.2(MSH6):c.1558G>A (p.Gly520Ser) rs1558662076
NM_000179.2(MSH6):c.155A>T (p.Glu52Val) rs878853707
NM_000179.2(MSH6):c.1560T>C (p.Gly520=) rs762396230
NM_000179.2(MSH6):c.1561A>C (p.Thr521Pro)
NM_000179.2(MSH6):c.1561A>T (p.Thr521Ser) rs587779916
NM_000179.2(MSH6):c.1563A>G (p.Thr521=) rs1553412952
NM_000179.2(MSH6):c.1564C>A (p.Gln522Lys) rs878853708
NM_000179.2(MSH6):c.1565A>G (p.Gln522Arg) rs63751009
NM_000179.2(MSH6):c.1567A>C (p.Thr523Pro)
NM_000179.2(MSH6):c.1569_1570del (p.Tyr524fs) rs1553412960
NM_000179.2(MSH6):c.156G>A (p.Glu52=) rs1553408285
NM_000179.2(MSH6):c.1570_1571insC (p.Tyr524fs) rs878853709
NM_000179.2(MSH6):c.1571dup (p.Tyr524Ter) rs1553412966
NM_000179.2(MSH6):c.1572C>A (p.Tyr524Ter) rs587779215
NM_000179.2(MSH6):c.1572C>G (p.Tyr524Ter) rs587779215
NM_000179.2(MSH6):c.1572_1573del (p.Tyr524_Ser525delinsTer) rs1114167702
NM_000179.2(MSH6):c.1576G>A (p.Val526Met) rs1060502899
NM_000179.2(MSH6):c.1581G>A (p.Leu527=) rs775618855
NM_000179.2(MSH6):c.1581G>T (p.Leu527=) rs775618855
NM_000179.2(MSH6):c.1586G>C (p.Gly529Ala)
NM_000179.2(MSH6):c.1586G>T (p.Gly529Val) rs786201964
NM_000179.2(MSH6):c.1591C>A (p.Pro531Thr) rs201721694
NM_000179.2(MSH6):c.1594T>C (p.Ser532Pro) rs1558662224
NM_000179.2(MSH6):c.1599G>C (p.Glu533Asp) rs373726731
NM_000179.2(MSH6):c.159_164TGGGCC[3] (p.54_55GP[3]) rs767894453
NM_000179.2(MSH6):c.1602C>G (p.Asn534Lys) rs763712971
NM_000179.2(MSH6):c.1604A>G (p.Tyr535Cys)
NM_000179.2(MSH6):c.1606A>G (p.Ser536Gly)
NM_000179.2(MSH6):c.1606_1609AGTA[1] (p.Lys537fs) rs771764652
NM_000179.2(MSH6):c.1607G>A (p.Ser536Asn) rs587782352
NM_000179.2(MSH6):c.1607G>C (p.Ser536Thr) rs587782352
NM_000179.2(MSH6):c.1608dup (p.Lys537Ter)
NM_000179.2(MSH6):c.1609A>G (p.Lys537Glu) rs753276270
NM_000179.2(MSH6):c.1615C>T (p.Leu539Phe) rs1553412999
NM_000179.2(MSH6):c.1615_1617CTT[1] (p.Leu540del) rs1064793600
NM_000179.2(MSH6):c.1616T>A (p.Leu539His)
NM_000179.2(MSH6):c.1618C>A (p.Leu540Ile) rs201996928
NM_000179.2(MSH6):c.1618C>G (p.Leu540Val) rs201996928
NM_000179.2(MSH6):c.1618C>T (p.Leu540Phe)
NM_000179.2(MSH6):c.161G>C (p.Gly54Ala) rs63751098
NM_000179.2(MSH6):c.1621A>G (p.Ser541Gly)
NM_000179.2(MSH6):c.1623C>T (p.Ser541=) rs777678406
NM_000179.2(MSH6):c.1633A>G (p.Lys545Glu) rs1064793403
NM_000179.2(MSH6):c.1634_1635del (p.Lys545fs) rs267608064
NM_000179.2(MSH6):c.1634_1637del (p.Lys545fs) rs63749874
NM_000179.2(MSH6):c.1635_1636AG[1] (p.Glu546fs) rs267608076
NM_000179.2(MSH6):c.1637A>G (p.Glu546Gly) rs373554374
NM_000179.2(MSH6):c.1640A>G (p.Glu547Gly) rs1553413026
NM_000179.2(MSH6):c.1646C>A (p.Ser549Tyr) rs200447622
NM_000179.2(MSH6):c.1646C>G (p.Ser549Cys) rs200447622
NM_000179.2(MSH6):c.1649C>G (p.Ser550Cys) rs878853710
NM_000179.2(MSH6):c.1649C>T (p.Ser550Phe) rs878853710
NM_000179.2(MSH6):c.1649_1651del (p.Ser550_Gly551delinsCys) rs1558662438
NM_000179.2(MSH6):c.164C>A (p.Pro55His) rs1342218617
NM_000179.2(MSH6):c.164_177del (p.Pro55fs) rs1558645195
NM_000179.2(MSH6):c.1652G>A (p.Gly551Asp) rs587779917
NM_000179.2(MSH6):c.1656T>A (p.His552Gln) rs745937181
NM_000179.2(MSH6):c.1658C>T (p.Thr553Ile) rs1553413038
NM_000179.2(MSH6):c.165T>C (p.Pro55=) rs1553408290
NM_000179.2(MSH6):c.1660C>T (p.Arg554Cys) rs775716798
NM_000179.2(MSH6):c.1661G>A (p.Arg554His) rs730881791
NM_000179.2(MSH6):c.1665A>G (p.Ala555=) rs146785465
NM_000179.2(MSH6):c.1666T>C (p.Tyr556His) rs1060502895
NM_000179.2(MSH6):c.1667A>G (p.Tyr556Cys) rs63751312
NM_000179.2(MSH6):c.1668T>C (p.Tyr556=) rs730882130
NM_000179.2(MSH6):c.166G>T (p.Gly56Trp) rs1254951576
NM_000179.2(MSH6):c.166_171dup (p.54_55GP[3]) rs786201776
NM_000179.2(MSH6):c.1674G>A (p.Val558=) rs762442338
NM_000179.2(MSH6):c.1677C>T (p.Cys559=) rs63749893
NM_000179.2(MSH6):c.1678T>C (p.Phe560Leu) rs863224617
NM_000179.2(MSH6):c.168G>T (p.Gly56=) rs1553408296
NM_000179.2(MSH6):c.1691C>A (p.Ser564Ter) rs864622153
NM_000179.2(MSH6):c.1691C>G (p.Ser564Ter) rs864622153
NM_000179.2(MSH6):c.1696G>A (p.Gly566Arg) rs63749973
NM_000179.2(MSH6):c.16A>C (p.Thr6Pro) rs200944853
NM_000179.2(MSH6):c.1700A>G (p.Lys567Arg) rs1558662651
NM_000179.2(MSH6):c.1700dup (p.Phe568fs) rs1553413074
NM_000179.2(MSH6):c.1701G>C (p.Lys567Asn) rs752435825
NM_000179.2(MSH6):c.1705T>C (p.Phe569Leu) rs1553413084
NM_000179.2(MSH6):c.1705T>G (p.Phe569Val) rs1553413084
NM_000179.2(MSH6):c.1705_1706del (p.Phe569fs) rs587783056
NM_000179.2(MSH6):c.1707C>T (p.Phe569=) rs1553413086
NM_000179.2(MSH6):c.1708A>G (p.Ile570Val) rs61748081
NM_000179.2(MSH6):c.170C>G (p.Pro57Arg) rs1064793657
NM_000179.2(MSH6):c.170C>T (p.Pro57Leu) rs1064793657
NM_000179.2(MSH6):c.1712G>A (p.Gly571Asp) rs863224618
NM_000179.2(MSH6):c.1713T>C (p.Gly571=) rs781019496
NM_000179.2(MSH6):c.1713T>G (p.Gly571=) rs781019496
NM_000179.2(MSH6):c.1716G>A (p.Gln572=) rs745772518
NM_000179.2(MSH6):c.1716G>T (p.Gln572His) rs745772518
NM_000179.2(MSH6):c.171del (p.Arg58fs) rs1553408306
NM_000179.2(MSH6):c.1722A>T (p.Ser574=) rs1553413102
NM_000179.2(MSH6):c.1723G>T (p.Asp575Tyr) rs863224619
NM_000179.2(MSH6):c.1729C>A (p.Arg577Ser) rs542838372
NM_000179.2(MSH6):c.1729C>G (p.Arg577Gly) rs542838372
NM_000179.2(MSH6):c.1729C>T (p.Arg577Cys) rs542838372
NM_000179.2(MSH6):c.172_177dup (p.Arg58_Pro59dup) rs876661161
NM_000179.2(MSH6):c.1730G>A (p.Arg577His) rs376220212
NM_000179.2(MSH6):c.1732C>G (p.His578Asp)
NM_000179.2(MSH6):c.1733A>G (p.His578Arg) rs1553413111
NM_000179.2(MSH6):c.1733A>T (p.His578Leu) rs1553413111
NM_000179.2(MSH6):c.1735T>C (p.Cys579Arg) rs1185721664
NM_000179.2(MSH6):c.1738del (p.Ser580fs) rs1553413116
NM_000179.2(MSH6):c.1739C>T (p.Ser580Leu) rs41295270
NM_000179.2(MSH6):c.1740G>A (p.Ser580=) rs762089407
NM_000179.2(MSH6):c.1740G>T (p.Ser580=) rs762089407
NM_000179.2(MSH6):c.1746T>G (p.Phe582Leu) rs201518545
NM_000179.2(MSH6):c.1746dup (p.Arg583Ter) rs863224474
NM_000179.2(MSH6):c.1747A>G (p.Arg583Gly) rs1558662808
NM_000179.2(MSH6):c.1752T>G (p.Thr584=) rs1114167777
NM_000179.2(MSH6):c.1753C>G (p.Leu585Val) rs1558662820
NM_000179.2(MSH6):c.1754T>C (p.Leu585Pro) rs587779220
NM_000179.2(MSH6):c.1756G>C (p.Val586Leu) rs1044963129
NM_000179.2(MSH6):c.1757T>C (p.Val586Ala) rs730881792
NM_000179.2(MSH6):c.1759G>A (p.Ala587Thr)
NM_000179.2(MSH6):c.175C>A (p.Pro59Thr) rs761033647
NM_000179.2(MSH6):c.175C>T (p.Pro59Ser) rs761033647
NM_000179.2(MSH6):c.1760C>T (p.Ala587Val) rs1060502907
NM_000179.2(MSH6):c.1763A>G (p.His588Arg) rs786202725
NM_000179.2(MSH6):c.1767T>A (p.Tyr589Ter) rs1558662873
NM_000179.2(MSH6):c.1767del (p.Pro591fs) rs1114167765
NM_000179.2(MSH6):c.1768C>A (p.Pro590Thr) rs1553413153
NM_000179.2(MSH6):c.1769C>T (p.Pro590Leu) rs587782635
NM_000179.2(MSH6):c.1770C>T (p.Pro590=) rs267608070
NM_000179.2(MSH6):c.1772C>A (p.Pro591Gln) rs1558662903
NM_000179.2(MSH6):c.1772C>T (p.Pro591Leu)
NM_000179.2(MSH6):c.1773A>G (p.Pro591=) rs752239740
NM_000179.2(MSH6):c.1776A>G (p.Val592=) rs56132616
NM_000179.2(MSH6):c.1776A>T (p.Val592=) rs56132616
NM_000179.2(MSH6):c.1784T>C (p.Leu595Ser) rs1553413170
NM_000179.2(MSH6):c.1785A>G (p.Leu595=) rs767325893
NM_000179.2(MSH6):c.1786T>A (p.Phe596Ile) rs587779918
NM_000179.2(MSH6):c.1787T>A (p.Phe596Tyr) rs1064793774
NM_000179.2(MSH6):c.1787T>C (p.Phe596Ser) rs1064793774
NM_000179.2(MSH6):c.178T>C (p.Leu60=) rs35819209
NM_000179.2(MSH6):c.1793A>G (p.Lys598Arg) rs587779919
NM_000179.2(MSH6):c.1794A>G (p.Lys598=) rs786201210
NM_000179.2(MSH6):c.1794dup (p.Gly599fs) rs587780670
NM_000179.2(MSH6):c.1795G>C (p.Gly599Arg) rs756043669
NM_000179.2(MSH6):c.1796G>C (p.Gly599Ala) rs1558663014
NM_000179.2(MSH6):c.1800T>C (p.Asn600=) rs876660238
NM_000179.2(MSH6):c.1801C>G (p.Leu601Val) rs1553413197
NM_000179.2(MSH6):c.1805C>A (p.Ser602Ter) rs730881816
NM_000179.2(MSH6):c.1805C>G (p.Ser602Ter) rs730881816
NM_000179.2(MSH6):c.1806A>C (p.Ser602=) rs1057520981
NM_000179.2(MSH6):c.1806_1809del (p.Glu604fs) rs63750735
NM_000179.2(MSH6):c.1814C>A (p.Thr605Asn)
NM_000179.2(MSH6):c.1814C>G (p.Thr605Ser) rs587781616
NM_000179.2(MSH6):c.1815_1816del (p.Lys606fs) rs1060502886
NM_000179.2(MSH6):c.1819del (p.Thr607fs)
NM_000179.2(MSH6):c.1820C>G (p.Thr607Arg) rs786201676
NM_000179.2(MSH6):c.1822A>G (p.Ile608Val) rs201613780
NM_000179.2(MSH6):c.1822A>T (p.Ile608Phe) rs201613780
NM_000179.2(MSH6):c.1827A>G (p.Leu609=) rs767064953
NM_000179.2(MSH6):c.182C>T (p.Ala61Val) rs572336612
NM_000179.2(MSH6):c.1830G>C (p.Lys610Asn) rs201735525
NM_000179.2(MSH6):c.1833T>G (p.Ser611Arg) rs1553413220
NM_000179.2(MSH6):c.1835C>G (p.Ser612Ter) rs63750564
NM_000179.2(MSH6):c.183G>C (p.Ala61=) rs1060504757
NM_000179.2(MSH6):c.1842del (p.Cys615fs) rs730881825
NM_000179.2(MSH6):c.1843T>C (p.Cys615Arg)
NM_000179.2(MSH6):c.1844G>C (p.Cys615Ser) rs730881793
NM_000179.2(MSH6):c.1844G>T (p.Cys615Phe) rs730881793
NM_000179.2(MSH6):c.1847C>G (p.Ser616Cys) rs772363120
NM_000179.2(MSH6):c.1847C>T (p.Ser616Phe) rs772363120
NM_000179.2(MSH6):c.1849C>T (p.Leu617Phe)
NM_000179.2(MSH6):c.184C>A (p.Arg62Ser) rs876659508
NM_000179.2(MSH6):c.184C>T (p.Arg62Cys) rs876659508
NM_000179.2(MSH6):c.1850T>G (p.Leu617Arg) rs1553413228
NM_000179.2(MSH6):c.1857A>C (p.Glu619Asp) rs63751121
NM_000179.2(MSH6):c.1858G>A (p.Gly620Ser) rs876661043
NM_000179.2(MSH6):c.185G>A (p.Arg62His) rs867979237
NM_000179.2(MSH6):c.185G>C (p.Arg62Pro) rs867979237
NM_000179.2(MSH6):c.185G>T (p.Arg62Leu) rs867979237
NM_000179.2(MSH6):c.1864A>C (p.Ile622Leu) rs587778529
NM_000179.2(MSH6):c.1866A>G (p.Ile622Met) rs1042817
NM_000179.2(MSH6):c.1867C>A (p.Pro623Thr) rs3136334
NM_000179.2(MSH6):c.1867C>G (p.Pro623Ala) rs3136334
NM_000179.2(MSH6):c.1868C>T (p.Pro623Leu) rs63750462
NM_000179.2(MSH6):c.1869C>T (p.Pro623=) rs141242295
NM_000179.2(MSH6):c.1870G>A (p.Gly624Ser) rs868760377
NM_000179.2(MSH6):c.1871G>A (p.Gly624Asp)
NM_000179.2(MSH6):c.1871G>T (p.Gly624Val) rs763606858
NM_000179.2(MSH6):c.1872C>A (p.Gly624=) rs1553413248
NM_000179.2(MSH6):c.1875C>T (p.Ser625=) rs63749886
NM_000179.2(MSH6):c.1876C>G (p.Gln626Glu) rs1553413253
NM_000179.2(MSH6):c.1878G>C (p.Gln626His) rs767285340
NM_000179.2(MSH6):c.187T>A (p.Ser63Thr) rs763702846
NM_000179.2(MSH6):c.187T>C (p.Ser63Pro) rs763702846
NM_000179.2(MSH6):c.187T>G (p.Ser63Ala) rs763702846
NM_000179.2(MSH6):c.1885G>T (p.Asp629Tyr) rs1064795030
NM_000179.2(MSH6):c.1887T>G (p.Asp629Glu)
NM_000179.2(MSH6):c.188C>A (p.Ser63Tyr) rs587779920
NM_000179.2(MSH6):c.188C>G (p.Ser63Cys) rs587779920
NM_000179.2(MSH6):c.1894A>G (p.Lys632Glu) rs755847154
NM_000179.2(MSH6):c.1898C>G (p.Thr633Ser) rs1553413271
NM_000179.2(MSH6):c.189C>T (p.Ser63=) rs917331457
NM_000179.2(MSH6):c.18C>T (p.Thr6=) rs909257611
NM_000179.2(MSH6):c.1901_1902del (p.Thr633_Leu634insTer) rs267608082
NM_000179.2(MSH6):c.1901dup (p.Leu634fs) rs587782638
NM_000179.2(MSH6):c.1904G>A (p.Arg635Lys) rs1558663439
NM_000179.2(MSH6):c.1907C>A (p.Thr636Asn) rs1553413281
NM_000179.2(MSH6):c.1907C>T (p.Thr636Ile) rs1553413281
NM_000179.2(MSH6):c.190G>A (p.Ala64Thr) rs587779921
NM_000179.2(MSH6):c.1911_1912delinsTG (p.Leu638Val) rs1553413293
NM_000179.2(MSH6):c.1912C>A (p.Leu638Ile)
NM_000179.2(MSH6):c.1912_1914del (p.Leu638del) rs1060502877
NM_000179.2(MSH6):c.1912del (p.Glu639fs) rs1553413294
NM_000179.2(MSH6):c.1913T>C (p.Leu638Pro) rs1553413298
NM_000179.2(MSH6):c.1914T>G (p.Leu638=) rs766310490
NM_000179.2(MSH6):c.1915G>A (p.Glu639Lys) rs143517321
NM_000179.2(MSH6):c.1917G>A (p.Glu639=) rs368059229
NM_000179.2(MSH6):c.1917G>C (p.Glu639Asp) rs368059229
NM_000179.2(MSH6):c.1918_1920GAA[1] (p.Glu641del) rs786203970
NM_000179.2(MSH6):c.1923del (p.Glu641fs) rs869040863
NM_000179.2(MSH6):c.1931G>C (p.Arg644Thr)
NM_000179.2(MSH6):c.1932G>C (p.Arg644Ser) rs34938432
NM_000179.2(MSH6):c.1933G>T (p.Glu645Ter) rs1064795591
NM_000179.2(MSH6):c.1935A>G (p.Glu645=) rs779019430
NM_000179.2(MSH6):c.1937A>G (p.Lys646Arg) rs201096652
NM_000179.2(MSH6):c.1938G>A (p.Lys646=) rs758631207
NM_000179.2(MSH6):c.1938G>C (p.Lys646Asn)
NM_000179.2(MSH6):c.193T>G (p.Ser65Ala) rs1553408350
NM_000179.2(MSH6):c.1945G>T (p.Asp649Tyr) rs1064793188
NM_000179.2(MSH6):c.1946A>G (p.Asp649Gly) rs777799551
NM_000179.2(MSH6):c.194C>T (p.Ser65Leu) rs41294984
NM_000179.2(MSH6):c.1950C>T (p.Gly650=) rs747380250
NM_000179.2(MSH6):c.1954G>T (p.Gly652Trp) rs1553413323
NM_000179.2(MSH6):c.1955G>A (p.Gly652Glu) rs1558663683
NM_000179.2(MSH6):c.1957G>A (p.Val653Met) rs768095444
NM_000179.2(MSH6):c.1957G>C (p.Val653Leu) rs768095444
NM_000179.2(MSH6):c.1968C>G (p.Pro656=) rs1553413333
NM_000179.2(MSH6):c.1969del (p.Gln657fs) rs876661205
NM_000179.2(MSH6):c.1970A>C (p.Gln657Pro) rs1459883720
NM_000179.2(MSH6):c.1970A>G (p.Gln657Arg) rs1459883720
NM_000179.2(MSH6):c.1972G>A (p.Val658Met) rs1553413340
NM_000179.2(MSH6):c.1974G>A (p.Val658=) rs372916347
NM_000179.2(MSH6):c.1978A>C (p.Lys660Gln) rs1060502894
NM_000179.2(MSH6):c.197C>A (p.Pro66Gln) rs730881812
NM_000179.2(MSH6):c.197C>T (p.Pro66Leu) rs730881812
NM_000179.2(MSH6):c.1982G>A (p.Gly661Asp) rs1553413342
NM_000179.2(MSH6):c.1983T>C (p.Gly661=) rs1411415960
NM_000179.2(MSH6):c.1984A>G (p.Met662Val) rs1060502935
NM_000179.2(MSH6):c.1989T>G (p.Thr663=) rs1057520324
NM_000179.2(MSH6):c.198G>C (p.Pro66=) rs1299712565
NM_000179.2(MSH6):c.198G>T (p.Pro66=) rs1299712565
NM_000179.2(MSH6):c.1990T>G (p.Ser664Ala) rs1558663809
NM_000179.2(MSH6):c.1991C>T (p.Ser664Leu) rs1553413355
NM_000179.2(MSH6):c.1995G>C (p.Glu665Asp) rs587778532
NM_000179.2(MSH6):c.1999G>C (p.Asp667His) rs151086192
NM_000179.2(MSH6):c.199C>A (p.Pro67Thr) rs878853712
NM_000179.2(MSH6):c.199C>T (p.Pro67Ser)
NM_000179.2(MSH6):c.19C>A (p.Leu7Met) rs1064795094
NM_000179.2(MSH6):c.19C>G (p.Leu7Val) rs1064795094
NM_000179.2(MSH6):c.2001T>A (p.Asp667Glu) rs1361745058
NM_000179.2(MSH6):c.2006T>C (p.Ile669Thr) rs555209664
NM_000179.2(MSH6):c.2010del (p.Gly670_Leu671insTer) rs1060502918
NM_000179.2(MSH6):c.2013G>A (p.Leu671=) rs765289515
NM_000179.2(MSH6):c.2013G>T (p.Leu671Phe) rs765289515
NM_000179.2(MSH6):c.2015C>T (p.Thr672Ile) rs1460598011
NM_000179.2(MSH6):c.2017C>G (p.Pro673Ala) rs377356882
NM_000179.2(MSH6):c.2017C>T (p.Pro673Ser) rs377356882
NM_000179.2(MSH6):c.2018C>T (p.Pro673Leu) rs864622085
NM_000179.2(MSH6):c.2019A>G (p.Pro673=) rs863224327
NM_000179.2(MSH6):c.2020_2147delinsTTGT (p.Gly674fs) rs1558663954
NM_000179.2(MSH6):c.2023G>A (p.Glu675Lys) rs878853713
NM_000179.2(MSH6):c.2024A>G (p.Glu675Gly)
NM_000179.2(MSH6):c.2025G>C (p.Glu675Asp) rs587779223
NM_000179.2(MSH6):c.2027A>G (p.Lys676Arg) rs143643688
NM_000179.2(MSH6):c.2028_2029del (p.Lys676_Ser677insTer) rs1064794055
NM_000179.2(MSH6):c.2030G>C (p.Ser677Thr) rs587779224
NM_000179.2(MSH6):c.2032G>C (p.Glu678Gln) rs751778243
NM_000179.2(MSH6):c.2035T>C (p.Leu679=) rs757741943
NM_000179.2(MSH6):c.2035T>G (p.Leu679Val)
NM_000179.2(MSH6):c.2039C>T (p.Ala680Val)
NM_000179.2(MSH6):c.203A>G (p.Lys68Arg) rs863224620
NM_000179.2(MSH6):c.2041C>G (p.Leu681Val)
NM_000179.2(MSH6):c.2041del (p.Leu681fs)
NM_000179.2(MSH6):c.2045C>G (p.Ser682Cys) rs587779225
NM_000179.2(MSH6):c.2048C>G (p.Ala683Gly) rs747699430
NM_000179.2(MSH6):c.2048C>T (p.Ala683Val)
NM_000179.2(MSH6):c.2049T>C (p.Ala683=) rs1553413418
NM_000179.2(MSH6):c.204G>A (p.Lys68=) rs864622565
NM_000179.2(MSH6):c.2050del (p.Ala683_Leu684insTer) rs1553413424
NM_000179.2(MSH6):c.2056G>T (p.Gly686Cys) rs1060502934
NM_000179.2(MSH6):c.2056_2060delinsCTTCTACCTCAAAAA (p.Gly686fs) rs878853711
NM_000179.2(MSH6):c.2057G>A (p.Gly686Asp) rs587779227
NM_000179.2(MSH6):c.205G>A (p.Ala69Thr) rs1382081255
NM_000179.2(MSH6):c.2060G>C (p.Cys687Ser) rs1553413433
NM_000179.2(MSH6):c.2061T>A (p.Cys687Ter) rs267608068
NM_000179.2(MSH6):c.2064C>G (p.Val688=) rs1057524297
NM_000179.2(MSH6):c.2065T>G (p.Phe689Val) rs1558664138
NM_000179.2(MSH6):c.2069A>T (p.Tyr690Phe) rs730881794
NM_000179.2(MSH6):c.206C>T (p.Ala69Val) rs1558645360
NM_000179.2(MSH6):c.2075A>G (p.Lys692Arg) rs975991506
NM_000179.2(MSH6):c.2079del (p.Lys693fs) rs267608083
NM_000179.2(MSH6):c.2079dup (p.Cys694fs) rs267608083
NM_000179.2(MSH6):c.207G>A (p.Ala69=) rs757025193
NM_000179.2(MSH6):c.207_209GAA[3] (p.Lys70dup) rs1553408369
NM_000179.2(MSH6):c.2080T>C (p.Cys694Arg) rs587779228
NM_000179.2(MSH6):c.2089G>C (p.Asp697His) rs1553413460
NM_000179.2(MSH6):c.2089del (p.Asp697fs) rs863224475
NM_000179.2(MSH6):c.208A>G (p.Lys70Glu) rs863224621
NM_000179.2(MSH6):c.2092C>G (p.Gln698Glu) rs63750832
NM_000179.2(MSH6):c.2098C>A (p.Leu700Ile) rs587779230
NM_000179.2(MSH6):c.2101T>C (p.Leu701=) rs1057523503
NM_000179.2(MSH6):c.2103A>G (p.Leu701=) rs764244124
NM_000179.2(MSH6):c.2105C>G (p.Ser702Ter) rs63751419
NM_000179.2(MSH6):c.2105C>T (p.Ser702Leu) rs63751419
NM_000179.2(MSH6):c.2107A>G (p.Met703Val) rs751867550
NM_000179.2(MSH6):c.2108T>C (p.Met703Thr) rs1064793189
NM_000179.2(MSH6):c.2112T>C (p.Ala704=) rs1553413481
NM_000179.2(MSH6):c.2118del (p.Phe706fs)
NM_000179.2(MSH6):c.211A>C (p.Asn71His) rs1558645379
NM_000179.2(MSH6):c.211A>G (p.Asn71Asp)
NM_000179.2(MSH6):c.2120A>G (p.Glu707Gly) rs1553413485
NM_000179.2(MSH6):c.2124A>G (p.Glu708=) rs781730324
NM_000179.2(MSH6):c.2126A>G (p.Tyr709Cys) rs1558664366
NM_000179.2(MSH6):c.2127T>A (p.Tyr709Ter) rs587779232
NM_000179.2(MSH6):c.212A>C (p.Asn71Thr) rs1553408375
NM_000179.2(MSH6):c.2131C>T (p.Pro711Ser) rs878853714
NM_000179.2(MSH6):c.2137G>A (p.Asp713Asn) rs876660123
NM_000179.2(MSH6):c.2137del (p.Asp713fs) rs864622257
NM_000179.2(MSH6):c.2141C>G (p.Ser714Cys) rs730881796
NM_000179.2(MSH6):c.2141C>T (p.Ser714Phe) rs730881796
NM_000179.2(MSH6):c.2142T>C (p.Ser714=) rs786201606
NM_000179.2(MSH6):c.2145C>G (p.Asp715Glu) rs1221484522
NM_000179.2(MSH6):c.2145_2146CA[1] (p.Thr716fs) rs786204048
NM_000179.2(MSH6):c.2146A>G (p.Thr716Ala) rs749711246
NM_000179.2(MSH6):c.2147C>T (p.Thr716Ile) rs587782805
NM_000179.2(MSH6):c.2149G>T (p.Val717Phe)
NM_000179.2(MSH6):c.2150_2153del (p.Val717fs) rs267608058
NM_000179.2(MSH6):c.2154C>T (p.Ser718=) rs771662801
NM_000179.2(MSH6):c.2156C>G (p.Thr719Ser)
NM_000179.2(MSH6):c.2156C>T (p.Thr719Ile) rs373418713
NM_000179.2(MSH6):c.2159C>T (p.Thr720Ile) rs185531778
NM_000179.2(MSH6):c.2161A>C (p.Arg721=) rs537604099
NM_000179.2(MSH6):c.2161A>G (p.Arg721Gly) rs537604099
NM_000179.2(MSH6):c.2162G>A (p.Arg721Lys)
NM_000179.2(MSH6):c.2162G>T (p.Arg721Ile) rs876660319
NM_000179.2(MSH6):c.2165C>T (p.Ser722Phe)
NM_000179.2(MSH6):c.2169T>G (p.Gly723=) rs769422122
NM_000179.2(MSH6):c.2171C>G (p.Ala724Gly) rs587779922
NM_000179.2(MSH6):c.2173A>G (p.Ile725Val) rs148898662
NM_000179.2(MSH6):c.2175C>G (p.Ile725Met) rs63750304
NM_000179.2(MSH6):c.2177T>A (p.Phe726Tyr) rs574358605
NM_000179.2(MSH6):c.2180C>A (p.Thr727Asn)
NM_000179.2(MSH6):c.2180C>G (p.Thr727Ser) rs767861096
NM_000179.2(MSH6):c.2181C>G (p.Thr727=) rs876659171
NM_000179.2(MSH6):c.2182A>G (p.Lys728Glu)
NM_000179.2(MSH6):c.2183A>C (p.Lys728Thr) rs35552856
NM_000179.2(MSH6):c.2183A>G (p.Lys728Arg) rs35552856
NM_000179.2(MSH6):c.2186C>G (p.Ala729Gly) rs1553413553
NM_000179.2(MSH6):c.2186C>T (p.Ala729Val) rs1553413553
NM_000179.2(MSH6):c.2187C>A (p.Ala729=) rs375610656
NM_000179.2(MSH6):c.2187C>T (p.Ala729=) rs375610656
NM_000179.2(MSH6):c.2189A>G (p.Tyr730Cys) rs587782900
NM_000179.2(MSH6):c.2189A>T (p.Tyr730Phe)
NM_000179.2(MSH6):c.2192A>T (p.Gln731Leu) rs1553413559
NM_000179.2(MSH6):c.2193A>G (p.Gln731=) rs1055190211
NM_000179.2(MSH6):c.2194C>A (p.Arg732=) rs63751127
NM_000179.2(MSH6):c.2194C>T (p.Arg732Ter) rs63751127
NM_000179.2(MSH6):c.2195G>A (p.Arg732Gln) rs749746725
NM_000179.2(MSH6):c.2197A>G (p.Met733Val) rs1355166868
NM_000179.2(MSH6):c.2199G>C (p.Met733Ile) rs1359474814
NM_000179.2(MSH6):c.219C>T (p.Asn73=) rs1060504756
NM_000179.2(MSH6):c.2200G>A (p.Val734Met) rs587780671
NM_000179.2(MSH6):c.2201T>A (p.Val734Glu) rs1060502883
NM_000179.2(MSH6):c.2203C>A (p.Leu735Ile) rs786204071
NM_000179.2(MSH6):c.2203C>G (p.Leu735Val) rs786204071
NM_000179.2(MSH6):c.220G>T (p.Gly74Ter) rs1553408388
NM_000179.2(MSH6):c.2210C>G (p.Ala737Gly) rs869312798
NM_000179.2(MSH6):c.2211A>C (p.Ala737=) rs780916013
NM_000179.2(MSH6):c.2223C>T (p.Asn741=) rs769668640
NM_000179.2(MSH6):c.2225A>C (p.Asn742Thr) rs878853715
NM_000179.2(MSH6):c.2225A>G (p.Asn742Ser) rs878853715
NM_000179.2(MSH6):c.2226C>G (p.Asn742Lys) rs587781739
NM_000179.2(MSH6):c.2227T>C (p.Leu743=) rs749308906
NM_000179.2(MSH6):c.222A>T (p.Gly74=) rs888377589
NM_000179.2(MSH6):c.2230dup (p.Glu744fs) rs786201050
NM_000179.2(MSH6):c.2233A>G (p.Ile745Val)
NM_000179.2(MSH6):c.2235T>G (p.Ile745Met) rs556339046
NM_000179.2(MSH6):c.2236T>C (p.Phe746Leu) rs1553413604
NM_000179.2(MSH6):c.2238dup (p.Leu747fs) rs1553413599
NM_000179.2(MSH6):c.2239C>T (p.Leu747=) rs63751305
NM_000179.2(MSH6):c.2239del (p.Phe746_Leu747insTer)
NM_000179.2(MSH6):c.2241G>A (p.Leu747=) rs377722465
NM_000179.2(MSH6):c.2241G>C (p.Leu747=) rs377722465
NM_000179.2(MSH6):c.2246G>A (p.Gly749Glu) rs1060502916
NM_000179.2(MSH6):c.2246G>T (p.Gly749Val) rs1060502916
NM_000179.2(MSH6):c.2249C>A (p.Thr750Lys) rs730881817
NM_000179.2(MSH6):c.2250A>C (p.Thr750=) rs1060504746
NM_000179.2(MSH6):c.2252A>T (p.Asn751Ile) rs1553413626
NM_000179.2(MSH6):c.2253T>C (p.Asn751=) rs2020913
NM_000179.2(MSH6):c.2258C>A (p.Ser753Tyr) rs876660934
NM_000179.2(MSH6):c.2258C>G (p.Ser753Cys) rs876660934
NM_000179.2(MSH6):c.225G>A (p.Gly75=) rs786202321
NM_000179.2(MSH6):c.2260A>C (p.Thr754Pro) rs545057945
NM_000179.2(MSH6):c.2260A>G (p.Thr754Ala) rs545057945
NM_000179.2(MSH6):c.2260dup (p.Thr754fs) rs1553413640
NM_000179.2(MSH6):c.2265A>C (p.Glu755Asp) rs1553413644
NM_000179.2(MSH6):c.2268A>C (p.Gly756=) rs142246608
NM_000179.2(MSH6):c.2269_2270del (p.Thr757fs) rs876661025
NM_000179.2(MSH6):c.2271C>G (p.Thr757=) rs142172006
NM_000179.2(MSH6):c.2271C>T (p.Thr757=) rs142172006
NM_000179.2(MSH6):c.2272C>T (p.Leu758=) rs56371757
NM_000179.2(MSH6):c.2276T>C (p.Leu759Pro) rs1553413655
NM_000179.2(MSH6):c.2277_2281dup (p.Arg761fs)
NM_000179.2(MSH6):c.2278G>C (p.Glu760Gln) rs1322642187
NM_000179.2(MSH6):c.227T>C (p.Leu76Pro) rs587780672
NM_000179.2(MSH6):c.2281A>G (p.Arg761Gly) rs199876321
NM_000179.2(MSH6):c.2282G>C (p.Arg761Thr)
NM_000179.2(MSH6):c.2282G>T (p.Arg761Met) rs587779233
NM_000179.2(MSH6):c.2283G>A (p.Arg761=) rs1057523842
NM_000179.2(MSH6):c.2288A>G (p.Asp763Gly) rs1060502913
NM_000179.2(MSH6):c.2289T>C (p.Asp763=) rs137946937
NM_000179.2(MSH6):c.2291C>A (p.Thr764Asn) rs561198849
NM_000179.2(MSH6):c.2292T>C (p.Thr764=) rs1553413668
NM_000179.2(MSH6):c.2294G>C (p.Cys765Ser) rs1553413671
NM_000179.2(MSH6):c.2294dup (p.Cys765fs) rs1553413673
NM_000179.2(MSH6):c.2295C>A (p.Cys765Ter)
NM_000179.2(MSH6):c.2296C>T (p.His766Tyr) rs1414463878
NM_000179.2(MSH6):c.2297A>G (p.His766Arg) rs1060502870
NM_000179.2(MSH6):c.2299A>G (p.Thr767Ala) rs774452933
NM_000179.2(MSH6):c.229C>T (p.Arg77Trp) rs745442468
NM_000179.2(MSH6):c.2300C>G (p.Thr767Ser) rs587781462
NM_000179.2(MSH6):c.2300C>T (p.Thr767Ile) rs587781462
NM_000179.2(MSH6):c.2302C>G (p.Pro768Ala) rs35946687
NM_000179.2(MSH6):c.2303C>G (p.Pro768Arg) rs773162893
NM_000179.2(MSH6):c.2308_2312delinsT (p.Gly770fs) rs864622585
NM_000179.2(MSH6):c.2309G>A (p.Gly770Asp) rs587781478
NM_000179.2(MSH6):c.2312A>C (p.Lys771Thr) rs864622586
NM_000179.2(MSH6):c.2312A>T (p.Lys771Met) rs864622586
NM_000179.2(MSH6):c.2313G>T (p.Lys771Asn)
NM_000179.2(MSH6):c.2314C>A (p.Arg772=) rs63750138
NM_000179.2(MSH6):c.2314C>T (p.Arg772Trp) rs63750138
NM_000179.2(MSH6):c.2315G>A (p.Arg772Gln) rs63750725
NM_000179.2(MSH6):c.2318T>C (p.Leu773Pro) rs863224623
NM_000179.2(MSH6):c.2319C>A (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2319C>T (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2320C>G (p.Leu774Val) rs864622324
NM_000179.2(MSH6):c.2328A>T (p.Gln776His) rs1463214972
NM_000179.2(MSH6):c.232A>C (p.Arg78=) rs1553408408
NM_000179.2(MSH6):c.232A>G (p.Arg78Gly) rs1553408408
NM_000179.2(MSH6):c.2334T>C (p.Leu778=) rs1057523588
NM_000179.2(MSH6):c.233G>A (p.Arg78Lys) rs864622425
NM_000179.2(MSH6):c.2343A>C (p.Pro781=) rs965368508
NM_000179.2(MSH6):c.2344C>G (p.Leu782Val) rs1553413714
NM_000179.2(MSH6):c.2347T>A (p.Cys783Ser) rs373721483
NM_000179.2(MSH6):c.2348_2349del (p.Leu782_Cys783insTer) rs267608065
NM_000179.2(MSH6):c.234A>G (p.Arg78=) rs1553408414
NM_000179.2(MSH6):c.2351_2352del (p.Asn784fs) rs1553413717
NM_000179.2(MSH6):c.2352C>G (p.Asn784Lys) rs1553413722
NM_000179.2(MSH6):c.2353C>G (p.His785Asp)
NM_000179.2(MSH6):c.2355T>A (p.His785Gln) rs1060502942
NM_000179.2(MSH6):c.2360C>G (p.Ala787Gly) rs63750637
NM_000179.2(MSH6):c.2367T>C (p.Asn789=) rs1060504738
NM_000179.2(MSH6):c.236C>T (p.Ser79Leu) rs1428717797
NM_000179.2(MSH6):c.2371C>T (p.Arg791Cys) rs749918474
NM_000179.2(MSH6):c.2371_2372insAGAC (p.Arg791fs) rs1553413732
NM_000179.2(MSH6):c.2372G>A (p.Arg791His) rs755587950
NM_000179.2(MSH6):c.2375T>C (p.Leu792Pro) rs587779236
NM_000179.2(MSH6):c.2377G>C (p.Asp793His) rs1553413737
NM_000179.2(MSH6):c.2383A>G (p.Ile795Val) rs865931684
NM_000179.2(MSH6):c.2384T>C (p.Ile795Thr) rs202127474
NM_000179.2(MSH6):c.2385A>G (p.Ile795Met) rs1558665293
NM_000179.2(MSH6):c.2386G>T (p.Glu796Ter) rs1558665297
NM_000179.2(MSH6):c.2387A>G (p.Glu796Gly) rs532445704
NM_000179.2(MSH6):c.2391C>T (p.Asp797=) rs754870044
NM_000179.2(MSH6):c.2392C>G (p.Leu798Val) rs587779238
NM_000179.2(MSH6):c.2398G>C (p.Val800Leu) rs61748083
NM_000179.2(MSH6):c.23A>G (p.Tyr8Cys)
NM_000179.2(MSH6):c.2400T>C (p.Val800=) rs267608071
NM_000179.2(MSH6):c.2401G>A (p.Val801Met) rs1265121267
NM_000179.2(MSH6):c.2404C>T (p.Pro802Ser) rs1553413764
NM_000179.2(MSH6):c.2407G>T (p.Asp803Tyr) rs1553413770
NM_000179.2(MSH6):c.2408A>G (p.Asp803Gly) rs63751450
NM_000179.2(MSH6):c.2409C>G (p.Asp803Glu) rs1434270332
NM_000179.2(MSH6):c.240A>G (p.Val80=) rs864622281
NM_000179.2(MSH6):c.2410A>G (p.Lys804Glu) rs1064793552
NM_000179.2(MSH6):c.2412A>G (p.Lys804=) rs201460265
NM_000179.2(MSH6):c.2413A>G (p.Ile805Val) rs928923556
NM_000179.2(MSH6):c.2415C>G (p.Ile805Met) rs1219649543
NM_000179.2(MSH6):c.2415C>T (p.Ile805=) rs1219649543
NM_000179.2(MSH6):c.2417C>G (p.Ser806Cys) rs372990379
NM_000179.2(MSH6):c.2417C>T (p.Ser806Phe)
NM_000179.2(MSH6):c.2418C>T (p.Ser806=) rs770992427
NM_000179.2(MSH6):c.2419G>A (p.Glu807Lys) rs587779923
NM_000179.2(MSH6):c.2419G>T (p.Glu807Ter) rs587779923
NM_000179.2(MSH6):c.2419dup (p.Glu807fs) rs1553413784
NM_000179.2(MSH6):c.241G>A (p.Ala81Thr) rs587779239
NM_000179.2(MSH6):c.241G>T (p.Ala81Ser) rs587779239
NM_000179.2(MSH6):c.2426T>C (p.Val809Ala)
NM_000179.2(MSH6):c.242C>T (p.Ala81Val) rs587779924
NM_000179.2(MSH6):c.2436A>G (p.Leu812=) rs897288945
NM_000179.2(MSH6):c.243G>T (p.Ala81=) rs1057523564
NM_000179.2(MSH6):c.2443C>A (p.Leu815Ile) rs377411318
NM_000179.2(MSH6):c.2446C>G (p.Pro816Ala) rs1553413803
NM_000179.2(MSH6):c.2447C>T (p.Pro816Leu) rs1553413804
NM_000179.2(MSH6):c.2452C>T (p.Leu818Phe) rs786203612
NM_000179.2(MSH6):c.2459G>A (p.Arg820Lys) rs876661204
NM_000179.2(MSH6):c.246T>C (p.Pro82=) rs786201527
NM_000179.2(MSH6):c.2479A>G (p.Asn827Asp) rs878853716
NM_000179.2(MSH6):c.2479_2481del (p.Asn827del) rs1553413826
NM_000179.2(MSH6):c.247G>A (p.Ala83Thr)
NM_000179.2(MSH6):c.2482G>A (p.Val828Ile) rs587781349
NM_000179.2(MSH6):c.2482G>C (p.Val828Leu)
NM_000179.2(MSH6):c.2487G>A (p.Gly829=) rs1275700361
NM_000179.2(MSH6):c.248C>G (p.Ala83Gly) rs876661197
NM_000179.2(MSH6):c.2492C>T (p.Pro831Leu)
NM_000179.2(MSH6):c.2493C>T (p.Pro831=) rs778911612
NM_000179.2(MSH6):c.2501G>A (p.Ser834Asn) rs752544046
NM_000179.2(MSH6):c.2501G>C (p.Ser834Thr)
NM_000179.2(MSH6):c.2504del (p.Gln835fs)
NM_000179.2(MSH6):c.2505G>A (p.Gln835=) rs863224328
NM_000179.2(MSH6):c.2508C>T (p.Asn836=) rs758170249
NM_000179.2(MSH6):c.2509C>T (p.His837Tyr) rs777593472
NM_000179.2(MSH6):c.2511C>G (p.His837Gln) rs587779925
NM_000179.2(MSH6):c.2511C>T (p.His837=) rs587779925
NM_000179.2(MSH6):c.2513C>T (p.Pro838Leu)
NM_000179.2(MSH6):c.2514A>T (p.Pro838=) rs1553413863
NM_000179.2(MSH6):c.2515G>A (p.Asp839Asn) rs1553413868
NM_000179.2(MSH6):c.2515G>C (p.Asp839His) rs1553413868
NM_000179.2(MSH6):c.2517C>T (p.Asp839=) rs902748383
NM_000179.2(MSH6):c.2518A>C (p.Ser840Arg) rs863224624
NM_000179.2(MSH6):c.251C>T (p.Ala84Val) rs878853717
NM_000179.2(MSH6):c.2520C>T (p.Ser840=) rs781241667
NM_000179.2(MSH6):c.2521del (p.Arg841fs) rs1114167771
NM_000179.2(MSH6):c.2526T>G (p.Ala842=) rs772394197
NM_000179.2(MSH6):c.2527A>G (p.Ile843Val) rs1060502922
NM_000179.2(MSH6):c.2535dup (p.Glu846Ter) rs587779241
NM_000179.2(MSH6):c.2539G>A (p.Glu847Lys)
NM_000179.2(MSH6):c.253C>T (p.Pro85Ser) rs779664343
NM_000179.2(MSH6):c.2541A>T (p.Glu847Asp) rs1553413887
NM_000179.2(MSH6):c.2545A>G (p.Thr849Ala) rs1558665776
NM_000179.2(MSH6):c.2547A>C (p.Thr849=) rs769018957
NM_000179.2(MSH6):c.2547A>G (p.Thr849=) rs769018957
NM_000179.2(MSH6):c.2548T>C (p.Tyr850His) rs1558665790
NM_000179.2(MSH6):c.2549A>G (p.Tyr850Cys) rs63750389
NM_000179.2(MSH6):c.254C>T (p.Pro85Leu) rs1060502945
NM_000179.2(MSH6):c.2550C>G (p.Tyr850Ter) rs374230313
NM_000179.2(MSH6):c.2550C>T (p.Tyr850=) rs374230313
NM_000179.2(MSH6):c.2551A>G (p.Ser851Gly)
NM_000179.2(MSH6):c.2555A>C (p.Lys852Thr) rs1114167796
NM_000179.2(MSH6):c.2555_2557AGA[2] (p.Lys854del) rs587782858
NM_000179.2(MSH6):c.2559G>C (p.Lys853Asn) rs765873566
NM_000179.2(MSH6):c.255C>A (p.Pro85=) rs587779242
NM_000179.2(MSH6):c.255C>G (p.Pro85=) rs587779242
NM_000179.2(MSH6):c.255C>T (p.Pro85=) rs587779242
NM_000179.2(MSH6):c.2561A>T (p.Lys854Met) rs34374438
NM_000179.2(MSH6):c.2561_2562delinsTT (p.Lys854Ile) rs587780673
NM_000179.2(MSH6):c.2562G>C (p.Lys854Asn) rs759048538
NM_000179.2(MSH6):c.2562G>T (p.Lys854Asn) rs759048538
NM_000179.2(MSH6):c.2567T>C (p.Ile856Thr) rs1064794084
NM_000179.2(MSH6):c.2569G>A (p.Asp857Asn) rs368437140
NM_000179.2(MSH6):c.256A>T (p.Thr86Ser) rs1553408451
NM_000179.2(MSH6):c.2570A>G (p.Asp857Gly)
NM_000179.2(MSH6):c.2575C>G (p.Leu859Val) rs1553413924
NM_000179.2(MSH6):c.2579C>T (p.Ser860Phe) rs370412074
NM_000179.2(MSH6):c.257C>T (p.Thr86Ile) rs768444916
NM_000179.2(MSH6):c.2582C>T (p.Ala861Val) rs1553413929
NM_000179.2(MSH6):c.2583T>A (p.Ala861=) rs1060504763
NM_000179.2(MSH6):c.2584C>T (p.Leu862=) rs1187393388
NM_000179.2(MSH6):c.2588A>G (p.Glu863Gly) rs876658238
NM_000179.2(MSH6):c.2591G>A (p.Gly864Glu) rs587781306
NM_000179.2(MSH6):c.2593T>C (p.Phe865Leu)
NM_000179.2(MSH6):c.2593T>G (p.Phe865Val) rs1558665927
NM_000179.2(MSH6):c.2595C>G (p.Phe865Leu) rs757202837
NM_000179.2(MSH6):c.2596A>G (p.Lys866Glu) rs1553413941
NM_000179.2(MSH6):c.2597A>C (p.Lys866Thr) rs190075874
NM_000179.2(MSH6):c.2597A>G (p.Lys866Arg) rs190075874
NM_000179.2(MSH6):c.2597A>T (p.Lys866Ile) rs190075874
NM_000179.2(MSH6):c.2598A>C (p.Lys866Asn)
NM_000179.2(MSH6):c.2599G>A (p.Val867Ile) rs745954217
NM_000179.2(MSH6):c.25A>G (p.Ser9Gly) rs41294986
NM_000179.2(MSH6):c.260+10dup rs1553408493
NM_000179.2(MSH6):c.260+2_260+3delTAinsAG rs1064794075
NM_000179.2(MSH6):c.260+3A>C rs1553408474
NM_000179.2(MSH6):c.260+4_260+5delGCinsTT rs1064795936
NM_000179.2(MSH6):c.260+7G>A rs774479750
NM_000179.2(MSH6):c.2600T>G (p.Val867Gly) rs139598980
NM_000179.2(MSH6):c.2602dup (p.Met868fs)
NM_000179.2(MSH6):c.2603T>C (p.Met868Thr) rs780280765
NM_000179.2(MSH6):c.2604G>A (p.Met868Ile) rs749508276
NM_000179.2(MSH6):c.2605T>G (p.Cys869Gly) rs768941857
NM_000179.2(MSH6):c.261-1G>C rs863225402
NM_000179.2(MSH6):c.261-3237_3735del
NM_000179.2(MSH6):c.2611A>G (p.Ile871Val)
NM_000179.2(MSH6):c.2614A>G (p.Ile872Val) rs1060502939
NM_000179.2(MSH6):c.2615T>A (p.Ile872Lys) rs1064793342
NM_000179.2(MSH6):c.2615T>C (p.Ile872Thr) rs1064793342
NM_000179.2(MSH6):c.2619G>A (p.Gly873=) rs1315876988
NM_000179.2(MSH6):c.2624T>C (p.Met875Thr) rs774774596
NM_000179.2(MSH6):c.2629G>A (p.Glu877Lys) rs730881797
NM_000179.2(MSH6):c.2630A>G (p.Glu877Gly) rs1060502873
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000179.2(MSH6):c.2633T>G (p.Val878Gly) rs2020912
NM_000179.2(MSH6):c.263G>A (p.Cys88Tyr) rs1060502911
NM_000179.2(MSH6):c.2641delinsAAAA (p.Gly881delinsLysSer) rs63751408
NM_000179.2(MSH6):c.2645_2653del (p.Phe882_Lys885delinsTer) rs876660630
NM_000179.2(MSH6):c.2648A>C (p.Lys883Thr) rs764816440
NM_000179.2(MSH6):c.2651C>G (p.Ser884Cys) rs561217424
NM_000179.2(MSH6):c.2653A>C (p.Lys885Gln) rs587782593
NM_000179.2(MSH6):c.2653A>G (p.Lys885Glu) rs587782593
NM_000179.2(MSH6):c.2655A>C (p.Lys885Asn) rs1553413977
NM_000179.2(MSH6):c.2658C>T (p.Ile886=) rs786201051
NM_000179.2(MSH6):c.2659C>G (p.Leu887Val) rs1423320900
NM_000179.2(MSH6):c.2660T>G (p.Leu887Arg)
NM_000179.2(MSH6):c.2661T>G (p.Leu887=) rs267608069
NM_000179.2(MSH6):c.2664G>C (p.Lys888Asn) rs730881798
NM_000179.2(MSH6):c.2666A>C (p.Gln889Pro) rs377542011
NM_000179.2(MSH6):c.2667G>T (p.Gln889His) rs149945495
NM_000179.2(MSH6):c.2668G>A (p.Val890Ile)
NM_000179.2(MSH6):c.2668G>T (p.Val890Phe) rs786202628
NM_000179.2(MSH6):c.2669T>C (p.Val890Ala) rs1114167741
NM_000179.2(MSH6):c.266A>G (p.Asp89Gly) rs1311655109
NM_000179.2(MSH6):c.2670C>A (p.Val890=) rs863224625
NM_000179.2(MSH6):c.2673C>G (p.Ile891Met) rs146006741
NM_000179.2(MSH6):c.2674T>G (p.Ser892Ala)
NM_000179.2(MSH6):c.2676T>G (p.Ser892=) rs863224329
NM_000179.2(MSH6):c.2677C>A (p.Leu893Met) rs370754319
NM_000179.2(MSH6):c.2677C>G (p.Leu893Val) rs370754319
NM_000179.2(MSH6):c.267C>G (p.Asp89Glu) rs762818044
NM_000179.2(MSH6):c.267C>T (p.Asp89=) rs762818044
NM_000179.2(MSH6):c.2680C>T (p.Gln894Ter) rs878853718
NM_000179.2(MSH6):c.2682G>A (p.Gln894=) rs756239543
NM_000179.2(MSH6):c.2684C>G (p.Thr895Arg)
NM_000179.2(MSH6):c.2685A>T (p.Thr895=) rs749539614
NM_000179.2(MSH6):c.2688A>G (p.Lys896=) rs876659173
NM_000179.2(MSH6):c.2689A>T (p.Asn897Tyr) rs1064794771
NM_000179.2(MSH6):c.2690dup (p.Asn897fs) rs1553414010
NM_000179.2(MSH6):c.2692C>A (p.Pro898Thr) rs1114167700
NM_000179.2(MSH6):c.2693C>G (p.Pro898Arg) rs876661281
NM_000179.2(MSH6):c.2693del (p.Pro898fs) rs1553414022
NM_000179.2(MSH6):c.2694T>C (p.Pro898=) rs769668106
NM_000179.2(MSH6):c.2701C>A (p.Arg901Ser) rs772514245
NM_000179.2(MSH6):c.2701C>T (p.Arg901Cys) rs772514245
NM_000179.2(MSH6):c.2702G>A (p.Arg901His) rs63749889
NM_000179.2(MSH6):c.2705T>A (p.Phe902Tyr)
NM_000179.2(MSH6):c.2708C>T (p.Pro903Leu) rs1060502919
NM_000179.2(MSH6):c.2712T>G (p.Asp904Glu) rs374401174
NM_000179.2(MSH6):c.2717C>G (p.Thr906Ser) rs1436232875
NM_000179.2(MSH6):c.2719G>A (p.Val907Ile) rs1558666445
NM_000179.2(MSH6):c.2722G>A (p.Glu908Lys) rs886056144
NM_000179.2(MSH6):c.2724A>G (p.Glu908=) rs35389622
NM_000179.2(MSH6):c.2725T>C (p.Leu909=) rs876659785
NM_000179.2(MSH6):c.2726T>C (p.Leu909Ser) rs969521586
NM_000179.2(MSH6):c.272C>T (p.Ser91Leu) rs864622559
NM_000179.2(MSH6):c.2730C>G (p.Asn910Lys) rs773837927
NM_000179.2(MSH6):c.2730C>T (p.Asn910=) rs773837927
NM_000179.2(MSH6):c.2731C>T (p.Arg911Ter) rs63751017
NM_000179.2(MSH6):c.2732G>A (p.Arg911Gln) rs761622304
NM_000179.2(MSH6):c.2732G>T (p.Arg911Leu) rs761622304
NM_000179.2(MSH6):c.2733A>G (p.Arg911=) rs1553414083
NM_000179.2(MSH6):c.2734T>C (p.Trp912Arg) rs1060502869
NM_000179.2(MSH6):c.2735G>A (p.Trp912Ter) rs1060502876
NM_000179.2(MSH6):c.2739_2740dup (p.Thr914fs) rs1553414092
NM_000179.2(MSH6):c.2741C>T (p.Thr914Ile) rs1553414094
NM_000179.2(MSH6):c.2744C>A (p.Ala915Asp) rs766427609
NM_000179.2(MSH6):c.2744C>G (p.Ala915Gly) rs766427609
NM_000179.2(MSH6):c.2748dup (p.Asp917Ter) rs1553414102
NM_000179.2(MSH6):c.2754T>C (p.His918=) rs1057521383
NM_000179.2(MSH6):c.2755G>A (p.Glu919Lys) rs1553414110
NM_000179.2(MSH6):c.2757A>C (p.Glu919Asp) rs866493167
NM_000179.2(MSH6):c.2759dup (p.Ala921fs)
NM_000179.2(MSH6):c.275C>T (p.Pro92Leu) rs1257646433
NM_000179.2(MSH6):c.275_276inv (p.Pro92Leu)
NM_000179.2(MSH6):c.2760G>C (p.Lys920Asn) rs1553414113
NM_000179.2(MSH6):c.2762C>T (p.Ala921Val) rs1060502936
NM_000179.2(MSH6):c.2765G>A (p.Arg922Gln) rs752839086
NM_000179.2(MSH6):c.2767A>G (p.Lys923Glu) rs1558666660
NM_000179.2(MSH6):c.2770A>T (p.Thr924Ser) rs758873844
NM_000179.2(MSH6):c.2771C>G (p.Thr924Ser)
NM_000179.2(MSH6):c.2772_2773del (p.Gly925fs) rs1553414131
NM_000179.2(MSH6):c.2775A>G (p.Gly925=) rs587779248
NM_000179.2(MSH6):c.2776C>T (p.Leu926Phe) rs587781318
NM_000179.2(MSH6):c.2777T>C (p.Leu926Pro) rs1060502948
NM_000179.2(MSH6):c.2780T>C (p.Ile927Thr) rs587779926
NM_000179.2(MSH6):c.2781T>G (p.Ile927Met) rs771575217
NM_000179.2(MSH6):c.2783C>A (p.Thr928Asn) rs781482454
NM_000179.2(MSH6):c.2785C>A (p.Pro929Thr) rs1553414139
NM_000179.2(MSH6):c.2785C>G (p.Pro929Ala) rs1553414139
NM_000179.2(MSH6):c.2787C>G (p.Pro929=) rs768005323
NM_000179.2(MSH6):c.2788A>C (p.Lys930Gln) rs878853719
NM_000179.2(MSH6):c.2788A>G (p.Lys930Glu) rs878853719
NM_000179.2(MSH6):c.2789A>G (p.Lys930Arg) rs878853720
NM_000179.2(MSH6):c.2790A>T (p.Lys930Asn)
NM_000179.2(MSH6):c.2802_2803CT[1] (p.Asp934_Ser935insTer) rs878853721
NM_000179.2(MSH6):c.280G>A (p.Asp94Asn)
NM_000179.2(MSH6):c.2812G>C (p.Asp938His) rs1553414175
NM_000179.2(MSH6):c.2818G>T (p.Ala940Ser) rs772978164
NM_000179.2(MSH6):c.2820T>A (p.Ala940=) rs878853722
NM_000179.2(MSH6):c.2827G>T (p.Asp943Tyr) rs143520357
NM_000179.2(MSH6):c.2830A>G (p.Ile944Val) rs878853723
NM_000179.2(MSH6):c.2832_2833del (p.Ile944fs) rs730881827
NM_000179.2(MSH6):c.2833_2835del (p.Arg945del) rs1553414199
NM_000179.2(MSH6):c.2838A>G (p.Glu946=) rs876660479
NM_000179.2(MSH6):c.283T>G (p.Leu95Val) rs786202397
NM_000179.2(MSH6):c.2841T>C (p.Asn947=) rs1057522717
NM_000179.2(MSH6):c.2844A>T (p.Glu948Asp) rs1558666921
NM_000179.2(MSH6):c.2845C>G (p.Gln949Glu) rs878853724
NM_000179.2(MSH6):c.2850C>T (p.Ser950=) rs571394629
NM_000179.2(MSH6):c.2853C>A (p.Leu951=) rs876658525
NM_000179.2(MSH6):c.2855T>C (p.Leu952Pro) rs587781743
NM_000179.2(MSH6):c.2857G>A (p.Glu953Lys) rs753034685
NM_000179.2(MSH6):c.2857G>C (p.Glu953Gln) rs753034685
NM_000179.2(MSH6):c.2863C>G (p.Leu955Val) rs1401779172
NM_000179.2(MSH6):c.2866G>C (p.Glu956Gln)
NM_000179.2(MSH6):c.2871A>G (p.Lys957=) rs778079788
NM_000179.2(MSH6):c.2872C>G (p.Gln958Glu) rs1553414236
NM_000179.2(MSH6):c.2873del (p.Gln958fs)
NM_000179.2(MSH6):c.2874_2885del (p.Gln958_Ile962delinsHis)
NM_000179.2(MSH6):c.2875C>T (p.Arg959Cys) rs751973865
NM_000179.2(MSH6):c.2876G>A (p.Arg959His) rs757653982
NM_000179.2(MSH6):c.2877C>T (p.Arg959=) rs781734958
NM_000179.2(MSH6):c.2882G>C (p.Arg961Thr) rs587781458
NM_000179.2(MSH6):c.2883A>G (p.Arg961=) rs1060504747
NM_000179.2(MSH6):c.2885T>C (p.Ile962Thr) rs778287080
NM_000179.2(MSH6):c.2889C>T (p.Gly963=) rs771726914
NM_000179.2(MSH6):c.2894G>C (p.Arg965Thr) rs1553414252
NM_000179.2(MSH6):c.2898C>G (p.Thr966=) rs772786755
NM_000179.2(MSH6):c.2899A>G (p.Ile967Val) rs876661067
NM_000179.2(MSH6):c.2901A>C (p.Ile967=) rs863224330
NM_000179.2(MSH6):c.2904C>G (p.Val968=) rs150683226
NM_000179.2(MSH6):c.2906A>C (p.Tyr969Ser) rs63749919
NM_000179.2(MSH6):c.2906A>G (p.Tyr969Cys) rs63749919
NM_000179.2(MSH6):c.2906A>T (p.Tyr969Phe) rs63749919
NM_000179.2(MSH6):c.2906_2907del (p.Tyr969fs) rs786203924
NM_000179.2(MSH6):c.2907T>C (p.Tyr969=) rs1553414274
NM_000179.2(MSH6):c.2910G>C (p.Trp970Cys) rs765411990
NM_000179.2(MSH6):c.2913dup (p.Ile972fs) rs1054003194
NM_000179.2(MSH6):c.2918G>C (p.Gly973Ala) rs1558667196
NM_000179.2(MSH6):c.2920A>G (p.Arg974Gly) rs775407589
NM_000179.2(MSH6):c.2920del (p.Arg974fs) rs1558667222
NM_000179.2(MSH6):c.2925C>T (p.Asn975=) rs139026662
NM_000179.2(MSH6):c.2926C>T (p.Arg976Cys) rs587782386
NM_000179.2(MSH6):c.2927G>A (p.Arg976His) rs63751113
NM_000179.2(MSH6):c.2928T>C (p.Arg976=) rs764440377
NM_000179.2(MSH6):c.292G>T (p.Ala98Ser) rs878853725
NM_000179.2(MSH6):c.2931C>A (p.Tyr977Ter) rs63750111
NM_000179.2(MSH6):c.2932C>G (p.Gln978Glu) rs587781372
NM_000179.2(MSH6):c.2934G>A (p.Gln978=) rs751780309
NM_000179.2(MSH6):c.2937G>T (p.Leu979=) rs757691799
NM_000179.2(MSH6):c.2940A>G (p.Glu980=) rs730881818
NM_000179.2(MSH6):c.2941A>G (p.Ile981Val) rs730881799
NM_000179.2(MSH6):c.2944C>G (p.Pro982Ala) rs1553414320
NM_000179.2(MSH6):c.2950A>C (p.Asn984His) rs146359682
NM_000179.2(MSH6):c.2950A>G (p.Asn984Asp) rs146359682
NM_000179.2(MSH6):c.2951A>C (p.Asn984Thr) rs587779927
NM_000179.2(MSH6):c.2954T>G (p.Phe985Cys)
NM_000179.2(MSH6):c.2956A>G (p.Thr986Ala) rs1553414327
NM_000179.2(MSH6):c.2958C>A (p.Thr986=) rs757866392
NM_000179.2(MSH6):c.2958C>T (p.Thr986=) rs757866392
NM_000179.2(MSH6):c.2959A>C (p.Thr987Pro)
NM_000179.2(MSH6):c.2959A>G (p.Thr987Ala) rs746631156
NM_000179.2(MSH6):c.2960C>T (p.Thr987Ile) rs587779928
NM_000179.2(MSH6):c.2962C>G (p.Arg988Gly)
NM_000179.2(MSH6):c.2962C>T (p.Arg988Cys) rs61753795
NM_000179.2(MSH6):c.2963G>A (p.Arg988His) rs115386788
NM_000179.2(MSH6):c.2963G>C (p.Arg988Pro) rs115386788
NM_000179.2(MSH6):c.2963G>T (p.Arg988Leu) rs115386788
NM_000179.2(MSH6):c.2964C>A (p.Arg988=) rs144288981
NM_000179.2(MSH6):c.2964C>T (p.Arg988=) rs144288981
NM_000179.2(MSH6):c.2966A>G (p.Asn989Ser) rs763146296
NM_000179.2(MSH6):c.2972C>T (p.Pro991Leu) rs375966384
NM_000179.2(MSH6):c.2973A>G (p.Pro991=) rs1057521349
NM_000179.2(MSH6):c.2974G>A (p.Glu992Lys) rs774755404
NM_000179.2(MSH6):c.2975A>G (p.Glu992Gly) rs876660688
NM_000179.2(MSH6):c.2979A>G (p.Glu993=) rs370462886
NM_000179.2(MSH6):c.2979A>T (p.Glu993Asp) rs370462886
NM_000179.2(MSH6):c.2982C>G (p.Tyr994Ter)
NM_000179.2(MSH6):c.2982C>T (p.Tyr994=) rs367758473
NM_000179.2(MSH6):c.2983G>A (p.Glu995Lys) rs63750258
NM_000179.2(MSH6):c.2986T>C (p.Leu996=) rs876658605
NM_000179.2(MSH6):c.2988G>A (p.Leu996=) rs1060504749
NM_000179.2(MSH6):c.2990A>G (p.Lys997Arg) rs587780674
NM_000179.2(MSH6):c.2991del (p.Lys997fs) rs1060502890
NM_000179.2(MSH6):c.2992T>A (p.Ser998Thr) rs730881800
NM_000179.2(MSH6):c.2992T>C (p.Ser998Pro)
NM_000179.2(MSH6):c.2993C>G (p.Ser998Cys) rs1281207200
NM_000179.2(MSH6):c.2997C>G (p.Thr999=) rs751279827
NM_000179.2(MSH6):c.2997C>T (p.Thr999=) rs751279827
NM_000179.2(MSH6):c.3002A>G (p.Lys1001Arg) rs876659485
NM_000179.2(MSH6):c.3005G>T (p.Gly1002Val)
NM_000179.2(MSH6):c.3006C>G (p.Gly1002=) rs878853726
NM_000179.2(MSH6):c.3006C>T (p.Gly1002=) rs878853726
NM_000179.2(MSH6):c.3008G>T (p.Cys1003Phe) rs1558667696
NM_000179.2(MSH6):c.300G>A (p.Met100Ile)
NM_000179.2(MSH6):c.3012A>G (p.Lys1004=) rs864622378
NM_000179.2(MSH6):c.3013C>T (p.Arg1005Ter) rs63750563
NM_000179.2(MSH6):c.3014G>T (p.Arg1005Leu) rs587782324
NM_000179.2(MSH6):c.3015A>G (p.Arg1005=) rs990650403
NM_000179.2(MSH6):c.3018C>A (p.Tyr1006Ter) rs1553414395
NM_000179.2(MSH6):c.3018C>G (p.Tyr1006Ter) rs1553414395
NM_000179.2(MSH6):c.3018C>T (p.Tyr1006=) rs1553414395
NM_000179.2(MSH6):c.3019T>G (p.Trp1007Gly) rs1553414398
NM_000179.2(MSH6):c.3021G>A (p.Trp1007Ter)
NM_000179.2(MSH6):c.3023C>T (p.Thr1008Ile) rs1558667779
NM_000179.2(MSH6):c.3024C>G (p.Thr1008=) rs587780675
NM_000179.2(MSH6):c.3024C>T (p.Thr1008=) rs587780675
NM_000179.2(MSH6):c.3026A>G (p.Lys1009Arg)
NM_000179.2(MSH6):c.3026A>T (p.Lys1009Ile) rs587781593
NM_000179.2(MSH6):c.3030T>C (p.Thr1010=) rs1060504753
NM_000179.2(MSH6):c.3033T>G (p.Ile1011Met)
NM_000179.2(MSH6):c.3037_3039AAG[1] (p.Lys1014del) rs267608073
NM_000179.2(MSH6):c.3037_3041del (p.Lys1013fs) rs587782712
NM_000179.2(MSH6):c.3039G>T (p.Lys1013Asn) rs1060502920
NM_000179.2(MSH6):c.303G>A (p.Glu101=) rs1057521533
NM_000179.2(MSH6):c.3043T>G (p.Leu1015Val)
NM_000179.2(MSH6):c.3045G>C (p.Leu1015Phe)
NM_000179.2(MSH6):c.3049A>C (p.Asn1017His) rs1060502943
NM_000179.2(MSH6):c.3052C>A (p.Leu1018Ile) rs878853727
NM_000179.2(MSH6):c.3054C>A (p.Leu1018=) rs772191770
NM_000179.2(MSH6):c.3054C>G (p.Leu1018=) rs772191770
NM_000179.2(MSH6):c.3060T>C (p.Asn1020=) rs1553414441
NM_000179.2(MSH6):c.3062C>G (p.Ala1021Gly) rs63750287
NM_000179.2(MSH6):c.3064G>T (p.Glu1022Ter) rs1114167724
NM_000179.2(MSH6):c.3067G>T (p.Glu1023Ter) rs267608059
NM_000179.2(MSH6):c.3068A>C (p.Glu1023Ala) rs1553414454
NM_000179.2(MSH6):c.3070C>T (p.Arg1024Trp) rs370505117
NM_000179.2(MSH6):c.3071G>A (p.Arg1024Gln) rs372705506
NM_000179.2(MSH6):c.3071G>C (p.Arg1024Pro)
NM_000179.2(MSH6):c.3072G>A (p.Arg1024=) rs878853728
NM_000179.2(MSH6):c.3078dup (p.Val1027fs)
NM_000179.2(MSH6):c.3079G>A (p.Val1027Ile) rs876658397
NM_000179.2(MSH6):c.3079G>C (p.Val1027Leu) rs876658397
NM_000179.2(MSH6):c.3080T>G (p.Val1027Gly) rs1553414471
NM_000179.2(MSH6):c.3083C>G (p.Ser1028Ter) rs876660853
NM_000179.2(MSH6):c.3083C>T (p.Ser1028Leu) rs876660853
NM_000179.2(MSH6):c.3084A>T (p.Ser1028=) rs786201843
NM_000179.2(MSH6):c.3086T>G (p.Leu1029Trp) rs1553414483
NM_000179.2(MSH6):c.3089_3092del (p.Lys1030fs) rs1553414488
NM_000179.2(MSH6):c.3091dup (p.Asp1031fs)
NM_000179.2(MSH6):c.3094T>G (p.Cys1032Gly)
NM_000179.2(MSH6):c.3097_3100del (p.Met1033fs) rs1553414498
NM_000179.2(MSH6):c.30C>T (p.Phe10=) rs786201869
NM_000179.2(MSH6):c.3100C>G (p.Arg1034Gly) rs587779930
NM_000179.2(MSH6):c.3100C>T (p.Arg1034Trp) rs587779930
NM_000179.2(MSH6):c.3101G>A (p.Arg1034Gln) rs181727939
NM_000179.2(MSH6):c.3101G>C (p.Arg1034Pro) rs181727939
NM_000179.2(MSH6):c.3103C>T (p.Arg1035Ter) rs63749999
NM_000179.2(MSH6):c.3104G>A (p.Arg1035Gln) rs730881801
NM_000179.2(MSH6):c.3104G>C (p.Arg1035Pro)
NM_000179.2(MSH6):c.3104G>T (p.Arg1035Leu) rs730881801
NM_000179.2(MSH6):c.3107T>G (p.Leu1036Arg) rs748211741
NM_000179.2(MSH6):c.3108G>A (p.Leu1036=) rs1399581663
NM_000179.2(MSH6):c.3108_3109del (p.Phe1037fs) rs1553414519
NM_000179.2(MSH6):c.3109_3112del (p.Phe1037fs) rs1558668156
NM_000179.2(MSH6):c.3111C>G (p.Phe1037Leu) rs587781673
NM_000179.2(MSH6):c.3111_3112delinsGA (p.Phe1037_Tyr1038delinsLeuAsn)
NM_000179.2(MSH6):c.3112T>C (p.Tyr1038His) rs1060502947
NM_000179.2(MSH6):c.3113A>G (p.Tyr1038Cys) rs773357672
NM_000179.2(MSH6):c.3117C>G (p.Asn1039Lys) rs1553414533
NM_000179.2(MSH6):c.3119_3120del (p.Asn1039_Phe1040insTer) rs267608042
NM_000179.2(MSH6):c.3128A>T (p.Asn1043Ile) rs1558668226
NM_000179.2(MSH6):c.3131A>C (p.Tyr1044Ser) rs1553414541
NM_000179.2(MSH6):c.3137A>G (p.Asp1046Gly) rs587779931
NM_000179.2(MSH6):c.3137_3138del (p.Asp1046fs) rs1558668258
NM_000179.2(MSH6):c.3138C>G (p.Asp1046Glu) rs1244049824
NM_000179.2(MSH6):c.3138C>T (p.Asp1046=) rs1244049824
NM_000179.2(MSH6):c.313del (p.Trp105fs)
NM_000179.2(MSH6):c.3141G>C (p.Trp1047Cys) rs1553414554
NM_000179.2(MSH6):c.3142C>G (p.Gln1048Glu) rs200492211
NM_000179.2(MSH6):c.3142C>T (p.Gln1048Ter) rs200492211
NM_000179.2(MSH6):c.3147T>G (p.Ser1049=) rs771340595
NM_000179.2(MSH6):c.3149C>T (p.Ala1050Val) rs1114167732
NM_000179.2(MSH6):c.3149del (p.Ala1050fs) rs1060502882
NM_000179.2(MSH6):c.3151G>A (p.Val1051Ile) rs576269342
NM_000179.2(MSH6):c.3153_3154AG[1] (p.Glu1052fs) rs63750833
NM_000179.2(MSH6):c.3155A>G (p.Glu1052Gly) rs587781568
NM_000179.2(MSH6):c.3159T>A (p.Cys1053Ter) rs767021188
NM_000179.2(MSH6):c.3159T>C (p.Cys1053=) rs767021188
NM_000179.2(MSH6):c.315G>T (p.Trp105Cys) rs1060502902
NM_000179.2(MSH6):c.3160A>G (p.Ile1054Val) rs267608075
NM_000179.2(MSH6):c.3160A>T (p.Ile1054Phe) rs267608075
NM_000179.2(MSH6):c.3162C>G (p.Ile1054Met) rs149605979
NM_000179.2(MSH6):c.3162C>T (p.Ile1054=) rs149605979
NM_000179.2(MSH6):c.3163G>A (p.Ala1055Thr) rs587779254
NM_000179.2(MSH6):c.3163dup (p.Ala1055fs) rs878853729
NM_000179.2(MSH6):c.3168G>C (p.Val1056=) rs1553414594
NM_000179.2(MSH6):c.316T>C (p.Trp106Arg) rs1410755308
NM_000179.2(MSH6):c.3172+1G>T rs587779255
NM_000179.2(MSH6):c.3172+5G>T rs876659857
NM_000179.2(MSH6):c.3172+7C>T rs587780676
NM_000179.2(MSH6):c.3172+9_3172+10delTT rs878853730
NM_000179.2(MSH6):c.3173-10C>A rs587780559
NM_000179.2(MSH6):c.3173-10C>T rs587780559
NM_000179.2(MSH6):c.3173-10_3173-6del rs781520783
NM_000179.2(MSH6):c.3173-14_3173-3delCTCTCTTTTAAC rs1553331228
NM_000179.2(MSH6):c.3173-1G>C rs397515875
NM_000179.2(MSH6):c.3173-1_3173delGA rs587779256
NM_000179.2(MSH6):c.3173-2A>C rs1553331242
NM_000179.2(MSH6):c.3173-3C>G rs1060502944
NM_000179.2(MSH6):c.3175G>A (p.Val1059Ile) rs1249506770
NM_000179.2(MSH6):c.3181C>G (p.Leu1061Val) rs1553331250
NM_000179.2(MSH6):c.3187C>T (p.Leu1063=) rs1553331257
NM_000179.2(MSH6):c.3188T>G (p.Leu1063Arg) rs1060502901
NM_000179.2(MSH6):c.318G>T (p.Trp106Cys)
NM_000179.2(MSH6):c.3191C>T (p.Ala1064Val) rs369042519
NM_000179.2(MSH6):c.3195C>G (p.Asn1065Lys) rs759260316
NM_000179.2(MSH6):c.3196_3197TA[1] (p.Tyr1066_Ser1067delinsTer) rs63749821
NM_000179.2(MSH6):c.3197A>G (p.Tyr1066Cys) rs372103816
NM_000179.2(MSH6):c.3198T>C (p.Tyr1066=) rs199643502
NM_000179.2(MSH6):c.3199_3213del (p.Ser1067_Asp1071del) rs1064792972
NM_000179.2(MSH6):c.3200G>C (p.Ser1067Thr) rs730881803
NM_000179.2(MSH6):c.3200G>T (p.Ser1067Ile) rs730881803
NM_000179.2(MSH6):c.3201T>C (p.Ser1067=) rs878853731
NM_000179.2(MSH6):c.3202C>T (p.Arg1068Ter) rs63749843
NM_000179.2(MSH6):c.3203G>A (p.Arg1068Gln) rs398123230
NM_000179.2(MSH6):c.3203G>C (p.Arg1068Pro) rs398123230
NM_000179.2(MSH6):c.3203G>T (p.Arg1068Leu) rs398123230
NM_000179.2(MSH6):c.3204A>T (p.Arg1068=) rs1060504764
NM_000179.2(MSH6):c.3205G>A (p.Gly1069Arg) rs764113705
NM_000179.2(MSH6):c.3205G>C (p.Gly1069Arg) rs764113705
NM_000179.2(MSH6):c.3209G>A (p.Gly1070Asp) rs751475855
NM_000179.2(MSH6):c.3209del (p.Gly1070fs)
NM_000179.2(MSH6):c.320C>T (p.Pro107Leu) rs878853732
NM_000179.2(MSH6):c.3213T>C (p.Asp1071=) rs534232216
NM_000179.2(MSH6):c.3215G>A (p.Gly1072Asp) rs781243845
NM_000179.2(MSH6):c.3215G>T (p.Gly1072Val) rs781243845
NM_000179.2(MSH6):c.3217C>T (p.Pro1073Ser) rs142254875
NM_000179.2(MSH6):c.321T>C (p.Pro107=) rs730881823
NM_000179.2(MSH6):c.3220A>G (p.Met1074Val) rs730881804
NM_000179.2(MSH6):c.3220A>T (p.Met1074Leu) rs730881804
NM_000179.2(MSH6):c.3220_3221del (p.Met1074fs) rs1553331290
NM_000179.2(MSH6):c.3221T>C (p.Met1074Thr) rs1060502927
NM_000179.2(MSH6):c.3223T>G (p.Cys1075Gly) rs1553331300
NM_000179.2(MSH6):c.3223dup (p.Cys1075fs)
NM_000179.2(MSH6):c.3226C>G (p.Arg1076Gly) rs63750617
NM_000179.2(MSH6):c.3226C>T (p.Arg1076Cys) rs63750617
NM_000179.2(MSH6):c.3227G>A (p.Arg1076His) rs779617676
NM_000179.2(MSH6):c.3232G>C (p.Val1078Leu) rs587779932
NM_000179.2(MSH6):c.3233T>C (p.Val1078Ala) rs376452612
NM_000179.2(MSH6):c.3235A>G (p.Ile1079Val) rs587779933
NM_000179.2(MSH6):c.3238_3239del (p.Leu1080fs) rs863225406
NM_000179.2(MSH6):c.3238del (p.Leu1080fs) rs1553331337
NM_000179.2(MSH6):c.323G>A (p.Cys108Tyr)
NM_000179.2(MSH6):c.3244C>T (p.Pro1082Ser) rs186240214
NM_000179.2(MSH6):c.3245C>T (p.Pro1082Leu) rs191109849
NM_000179.2(MSH6):c.3246G>A (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3246G>C (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3251A>G (p.Asp1084Gly) rs1553331364
NM_000179.2(MSH6):c.3252dup (p.Thr1085fs) rs1553331366
NM_000179.2(MSH6):c.3253A>T (p.Thr1085Ser) rs751563328
NM_000179.2(MSH6):c.3253del (p.Thr1085fs) rs1060502891
NM_000179.2(MSH6):c.3253dup (p.Thr1085fs) rs1114167705
NM_000179.2(MSH6):c.3255C>A (p.Thr1085=) rs371568610
NM_000179.2(MSH6):c.3255C>G (p.Thr1085=) rs371568610
NM_000179.2(MSH6):c.3256C>A (p.Pro1086Thr) rs756108143
NM_000179.2(MSH6):c.3256C>G (p.Pro1086Ala) rs756108143
NM_000179.2(MSH6):c.3256C>T (p.Pro1086Ser) rs756108143
NM_000179.2(MSH6):c.3257C>A (p.Pro1086His) rs780345806
NM_000179.2(MSH6):c.3257C>G (p.Pro1086Arg) rs780345806
NM_000179.2(MSH6):c.3257C>T (p.Pro1086Leu) rs780345806
NM_000179.2(MSH6):c.3258C>A (p.Pro1086=) rs863224331
NM_000179.2(MSH6):c.3258C>G (p.Pro1086=) rs863224331
NM_000179.2(MSH6):c.3258C>T (p.Pro1086=) rs863224331
NM_000179.2(MSH6):c.3259C>A (p.Pro1087Thr) rs63750998
NM_000179.2(MSH6):c.3259C>G (p.Pro1087Ala) rs63750998
NM_000179.2(MSH6):c.3259C>T (p.Pro1087Ser) rs63750998
NM_000179.2(MSH6):c.3260C>A (p.Pro1087His) rs63750753
NM_000179.2(MSH6):c.3260C>G (p.Pro1087Arg) rs63750753
NM_000179.2(MSH6):c.3260C>T (p.Pro1087Leu) rs63750753
NM_000179.2(MSH6):c.3261C>G (p.Pro1087=) rs370226185
NM_000179.2(MSH6):c.3261C>T (p.Pro1087=) rs370226185
NM_000179.2(MSH6):c.3261_3263CTT[1] (p.Phe1088del) rs1060502917
NM_000179.2(MSH6):c.3261del (p.Phe1088fs) rs267608078
NM_000179.2(MSH6):c.3261dup (p.Phe1088fs) rs267608078
NM_000179.2(MSH6):c.3264C>T (p.Phe1088=) rs35621414
NM_000179.2(MSH6):c.3265T>C (p.Leu1089=) rs34490141
NM_000179.2(MSH6):c.3268G>A (p.Glu1090Lys)
NM_000179.2(MSH6):c.3268_3274del (p.Glu1090fs) rs587779259
NM_000179.2(MSH6):c.3270G>C (p.Glu1090Asp) rs876660165
NM_000179.2(MSH6):c.3271C>G (p.Leu1091Val) rs1060502914
NM_000179.2(MSH6):c.3272T>G (p.Leu1091Arg) rs864622637
NM_000179.2(MSH6):c.3276A>C (p.Lys1092Asn)
NM_000179.2(MSH6):c.3276dup (p.Gly1093fs) rs1558387361
NM_000179.2(MSH6):c.3278G>T (p.Gly1093Val) rs876661048
NM_000179.2(MSH6):c.3281dup (p.Arg1095fs) rs1553331454
NM_000179.2(MSH6):c.3283C>T (p.Arg1095Cys) rs376243329
NM_000179.2(MSH6):c.3284G>A (p.Arg1095His) rs63750253
NM_000179.2(MSH6):c.3286C>T (p.His1096Tyr) rs1553331471
NM_000179.2(MSH6):c.328G>A (p.Val110Ile) rs876659374
NM_000179.2(MSH6):c.3299C>G (p.Thr1100Arg) rs63750442
NM_000179.2(MSH6):c.3299C>T (p.Thr1100Met) rs63750442
NM_000179.2(MSH6):c.3300G>A (p.Thr1100=) rs540252208
NM_000179.2(MSH6):c.3300G>C (p.Thr1100=) rs540252208
NM_000179.2(MSH6):c.3303G>T (p.Lys1101Asn) rs370353868
NM_000179.2(MSH6):c.3304A>G (p.Thr1102Ala) rs758782048
NM_000179.2(MSH6):c.3305C>G (p.Thr1102Ser) rs1553331510
NM_000179.2(MSH6):c.3306T>A (p.Thr1102=) rs2020910
NM_000179.2(MSH6):c.3307T>C (p.Phe1103Leu) rs1553331522
NM_000179.2(MSH6):c.3307T>G (p.Phe1103Val) rs1553331522
NM_000179.2(MSH6):c.3311_3312del (p.Phe1104fs) rs267608092
NM_000179.2(MSH6):c.3312T>A (p.Phe1104Leu) rs747441460
NM_000179.2(MSH6):c.3312del (p.Phe1104fs) rs267608092
NM_000179.2(MSH6):c.3312dup (p.Gly1105fs) rs267608092
NM_000179.2(MSH6):c.3313G>A (p.Gly1105Arg) rs755716475
NM_000179.2(MSH6):c.3314G>T (p.Gly1105Val) rs1060502910
NM_000179.2(MSH6):c.3316G>C (p.Asp1106His) rs1553331552
NM_000179.2(MSH6):c.3316_3318GAT[1] (p.Asp1107del) rs1064795429
NM_000179.2(MSH6):c.3321T>G (p.Asp1107Glu) rs1258021186
NM_000179.2(MSH6):c.3324T>C (p.Phe1108=) rs864622081
NM_000179.2(MSH6):c.3327T>C (p.Ile1109=) rs878853733
NM_000179.2(MSH6):c.3328C>A (p.Pro1110Thr) rs374070511
NM_000179.2(MSH6):c.3328C>T (p.Pro1110Ser) rs374070511
NM_000179.2(MSH6):c.3329C>G (p.Pro1110Arg) rs1270167314
NM_000179.2(MSH6):c.3332_3335dup (p.Asp1112delinsGluTer) rs587782562
NM_000179.2(MSH6):c.3334G>A (p.Asp1112Asn) rs773955368
NM_000179.2(MSH6):c.3335A>T (p.Asp1112Val) rs1165839059
NM_000179.2(MSH6):c.3337A>G (p.Ile1113Val) rs876658315
NM_000179.2(MSH6):c.333C>T (p.Tyr111=) rs786202772
NM_000179.2(MSH6):c.3341T>A (p.Leu1114Gln) rs1553331600
NM_000179.2(MSH6):c.3342A>C (p.Leu1114=) rs1553331612
NM_000179.2(MSH6):c.3343A>G (p.Ile1115Val)
NM_000179.2(MSH6):c.3344T>C (p.Ile1115Thr) rs747959862
NM_000179.2(MSH6):c.3346G>A (p.Gly1116Ser)
NM_000179.2(MSH6):c.3348C>G (p.Gly1116=) rs771833309
NM_000179.2(MSH6):c.334A>G (p.Asn112Asp) rs864622397
NM_000179.2(MSH6):c.3350G>T (p.Cys1117Phe) rs773245315
NM_000179.2(MSH6):c.3352G>A (p.Glu1118Lys) rs760530339
NM_000179.2(MSH6):c.3354G>A (p.Glu1118=) rs35642130
NM_000179.2(MSH6):c.3356A>G (p.Glu1119Gly) rs876661138
NM_000179.2(MSH6):c.335A>C (p.Asn112Thr) rs587779934
NM_000179.2(MSH6):c.335A>G (p.Asn112Ser) rs587779934
NM_000179.2(MSH6):c.3360G>A (p.Glu1120=) rs146737457
NM_000179.2(MSH6):c.3360G>C (p.Glu1120Asp)
NM_000179.2(MSH6):c.3361G>A (p.Glu1121Lys) rs587781609
NM_000179.2(MSH6):c.3362A>T (p.Glu1121Val)
NM_000179.2(MSH6):c.3363G>C (p.Glu1121Asp)
NM_000179.2(MSH6):c.3364C>G (p.Gln1122Glu) rs1060502892
NM_000179.2(MSH6):c.3365A>C (p.Gln1122Pro)
NM_000179.2(MSH6):c.336C>A (p.Asn112Lys) rs1182444882
NM_000179.2(MSH6):c.3370A>C (p.Asn1124His)
NM_000179.2(MSH6):c.3371del (p.Asn1124fs) rs1553331659
NM_000179.2(MSH6):c.3374G>A (p.Gly1125Asp)
NM_000179.2(MSH6):c.3375C>G (p.Gly1125=) rs765577023
NM_000179.2(MSH6):c.3377A>G (p.Lys1126Arg)
NM_000179.2(MSH6):c.3379G>A (p.Ala1127Thr) rs1060502880
NM_000179.2(MSH6):c.3380C>G (p.Ala1127Gly)
NM_000179.2(MSH6):c.3383A>G (p.Tyr1128Cys) rs587779261
NM_000179.2(MSH6):c.3383_3384dup (p.Cys1129fs)
NM_000179.2(MSH6):c.3384T>C (p.Tyr1128=) rs544518097
NM_000179.2(MSH6):c.3385T>G (p.Cys1129Gly) rs1060502905
NM_000179.2(MSH6):c.3388G>T (p.Val1130Leu) rs752164796
NM_000179.2(MSH6):c.3394G>C (p.Val1132Leu) rs781676597
NM_000179.2(MSH6):c.3396T>A (p.Val1132=) rs1026907245
NM_000179.2(MSH6):c.3398C>A (p.Thr1133Asn) rs730881805
NM_000179.2(MSH6):c.3398del (p.Thr1133fs) rs1553331722
NM_000179.2(MSH6):c.3399T>C (p.Thr1133=) rs61748084
NM_000179.2(MSH6):c.339C>T (p.His113=) rs886056141
NM_000179.2(MSH6):c.33C>G (p.Phe11Leu) rs747802641
NM_000179.2(MSH6):c.3409A>G (p.Met1137Val) rs1558387808
NM_000179.2(MSH6):c.3410T>C (p.Met1137Thr) rs1553331742
NM_000179.2(MSH6):c.3410_3418del (p.Met1137_Gly1139del) rs1553331738
NM_000179.2(MSH6):c.3412G>A (p.Gly1138Arg)
NM_000179.2(MSH6):c.3414G>A (p.Gly1138=) rs1553331748
NM_000179.2(MSH6):c.3415G>T (p.Gly1139Cys)
NM_000179.2(MSH6):c.3416G>A (p.Gly1139Asp) rs1316409501
NM_000179.2(MSH6):c.3416del (p.Gly1139fs) rs587781544
NM_000179.2(MSH6):c.341C>G (p.Pro114Arg) rs863224626
NM_000179.2(MSH6):c.3420G>A (p.Lys1140=) rs754435507
NM_000179.2(MSH6):c.3424A>G (p.Thr1142Ala)
NM_000179.2(MSH6):c.3425C>T (p.Thr1142Met) rs267608089
NM_000179.2(MSH6):c.3426G>A (p.Thr1142=) rs747771350
NM_000179.2(MSH6):c.3429T>C (p.Leu1143=) rs562766087
NM_000179.2(MSH6):c.342C>T (p.Pro114=) rs1057520438
NM_000179.2(MSH6):c.3431T>G (p.Met1144Arg) rs864622607
NM_000179.2(MSH6):c.3435A>G (p.Arg1145=) rs1060504742
NM_000179.2(MSH6):c.3435del (p.Arg1145fs) rs863224476
NM_000179.2(MSH6):c.3436C>T (p.Gln1146Ter) rs63750356
NM_000179.2(MSH6):c.3437A>C (p.Gln1146Pro) rs587779262
NM_000179.2(MSH6):c.3438+10T>G rs372775152
NM_000179.2(MSH6):c.3438+17G>C rs759737239
NM_000179.2(MSH6):c.3438+2dup rs1114167778
NM_000179.2(MSH6):c.3438+5C>G rs777420424
NM_000179.2(MSH6):c.3438+6T>C rs370170322
NM_000179.2(MSH6):c.3438+8dupA rs878853734
NM_000179.2(MSH6):c.3439-10T>A rs730881819
NM_000179.2(MSH6):c.3439-16C>T rs192614006
NM_000179.2(MSH6):c.3439-1G>T rs587779263
NM_000179.2(MSH6):c.3439-2A>G rs267608098
NM_000179.2(MSH6):c.3439-2A>T rs267608098
NM_000179.2(MSH6):c.3439-7T>G rs863224622
NM_000179.2(MSH6):c.3439-8A>G rs863224332
NM_000179.2(MSH6):c.3439G>A (p.Ala1147Thr) rs770054790
NM_000179.2(MSH6):c.3439G>C (p.Ala1147Pro)
NM_000179.2(MSH6):c.3440C>T (p.Ala1147Val) rs876659975
NM_000179.2(MSH6):c.3441T>G (p.Ala1147=) rs1389565996
NM_000179.2(MSH6):c.3442G>A (p.Gly1148Ser) rs63750257
NM_000179.2(MSH6):c.3443G>C (p.Gly1148Ala)
NM_000179.2(MSH6):c.3443del (p.Gly1148fs) rs1553332151
NM_000179.2(MSH6):c.3445T>A (p.Leu1149Ile) rs878853735
NM_000179.2(MSH6):c.3447A>C (p.Leu1149Phe) rs876660151
NM_000179.2(MSH6):c.3449T>A (p.Leu1150Ter) rs1057517763
NM_000179.2(MSH6):c.3449T>C (p.Leu1150Ser)
NM_000179.2(MSH6):c.3450A>C (p.Leu1150Phe) rs762134820
NM_000179.2(MSH6):c.3452C>G (p.Ala1151Gly) rs587782625
NM_000179.2(MSH6):c.3452C>T (p.Ala1151Val) rs587782625
NM_000179.2(MSH6):c.3456A>G (p.Val1152=) rs750998416
NM_000179.2(MSH6):c.3459G>A (p.Met1153Ile) rs1553332160
NM_000179.2(MSH6):c.3460G>C (p.Ala1154Pro)
NM_000179.2(MSH6):c.3461C>A (p.Ala1154Asp) rs786202842
NM_000179.2(MSH6):c.3461C>G (p.Ala1154Gly) rs786202842
NM_000179.2(MSH6):c.3465G>C (p.Gln1155His) rs766817979
NM_000179.2(MSH6):c.3465G>T (p.Gln1155His) rs766817979
NM_000179.2(MSH6):c.3466A>G (p.Met1156Val) rs1060502931
NM_000179.2(MSH6):c.3467T>C (p.Met1156Thr) rs876659549
NM_000179.2(MSH6):c.3468G>A (p.Met1156Ile) rs876658980
NM_000179.2(MSH6):c.3468G>C (p.Met1156Ile)
NM_000179.2(MSH6):c.3469G>T (p.Gly1157Cys) rs587779264
NM_000179.2(MSH6):c.346G>A (p.Asp116Asn) rs1060502871
NM_000179.2(MSH6):c.3476dup (p.Tyr1159Ter) rs587782111
NM_000179.2(MSH6):c.3477C>A (p.Tyr1159Ter) rs398123231
NM_000179.2(MSH6):c.3477C>G (p.Tyr1159Ter) rs398123231
NM_000179.2(MSH6):c.3477C>T (p.Tyr1159=) rs398123231
NM_000179.2(MSH6):c.3477del (p.Cys1158_Tyr1159insTer) rs1114167767
NM_000179.2(MSH6):c.3478G>A (p.Val1160Ile) rs376799914
NM_000179.2(MSH6):c.3478G>T (p.Val1160Phe) rs376799914
NM_000179.2(MSH6):c.3480C>A (p.Val1160=) rs786201385
NM_000179.2(MSH6):c.3480C>G (p.Val1160=) rs786201385
NM_000179.2(MSH6):c.3482_3484CTG[1] (p.Ala1162del) rs63751427
NM_000179.2(MSH6):c.3483T>C (p.Pro1161=) rs757064383
NM_000179.2(MSH6):c.3484G>A (p.Ala1162Thr)
NM_000179.2(MSH6):c.3485C>A (p.Ala1162Asp) rs587779935
NM_000179.2(MSH6):c.3486T>C (p.Ala1162=) rs781119463
NM_000179.2(MSH6):c.3487G>T (p.Glu1163Ter) rs587779267
NM_000179.2(MSH6):c.3488A>T (p.Glu1163Val) rs63750252
NM_000179.2(MSH6):c.3489A>T (p.Glu1163Asp) rs531674673
NM_000179.2(MSH6):c.3491dup (p.Cys1165fs) rs876661073
NM_000179.2(MSH6):c.3492G>A (p.Val1164=) rs1060504745
NM_000179.2(MSH6):c.3498G>C (p.Arg1166Ser) rs1553332214
NM_000179.2(MSH6):c.3499C>T (p.Leu1167Phe) rs1553332217
NM_000179.2(MSH6):c.349G>A (p.Gly117Arg) rs1558652014
NM_000179.2(MSH6):c.34C>A (p.Pro12Thr) rs587782084
NM_000179.2(MSH6):c.3502A>C (p.Thr1168Pro) rs1558389395
NM_000179.2(MSH6):c.3505C>A (p.Pro1169Thr)
NM_000179.2(MSH6):c.3505C>G (p.Pro1169Ala) rs904846776
NM_000179.2(MSH6):c.350_353dup (p.Phe119fs)
NM_000179.2(MSH6):c.3510T>C (p.Ile1170=) rs1001812170
NM_000179.2(MSH6):c.3513T>C (p.Asp1171=) rs63749834
NM_000179.2(MSH6):c.3513_3514del (p.Asp1171fs) rs63750194
NM_000179.2(MSH6):c.3513_3523del (p.Asp1171_Arg1172insTer) rs1324100572
NM_000179.2(MSH6):c.3514_3515AG[1] (p.Arg1172fs) rs398123232
NM_000179.2(MSH6):c.3514dup (p.Arg1172fs) rs63751327
NM_000179.2(MSH6):c.3515G>C (p.Arg1172Thr) rs864622217
NM_000179.2(MSH6):c.3517G>A (p.Val1173Met) rs730881806
NM_000179.2(MSH6):c.3522_3524delinsAT (p.Phe1174fs)
NM_000179.2(MSH6):c.3524C>T (p.Thr1175Ile) rs369583604
NM_000179.2(MSH6):c.3526A>G (p.Arg1176Gly)
NM_000179.2(MSH6):c.3526A>T (p.Arg1176Ter) rs786203968
NM_000179.2(MSH6):c.3528_3532del (p.Leu1177fs) rs863225408
NM_000179.2(MSH6):c.3529C>G (p.Leu1177Val) rs748398941
NM_000179.2(MSH6):c.3532G>A (p.Gly1178Ser) rs1558389590
NM_000179.2(MSH6):c.3532G>C (p.Gly1178Arg)
NM_000179.2(MSH6):c.3534T>A (p.Gly1178=) rs876658537
NM_000179.2(MSH6):c.3536C>A (p.Ala1179Asp) rs773583312
NM_000179.2(MSH6):c.3537C>G (p.Ala1179=) rs200120044
NM_000179.2(MSH6):c.3539_3542CAGA[1] (p.Asp1181fs) rs1553332297
NM_000179.2(MSH6):c.3540A>C (p.Ser1180=) rs777096746
NM_000179.2(MSH6):c.3541G>A (p.Asp1181Asn)
NM_000179.2(MSH6):c.3541G>C (p.Asp1181His) rs762406364
NM_000179.2(MSH6):c.3542A>G (p.Asp1181Gly) rs876660216
NM_000179.2(MSH6):c.3543C>A (p.Asp1181Glu)
NM_000179.2(MSH6):c.3543C>G (p.Asp1181Glu) rs267608100
NM_000179.2(MSH6):c.3546_3548AAT[1] (p.Ile1183del)
NM_000179.2(MSH6):c.3548T>A (p.Ile1183Lys) rs1459635476
NM_000179.2(MSH6):c.354A>G (p.Thr118=) rs558590898
NM_000179.2(MSH6):c.3551T>C (p.Met1184Thr)
NM_000179.2(MSH6):c.3553T>G (p.Ser1185Ala) rs786202777
NM_000179.2(MSH6):c.3555_3556del (p.Ser1185_Gly1186insTer) rs1553332312
NM_000179.2(MSH6):c.3556+10T>C rs863224333
NM_000179.2(MSH6):c.3556+1G>A rs1060502926
NM_000179.2(MSH6):c.3556+1G>C
NM_000179.2(MSH6):c.3556+1G>T
NM_000179.2(MSH6):c.3556+2_3556+3insTT
NM_000179.2(MSH6):c.3556+3_3556+13del rs587779269
NM_000179.2(MSH6):c.3556+6T>G rs767210715
NM_000179.2(MSH6):c.3556G>C (p.Gly1186Arg) rs1060502909
NM_000179.2(MSH6):c.3557-1G>T rs1114167723
NM_000179.2(MSH6):c.3557-2A>T rs1558390582
NM_000179.2(MSH6):c.3557-2delA rs587779271
NM_000179.2(MSH6):c.3557-2dup rs587779271
NM_000179.2(MSH6):c.3557-3A>T rs41295274
NM_000179.2(MSH6):c.3557-4T>A rs1553332598
NM_000179.2(MSH6):c.3557G>A (p.Gly1186Asp) rs587781690
NM_000179.2(MSH6):c.3560A>G (p.Glu1187Gly) rs150632241
NM_000179.2(MSH6):c.3560A>T (p.Glu1187Val)
NM_000179.2(MSH6):c.3562_3565dup (p.Thr1189fs) rs786203331
NM_000179.2(MSH6):c.3562del (p.Ser1188fs) rs1553332622
NM_000179.2(MSH6):c.3563G>A (p.Ser1188Asn) rs587779272
NM_000179.2(MSH6):c.3565A>G (p.Thr1189Ala) rs753778809
NM_000179.2(MSH6):c.3568T>G (p.Phe1190Val)
NM_000179.2(MSH6):c.356T>G (p.Phe119Cys) rs1060502893
NM_000179.2(MSH6):c.3570T>C (p.Phe1190=) rs1060504765
NM_000179.2(MSH6):c.3573dup (p.Val1192fs) rs1057517764
NM_000179.2(MSH6):c.3577_3580dup (p.Leu1194Ter) rs773262801
NM_000179.2(MSH6):c.3577_3581del (p.Glu1193fs) rs1060502881
NM_000179.2(MSH6):c.3579A>G (p.Glu1193=) rs1060504759
NM_000179.2(MSH6):c.3584G>C (p.Ser1195Thr) rs758428552
NM_000179.2(MSH6):c.3586G>C (p.Glu1196Gln) rs75095286
NM_000179.2(MSH6):c.358A>G (p.Ile120Val) rs146455343
NM_000179.2(MSH6):c.3591T>C (p.Thr1197=) rs771340721
NM_000179.2(MSH6):c.3596G>A (p.Ser1199Asn) rs773185557
NM_000179.2(MSH6):c.3596G>C (p.Ser1199Thr) rs773185557
NM_000179.2(MSH6):c.3598A>G (p.Ile1200Val) rs781627838
NM_000179.2(MSH6):c.3599T>C (p.Ile1200Thr)
NM_000179.2(MSH6):c.359T>C (p.Ile120Thr) rs775971872
NM_000179.2(MSH6):c.3600A>G (p.Ile1200Met) rs587781482
NM_000179.2(MSH6):c.3601C>G (p.Leu1201Val) rs182024561
NM_000179.2(MSH6):c.3601C>T (p.Leu1201Phe) rs182024561
NM_000179.2(MSH6):c.3603C>T (p.Leu1201=) rs761458936
NM_000179.2(MSH6):c.3603_3605dup (p.Met1202_His1203insIle) rs1064796248
NM_000179.2(MSH6):c.3604A>G (p.Met1202Val) rs369778514
NM_000179.2(MSH6):c.3604A>T (p.Met1202Leu) rs369778514
NM_000179.2(MSH6):c.3605T>C (p.Met1202Thr) rs587779273
NM_000179.2(MSH6):c.3605T>G (p.Met1202Arg) rs587779273
NM_000179.2(MSH6):c.3607C>A (p.His1203Asn) rs876660882
NM_000179.2(MSH6):c.3607C>T (p.His1203Tyr) rs876660882
NM_000179.2(MSH6):c.3615A>G (p.Thr1205=) rs876660407
NM_000179.2(MSH6):c.3619C>G (p.His1207Asp) rs760391254
NM_000179.2(MSH6):c.3619C>T (p.His1207Tyr) rs760391254
NM_000179.2(MSH6):c.361C>T (p.Arg121Cys) rs763593669
NM_000179.2(MSH6):c.3625C>G (p.Leu1209Val)
NM_000179.2(MSH6):c.3625C>T (p.Leu1209=) rs753675331
NM_000179.2(MSH6):c.3632T>C (p.Leu1211Pro) rs864622041
NM_000179.2(MSH6):c.3634G>A (p.Val1212Met) rs864622748
NM_000179.2(MSH6):c.3634G>C (p.Val1212Leu)
NM_000179.2(MSH6):c.3635T>C (p.Val1212Ala) rs1060502896
NM_000179.2(MSH6):c.3636G>T (p.Val1212=) rs1363247790
NM_000179.2(MSH6):c.3639T>A (p.Asp1213Glu) rs1114167788
NM_000179.2(MSH6):c.363C>T (p.Arg121=) rs587779276
NM_000179.2(MSH6):c.3642A>G (p.Glu1214=) rs765247025
NM_000179.2(MSH6):c.3646+10T>A rs1057520325
NM_000179.2(MSH6):c.3646+1dup rs1553332768
NM_000179.2(MSH6):c.3646+2T>C rs1553332776
NM_000179.2(MSH6):c.3646+7C>T rs1057522750
NM_000179.2(MSH6):c.3647-10A>G rs756569687
NM_000179.2(MSH6):c.3647-1G>A rs587779279
NM_000179.2(MSH6):c.3647-4A>C rs1464965737
NM_000179.2(MSH6):c.3647-6T>A rs182871847
NM_000179.2(MSH6):c.3647-6T>C rs182871847
NM_000179.2(MSH6):c.3647-7T>G rs780269667
NM_000179.2(MSH6):c.3649A>G (p.Arg1217Gly) rs587780677
NM_000179.2(MSH6):c.364G>A (p.Glu122Lys) rs143036974
NM_000179.2(MSH6):c.3652G>C (p.Gly1218Arg) rs776407427
NM_000179.2(MSH6):c.3657T>C (p.Thr1219=) rs745491567
NM_000179.2(MSH6):c.3657_3661delinsCTCAT (p.Ala1220_Thr1221delinsSerSer) rs1553332973
NM_000179.2(MSH6):c.365A>G (p.Glu122Gly) rs1558652077
NM_000179.2(MSH6):c.3660_3663dup (p.Phe1222fs) rs752404604
NM_000179.2(MSH6):c.3663A>G (p.Thr1221=) rs876660304
NM_000179.2(MSH6):c.3669T>G (p.Asp1223Glu)
NM_000179.2(MSH6):c.366G>A (p.Glu122=) rs774303198
NM_000179.2(MSH6):c.3670G>C (p.Gly1224Arg)
NM_000179.2(MSH6):c.3674C>A (p.Thr1225Lys)
NM_000179.2(MSH6):c.3674C>T (p.Thr1225Met) rs63750370
NM_000179.2(MSH6):c.3675G>A (p.Thr1225=) rs730881820
NM_000179.2(MSH6):c.3676G>A (p.Ala1226Thr) rs1064794746
NM_000179.2(MSH6):c.3679A>G (p.Ile1227Val)
NM_000179.2(MSH6):c.3685A>C (p.Asn1229His) rs774249402
NM_000179.2(MSH6):c.3685A>T (p.Asn1229Tyr) rs774249402
NM_000179.2(MSH6):c.3686A>G (p.Asn1229Ser) rs730881807
NM_000179.2(MSH6):c.3689C>G (p.Ala1230Gly) rs587782117
NM_000179.2(MSH6):c.3690del (p.Val1231fs) rs730881829
NM_000179.2(MSH6):c.3691_3693GTT[1] (p.Val1232del) rs587779284
NM_000179.2(MSH6):c.3696dup (p.Lys1233Ter) rs1553333017
NM_000179.2(MSH6):c.3698A>G (p.Lys1233Arg) rs766557450
NM_000179.2(MSH6):c.3699_3702del (p.Lys1233fs) rs193922343
NM_000179.2(MSH6):c.3699_3702dup (p.Leu1235fs) rs193922343
NM_000179.2(MSH6):c.3699del (p.Glu1234fs) rs1558392033
NM_000179.2(MSH6):c.369A>T (p.Lys123Asn) rs587782106
NM_000179.2(MSH6):c.3700G>A (p.Glu1234Lys) rs35717727
NM_000179.2(MSH6):c.3703C>G (p.Leu1235Val) rs876661084
NM_000179.2(MSH6):c.3705T>C (p.Leu1235=) rs545552712
NM_000179.2(MSH6):c.3708T>C (p.Ala1236=) rs1553333043
NM_000179.2(MSH6):c.3711G>A (p.Glu1237=) rs754289472
NM_000179.2(MSH6):c.3711G>C (p.Glu1237Asp) rs754289472
NM_000179.2(MSH6):c.3712A>T (p.Thr1238Ser)
NM_000179.2(MSH6):c.3713C>G (p.Thr1238Ser) rs755349360
NM_000179.2(MSH6):c.3714_3715TA[1] (p.Ile1239fs) rs1064794384
NM_000179.2(MSH6):c.3715A>G (p.Ile1239Val) rs1469961964
NM_000179.2(MSH6):c.3716T>C (p.Ile1239Thr) rs786203816
NM_000179.2(MSH6):c.3716T>G (p.Ile1239Arg) rs786203816
NM_000179.2(MSH6):c.3717A>G (p.Ile1239Met)
NM_000179.2(MSH6):c.3717_3721dup (p.Cys1241Ter) rs878853736
NM_000179.2(MSH6):c.3719A>G (p.Lys1240Arg) rs1553333057
NM_000179.2(MSH6):c.371G>T (p.Gly124Val) rs1553410286
NM_000179.2(MSH6):c.3720A>G (p.Lys1240=) rs786203260
NM_000179.2(MSH6):c.3724C>A (p.Arg1242Ser) rs587779285
NM_000179.2(MSH6):c.3724C>G (p.Arg1242Gly) rs587779285
NM_000179.2(MSH6):c.3724_3726del (p.Arg1242del) rs63749942
NM_000179.2(MSH6):c.3725G>A (p.Arg1242His) rs63750119
NM_000179.2(MSH6):c.3727A>T (p.Thr1243Ser) rs147453999
NM_000179.2(MSH6):c.3728C>A (p.Thr1243Lys) rs878853737
NM_000179.2(MSH6):c.3729A>G (p.Thr1243=) rs773807182
NM_000179.2(MSH6):c.3729_3731ATT[1] (p.Leu1244del) rs876658650
NM_000179.2(MSH6):c.3729_3731ATT[3] (p.Leu1244dup) rs876658650
NM_000179.2(MSH6):c.3730T>G (p.Leu1244Val) rs1060502938
NM_000179.2(MSH6):c.3731T>C (p.Leu1244Ser) rs1558392241
NM_000179.2(MSH6):c.3735_3769del (p.Thr1247fs) rs1558392228
NM_000179.2(MSH6):c.3738A>T (p.Ser1246=) rs1553333075
NM_000179.2(MSH6):c.3738_3759inv (p.His1248_Ser1251delinsAsnGluTrpTer)
NM_000179.2(MSH6):c.3739A>G (p.Thr1247Ala) rs769360577
NM_000179.2(MSH6):c.3740C>G (p.Thr1247Ser) rs786204182
NM_000179.2(MSH6):c.3742C>T (p.His1248Tyr) rs63750882
NM_000179.2(MSH6):c.3743_3744insT (p.Tyr1249fs) rs786201084
NM_000179.2(MSH6):c.3744_3773del (p.His1248_Ser1257del) rs863225412
NM_000179.2(MSH6):c.3749A>G (p.His1250Arg)
NM_000179.2(MSH6):c.374_382delinsT (p.Lys125fs) rs1553410300
NM_000179.2(MSH6):c.3753_3756dup (p.Val1253fs) rs876661222
NM_000179.2(MSH6):c.3757G>A (p.Val1253Ile) rs187491488
NM_000179.2(MSH6):c.3758T>A (p.Val1253Glu) rs202066386
NM_000179.2(MSH6):c.3758T>C (p.Val1253Ala) rs202066386
NM_000179.2(MSH6):c.3759A>T (p.Val1253=) rs1553333115
NM_000179.2(MSH6):c.3759_3761AGA[1] (p.Glu1254del) rs587779937
NM_000179.2(MSH6):c.3762A>T (p.Glu1254Asp) rs375459388
NM_000179.2(MSH6):c.3762_3763delinsTT (p.Glu1254_Asp1255delinsAspTyr) rs878853738
NM_000179.2(MSH6):c.3763G>C (p.Asp1255His)
NM_000179.2(MSH6):c.3766T>A (p.Tyr1256Asn) rs1553333129
NM_000179.2(MSH6):c.3767A>C (p.Tyr1256Ser) rs761643896
NM_000179.2(MSH6):c.3767A>G (p.Tyr1256Cys) rs761643896
NM_000179.2(MSH6):c.3768T>G (p.Tyr1256Ter) rs63751058
NM_000179.2(MSH6):c.3772C>G (p.Gln1258Glu) rs63750554
NM_000179.2(MSH6):c.3775_3776del (p.Asn1259fs)
NM_000179.2(MSH6):c.3779T>C (p.Val1260Ala) rs1212740618
NM_000179.2(MSH6):c.377C>G (p.Ser126Ter) rs1114167689
NM_000179.2(MSH6):c.3782C>T (p.Ala1261Val) rs773171352
NM_000179.2(MSH6):c.3784G>A (p.Val1262Met) rs587779290
NM_000179.2(MSH6):c.3784G>C (p.Val1262Leu) rs587779290
NM_000179.2(MSH6):c.3786G>A (p.Val1262=) rs760771483
NM_000179.2(MSH6):c.3787C>T (p.Arg1263Cys) rs367912290
NM_000179.2(MSH6):c.3788G>A (p.Arg1263His) rs147852216
NM_000179.2(MSH6):c.3789C>T (p.Arg1263=) rs1553333156
NM_000179.2(MSH6):c.3790C>T (p.Leu1264=) rs786202696
NM_000179.2(MSH6):c.3792A>C (p.Leu1264=) rs786202051
NM_000179.2(MSH6):c.3793G>T (p.Gly1265Ter)
NM_000179.2(MSH6):c.3796C>T (p.His1266Tyr) rs972387746
NM_000179.2(MSH6):c.3797A>G (p.His1266Arg) rs760023025
NM_000179.2(MSH6):c.3797_3798AT[1] (p.Met1267fs) rs267608114
NM_000179.2(MSH6):c.3798T>C (p.His1266=) rs1060504761
NM_000179.2(MSH6):c.3798_3801+9delTATGGTATGTGCA rs1553333168
NM_000179.2(MSH6):c.379G>A (p.Val127Ile) rs1553410307
NM_000179.2(MSH6):c.37A>G (p.Lys13Glu) rs942019524
NM_000179.2(MSH6):c.3800T>C (p.Met1267Thr) rs148445930
NM_000179.2(MSH6):c.3801+10A>G
NM_000179.2(MSH6):c.3801+1G>T rs876660943
NM_000179.2(MSH6):c.3801+1_3801+5delGTATG rs1553333175
NM_000179.2(MSH6):c.3801+1delG rs1553333185
NM_000179.2(MSH6):c.3801+4T>C rs758830540
NM_000179.2(MSH6):c.3801+5G>A rs201080919
NM_000179.2(MSH6):c.3801+6T>C rs749922503
NM_000179.2(MSH6):c.3801+8C>A rs864622734
NM_000179.2(MSH6):c.3802-6_3802-4delCTT rs587781932
NM_000179.2(MSH6):c.3802-7_3802-4delTCTT rs876661171
NM_000179.2(MSH6):c.3802-8T>G rs864622195
NM_000179.2(MSH6):c.3802-8_3802-4dupTTCTT rs745801834
NM_000179.2(MSH6):c.3803C>T (p.Ala1268Val) rs587779293
NM_000179.2(MSH6):c.3804dup (p.Cys1269fs) rs267608118
NM_000179.2(MSH6):c.3806G>C (p.Cys1269Ser) rs876658276
NM_000179.2(MSH6):c.3807C>T (p.Cys1269=) rs747924946
NM_000179.2(MSH6):c.3808A>G (p.Met1270Val) rs757963162
NM_000179.2(MSH6):c.3808_3824dup (p.Cys1275Ter)
NM_000179.2(MSH6):c.3809T>A (p.Met1270Lys) rs777617756
NM_000179.2(MSH6):c.3809_3812dup (p.Glu1272fs) rs1553333301
NM_000179.2(MSH6):c.3810G>A (p.Met1270Ile) rs1558393029
NM_000179.2(MSH6):c.3811G>A (p.Val1271Ile) rs770929545
NM_000179.2(MSH6):c.3811_3824del (p.Met1270_Val1271insTer) rs1558393006
NM_000179.2(MSH6):c.3812T>C (p.Val1271Ala) rs1553333303
NM_000179.2(MSH6):c.3813dup (p.Glu1272fs) rs1553333310
NM_000179.2(MSH6):c.3814_3827dup (p.Asp1277fs) rs1558393070
NM_000179.2(MSH6):c.3818dup (p.Asn1273fs) rs1553333321
NM_000179.2(MSH6):c.3819T>C (p.Asn1273=) rs759642651
NM_000179.2(MSH6):c.3819T>G (p.Asn1273Lys) rs759642651
NM_000179.2(MSH6):c.381C>T (p.Val127=) rs863224334
NM_000179.2(MSH6):c.3820G>C (p.Glu1274Gln) rs587779294
NM_000179.2(MSH6):c.3823_3828del (p.Cys1275_Glu1276del) rs1558393107
NM_000179.2(MSH6):c.3824G>A (p.Cys1275Tyr) rs150990541
NM_000179.2(MSH6):c.3824G>T (p.Cys1275Phe) rs150990541
NM_000179.2(MSH6):c.3827_3830dup (p.Asp1277fs) rs1060502903
NM_000179.2(MSH6):c.382C>T (p.Arg128Cys) rs1251938412
NM_000179.2(MSH6):c.3830_3833del (p.Asp1277fs)
NM_000179.2(MSH6):c.3832C>A (p.Pro1278Thr) rs587782109
NM_000179.2(MSH6):c.3832C>T (p.Pro1278Ser)
NM_000179.2(MSH6):c.3833C>A (p.Pro1278His)
NM_000179.2(MSH6):c.3833C>G (p.Pro1278Arg) rs201191389
NM_000179.2(MSH6):c.3833C>T (p.Pro1278Leu) rs201191389
NM_000179.2(MSH6):c.3836G>A (p.Ser1279Asn) rs864622400
NM_000179.2(MSH6):c.3837C>G (p.Ser1279Arg) rs876661245
NM_000179.2(MSH6):c.3839A>C (p.Gln1280Pro) rs1210663110
NM_000179.2(MSH6):c.383G>T (p.Arg128Leu) rs63750143
NM_000179.2(MSH6):c.3840_3846del (p.Glu1281fs) rs63751319
NM_000179.2(MSH6):c.3841G>A (p.Glu1281Lys) rs876659115
NM_000179.2(MSH6):c.3841G>C (p.Glu1281Gln) rs876659115
NM_000179.2(MSH6):c.3843G>T (p.Glu1281Asp) rs864622384
NM_000179.2(MSH6):c.3844A>C (p.Thr1282Pro) rs764507968
NM_000179.2(MSH6):c.3844A>G (p.Thr1282Ala) rs764507968
NM_000179.2(MSH6):c.3845C>A (p.Thr1282Asn) rs876660361
NM_000179.2(MSH6):c.3845_3847del (p.Thr1282del) rs1367615271
NM_000179.2(MSH6):c.3846dup (p.Ile1283fs) rs866771359
NM_000179.2(MSH6):c.3847A>G (p.Ile1283Val) rs144714869
NM_000179.2(MSH6):c.3847_3850dup (p.Thr1284fs) rs267608128
NM_000179.2(MSH6):c.3847_3851delinsTA (p.Ile1283_Thr1284delinsTer)
NM_000179.2(MSH6):c.3848_3850dup (p.Ile1283dup) rs1553333420
NM_000179.2(MSH6):c.3850_3851insGGA (p.Thr1284_Phe1285insArg) rs1553333421
NM_000179.2(MSH6):c.3850_3857dup (p.Tyr1287fs) rs1553333432
NM_000179.2(MSH6):c.3851C>A (p.Thr1284Lys)
NM_000179.2(MSH6):c.3851C>G (p.Thr1284Arg)
NM_000179.2(MSH6):c.3851C>T (p.Thr1284Met) rs63750836
NM_000179.2(MSH6):c.3851delinsTTAAT (p.Thr1284fs) rs1553333438
NM_000179.2(MSH6):c.3852G>A (p.Thr1284=) rs2229018
NM_000179.2(MSH6):c.3852G>T (p.Thr1284=) rs2229018
NM_000179.2(MSH6):c.3854T>C (p.Phe1285Ser) rs1553333453
NM_000179.2(MSH6):c.3854_3861del (p.Thr1284_Phe1285insTer) rs1553333449
NM_000179.2(MSH6):c.3856C>T (p.Leu1286Phe) rs1060502887
NM_000179.2(MSH6):c.385G>A (p.Val129Ile)
NM_000179.2(MSH6):c.3861T>C (p.Tyr1287=) rs1060504739
NM_000179.2(MSH6):c.3864dup (p.Phe1289fs) rs878853739
NM_000179.2(MSH6):c.3867C>G (p.Phe1289Leu) rs878853740
NM_000179.2(MSH6):c.3875G>C (p.Gly1292Ala) rs1553333492
NM_000179.2(MSH6):c.3878_3881dup (p.Pro1295fs) rs1553333500
NM_000179.2(MSH6):c.3880_3892del (p.Cys1294fs) rs1553333497
NM_000179.2(MSH6):c.3881G>A (p.Cys1294Tyr) rs878853741
NM_000179.2(MSH6):c.3881G>T (p.Cys1294Phe) rs878853741
NM_000179.2(MSH6):c.3882T>C (p.Cys1294=) rs1060504744
NM_000179.2(MSH6):c.3882del (p.Pro1295fs) rs876658817
NM_000179.2(MSH6):c.3884C>G (p.Pro1295Arg) rs758181932
NM_000179.2(MSH6):c.3884C>T (p.Pro1295Leu) rs758181932
NM_000179.2(MSH6):c.3886A>C (p.Lys1296Gln) rs575714670
NM_000179.2(MSH6):c.3886A>G (p.Lys1296Glu) rs575714670
NM_000179.2(MSH6):c.3887A>G (p.Lys1296Arg) rs1553333526
NM_000179.2(MSH6):c.3892T>A (p.Tyr1298Asn)
NM_000179.2(MSH6):c.3893A>G (p.Tyr1298Cys) rs786202520
NM_000179.2(MSH6):c.3893dup (p.Tyr1298Ter) rs1553333530
NM_000179.2(MSH6):c.3895G>A (p.Gly1299Ser) rs1553333534
NM_000179.2(MSH6):c.389A>G (p.His130Arg) rs1064793184
NM_000179.2(MSH6):c.38A>C (p.Lys13Thr) rs41294988
NM_000179.2(MSH6):c.38A>G (p.Lys13Arg) rs41294988
NM_000179.2(MSH6):c.38A>T (p.Lys13Met) rs41294988
NM_000179.2(MSH6):c.3900T>C (p.Phe1300=) rs1060504751
NM_000179.2(MSH6):c.3904G>A (p.Ala1302Thr) rs1553333561
NM_000179.2(MSH6):c.3909A>G (p.Ala1303=) rs757286252
NM_000179.2(MSH6):c.3911G>A (p.Arg1304Lys) rs34625968
NM_000179.2(MSH6):c.3919A>C (p.Asn1307His) rs730881808
NM_000179.2(MSH6):c.3920_3927dup (p.Glu1310fs) rs587779295
NM_000179.2(MSH6):c.3921T>A (p.Asn1307Lys) rs876659660
NM_000179.2(MSH6):c.3921T>G (p.Asn1307Lys) rs876659660
NM_000179.2(MSH6):c.3926_3927insGAGA (p.Glu1310fs) rs1553333605
NM_000179.2(MSH6):c.3930G>C (p.Glu1310Asp) rs267608129
NM_000179.2(MSH6):c.3930_3970dup (p.Glu1324fs) rs878853742
NM_000179.2(MSH6):c.3930_3978dup (p.Asn1327delinsGlySerTyrSerLysGlyThrTer) rs1558394104
NM_000179.2(MSH6):c.3931del (p.Glu1311fs) rs1558394093
NM_000179.2(MSH6):c.3932_3934dup (p.Glu1311dup) rs774984690
NM_000179.2(MSH6):c.3934G>C (p.Val1312Leu) rs1553333634
NM_000179.2(MSH6):c.3934_3937dup (p.Ile1313fs) rs760190301
NM_000179.2(MSH6):c.3935_3954dup (p.Lys1319fs) rs1553333644
NM_000179.2(MSH6):c.3936T>C (p.Val1312=) rs61753796
NM_000179.2(MSH6):c.3936_3941dup (p.Gln1314_Lys1315insHisIle) rs1553333654
NM_000179.2(MSH6):c.3936_4001+8dup
NM_000179.2(MSH6):c.3938T>C (p.Ile1313Thr) rs762115705
NM_000179.2(MSH6):c.3938_3941dup (p.Gln1314fs) rs267608126
NM_000179.2(MSH6):c.3939_3940dup (p.Gln1314fs) rs730881830
NM_000179.2(MSH6):c.3939_3957dup (p.Ala1320delinsSerLysGlyThrTer) rs63750767
NM_000179.2(MSH6):c.3939_3959dup (p.Gln1314_Ala1320dup) rs1553333670
NM_000179.2(MSH6):c.3939dup (p.Gln1314fs) rs1553333633
NM_000179.2(MSH6):c.393A>C (p.Val131=) rs752488540
NM_000179.2(MSH6):c.393A>G (p.Val131=) rs752488540
NM_000179.2(MSH6):c.3940C>G (p.Gln1314Glu)
NM_000179.2(MSH6):c.3942A>G (p.Gln1314=) rs768042560
NM_000179.2(MSH6):c.3944A>G (p.Lys1315Arg) rs1558394245
NM_000179.2(MSH6):c.3946_3958del (p.Gly1316fs) rs1553333674
NM_000179.2(MSH6):c.3947G>A (p.Gly1316Glu) rs876661174
NM_000179.2(MSH6):c.3949C>G (p.His1317Asp) rs759092293
NM_000179.2(MSH6):c.394C>G (p.Gln132Glu) rs587782101
NM_000179.2(MSH6):c.394C>T (p.Gln132Ter)
NM_000179.2(MSH6):c.3951T>C (p.His1317=) rs764786814
NM_000179.2(MSH6):c.3951T>G (p.His1317Gln) rs764786814
NM_000179.2(MSH6):c.3956A>C (p.Lys1319Thr)
NM_000179.2(MSH6):c.3956A>G (p.Lys1319Arg) rs876659383
NM_000179.2(MSH6):c.3956_3957dup (p.Ala1320fs) rs587779297
NM_000179.2(MSH6):c.3956_3974del (p.Lys1319fs) rs1558394336
NM_000179.2(MSH6):c.3957del (p.Ala1320fs) rs587779297
NM_000179.2(MSH6):c.3958G>C (p.Ala1320Pro)
NM_000179.2(MSH6):c.3959_3962del (p.Ala1320fs) rs267608120
NM_000179.2(MSH6):c.3960A>G (p.Ala1320=) rs373425206
NM_000179.2(MSH6):c.3961A>G (p.Arg1321Gly) rs41295278
NM_000179.2(MSH6):c.3962G>T (p.Arg1321Ile) rs1064795473
NM_000179.2(MSH6):c.3965A>G (p.Glu1322Gly)
NM_000179.2(MSH6):c.3966A>T (p.Glu1322Asp) rs1064794745
NM_000179.2(MSH6):c.3966dup (p.Phe1323fs) rs886044911
NM_000179.2(MSH6):c.3968T>C (p.Phe1323Ser) rs1051564593
NM_000179.2(MSH6):c.3969_4001+52dup rs1553333718
NM_000179.2(MSH6):c.396G>C (p.Gln132His) rs864622216
NM_000179.2(MSH6):c.3970G>C (p.Glu1324Gln)
NM_000179.2(MSH6):c.3971_3973AGA[1] (p.Lys1325del) rs587779300
NM_000179.2(MSH6):c.3972G>C (p.Glu1324Asp) rs587779938
NM_000179.2(MSH6):c.3972_3979del (p.Lys1325fs)
NM_000179.2(MSH6):c.3973A>T (p.Lys1325Ter) rs1060502937
NM_000179.2(MSH6):c.3974A>G (p.Lys1325Arg) rs876658189
NM_000179.2(MSH6):c.3974A>T (p.Lys1325Met) rs876658189
NM_000179.2(MSH6):c.3976A>C (p.Met1326Leu) rs587779939
NM_000179.2(MSH6):c.3976A>T (p.Met1326Leu) rs587779939
NM_000179.2(MSH6):c.3977T>G (p.Met1326Arg) rs757089977
NM_000179.2(MSH6):c.3978G>A (p.Met1326Ile) rs141464646
NM_000179.2(MSH6):c.3978G>C (p.Met1326Ile) rs141464646
NM_000179.2(MSH6):c.3978_3995dup (p.Asn1327_Leu1332dup) rs1553333731
NM_000179.2(MSH6):c.3979A>C (p.Asn1327His) rs756216566
NM_000179.2(MSH6):c.3979A>T (p.Asn1327Tyr) rs756216566
NM_000179.2(MSH6):c.3980A>G (p.Asn1327Ser) rs780187989
NM_000179.2(MSH6):c.3980_3983dup (p.Leu1330fs) rs1553333738
NM_000179.2(MSH6):c.3980dup (p.Asn1327fs) rs587782326
NM_000179.2(MSH6):c.3983A>C (p.Gln1328Pro) rs587779940
NM_000179.2(MSH6):c.3983A>T (p.Gln1328Leu) rs587779940
NM_000179.2(MSH6):c.3986C>T (p.Ser1329Leu) rs199594809
NM_000179.2(MSH6):c.3988C>G (p.Leu1330Val) rs768944975
NM_000179.2(MSH6):c.3988C>T (p.Leu1330=) rs768944975
NM_000179.2(MSH6):c.3989T>G (p.Leu1330Arg) rs774395829
NM_000179.2(MSH6):c.3991C>T (p.Arg1331Ter) rs267608094
NM_000179.2(MSH6):c.3992G>A (p.Arg1331Gln) rs184131049
NM_000179.2(MSH6):c.3993A>G (p.Arg1331=) rs772401158
NM_000179.2(MSH6):c.3994T>A (p.Leu1332Ile) rs786204160
NM_000179.2(MSH6):c.3994T>G (p.Leu1332Val) rs786204160
NM_000179.2(MSH6):c.3996_3999dup (p.Arg1334fs) rs1553333753
NM_000179.2(MSH6):c.3996_4000dup (p.Arg1334fs) rs587779301
NM_000179.2(MSH6):c.3G>T (p.Met1Ile) rs876660095
NM_000179.2(MSH6):c.3del (p.Met1fs) rs1553408068
NM_000179.2(MSH6):c.4000C>T (p.Arg1334Trp) rs773763465
NM_000179.2(MSH6):c.4001+11_4001+15dupAACTA rs587779302
NM_000179.2(MSH6):c.4001+11_4001+35delAACTATAATGGAATTATAACTAACT rs878853743
NM_000179.2(MSH6):c.4001+12_4001+15del rs267608132
NM_000179.2(MSH6):c.4001+12_4001+15dupACTA rs267608132
NM_000179.2(MSH6):c.4001+2T>C rs267608131
NM_000179.2(MSH6):c.4001+3_4001+5dup rs1553333781
NM_000179.2(MSH6):c.4001+5C>T rs786202305
NM_000179.2(MSH6):c.4001+7_4001+8insT rs1553333785
NM_000179.2(MSH6):c.4001+8_4001+12dup rs1424851908
NM_000179.2(MSH6):c.4001+8_4001+9insATTTCT rs1553333788
NM_000179.2(MSH6):c.4001+9C>G
NM_000179.2(MSH6):c.4001+9C>T rs1467103778
NM_000179.2(MSH6):c.4001G>A (p.Arg1334Gln) rs267608122
NM_000179.2(MSH6):c.4001G>C (p.Arg1334Pro) rs267608122
NM_000179.2(MSH6):c.4002-10T>A rs545466048
NM_000179.2(MSH6):c.4002-10T>G rs545466048
NM_000179.2(MSH6):c.4002-10_4002-4delTAATTTT rs1553333935
NM_000179.2(MSH6):c.4002-11_4002-4delTTAATTTT rs1060504752
NM_000179.2(MSH6):c.4002-22_4002-10delinsAAGGG rs878853744
NM_000179.2(MSH6):c.4002-2A>G rs878853745
NM_000179.2(MSH6):c.4002-4T>C rs370428032
NM_000179.2(MSH6):c.4002-5T>G rs1060502872
NM_000179.2(MSH6):c.4002-8A>C rs778957100
NM_000179.2(MSH6):c.4002-8A>T rs778957100
NM_000179.2(MSH6):c.4002-8_4002-7insAACTTTTTTTTTTTTT rs1553333915
NM_000179.2(MSH6):c.4002-8_4002-7insGGGAA rs267608139
NM_000179.2(MSH6):c.4002-8delA rs267608139
NM_000179.2(MSH6):c.4002-8dupA rs267608139
NM_000179.2(MSH6):c.4002-9_4002-7delAAT rs864622105
NM_000179.2(MSH6):c.4004A>C (p.Glu1335Ala) rs564434147
NM_000179.2(MSH6):c.4004_4007dup (p.Cys1337fs) rs876658497
NM_000179.2(MSH6):c.4005A>C (p.Glu1335Asp) rs786204130
NM_000179.2(MSH6):c.4008T>G (p.Val1336=) rs1553333982
NM_000179.2(MSH6):c.4012C>T (p.Leu1338=) rs1060504743
NM_000179.2(MSH6):c.4015_4033del (p.Leu1338_Ala1339insTer) rs1558395566
NM_000179.2(MSH6):c.4016_4017dup (p.Ser1340fs) rs876661127
NM_000179.2(MSH6):c.4018_4032del (p.Ser1340_Thr1344del) rs1553333998
NM_000179.2(MSH6):c.4020T>G (p.Ser1340Arg) rs1558395612
NM_000179.2(MSH6):c.4022_4077dup (p.Leu1360delinsLysGlyGlnLeuTer) rs1553334006
NM_000179.2(MSH6):c.4024_4044del (p.Arg1342_Glu1348del) rs1064792973
NM_000179.2(MSH6):c.4027_4028del (p.Ser1343fs)
NM_000179.2(MSH6):c.4028C>G (p.Ser1343Ter) rs863225420
NM_000179.2(MSH6):c.4029_4031dup (p.Thr1344dup)
NM_000179.2(MSH6):c.4030A>G (p.Thr1344Ala) rs1553334019
NM_000179.2(MSH6):c.4033G>A (p.Val1345Ile) rs747613376
NM_000179.2(MSH6):c.4034_4042del (p.Val1345_Ala1347del) rs864622703
NM_000179.2(MSH6):c.4037A>G (p.Asp1346Gly)
NM_000179.2(MSH6):c.4039G>C (p.Ala1347Pro) rs730881809
NM_000179.2(MSH6):c.4043A>C (p.Glu1348Ala) rs1449733937
NM_000179.2(MSH6):c.4044A>C (p.Glu1348Asp) rs786203740
NM_000179.2(MSH6):c.4051C>T (p.His1351Tyr) rs1558395737
NM_000179.2(MSH6):c.4052A>G (p.His1351Arg) rs1325140069
NM_000179.2(MSH6):c.4052A>T (p.His1351Leu)
NM_000179.2(MSH6):c.4054A>G (p.Lys1352Glu) rs587782309
NM_000179.2(MSH6):c.405T>A (p.Asp135Glu)
NM_000179.2(MSH6):c.4061T>C (p.Leu1354Pro) rs267608140
NM_000179.2(MSH6):c.4062G>C (p.Leu1354=) rs863224335
NM_000179.2(MSH6):c.4062G>T (p.Leu1354=) rs863224335
NM_000179.2(MSH6):c.4062_4065dup (p.Leu1356fs) rs1553334056
NM_000179.2(MSH6):c.4064C>G (p.Thr1355Ser) rs863224627
NM_000179.2(MSH6):c.4066T>G (p.Leu1356Val) rs1226221560
NM_000179.2(MSH6):c.4068G>C (p.Leu1356Phe) rs192740549
NM_000179.2(MSH6):c.4068_4071del (p.Ile1357fs)
NM_000179.2(MSH6):c.4068_4071dup (p.Lys1358delinsAspTer) rs55740729
NM_000179.2(MSH6):c.4070T>A (p.Ile1357Asn)
NM_000179.2(MSH6):c.4070T>G (p.Ile1357Ser) rs1209834047
NM_000179.2(MSH6):c.4070_*5del (p.Ile1357fs)
NM_000179.2(MSH6):c.4071T>G (p.Ile1357Met) rs1553334107
NM_000179.2(MSH6):c.4071_*4dup (p.Ile1357_Ter1361=) rs1491544951
NM_000179.2(MSH6):c.4072_*12del (p.Lys1358_Ter1361del) rs1553334099
NM_000179.2(MSH6):c.4073A>G (p.Lys1358Arg) rs1553334111
NM_000179.2(MSH6):c.4075G>A (p.Glu1359Lys) rs267608081
NM_000179.2(MSH6):c.4075G>T (p.Glu1359Ter)
NM_000179.2(MSH6):c.4077_4080dup (p.Ter1361IleextTer?) rs575068534
NM_000179.2(MSH6):c.4079_4080TA[1] (p.Ter1361AspextTer?) rs863224830
NM_000179.2(MSH6):c.4079_4081dup (p.Leu1360dup) rs1553334041
NM_000179.2(MSH6):c.4081T>C (p.Ter1361Gln) rs765098678
NM_000179.2(MSH6):c.4081dup (p.Ter1361LeuextTer?) rs1060502898
NM_000179.2(MSH6):c.4082A>T (p.Ter1361Leu) rs907892681
NM_000179.2(MSH6):c.4082_*11del (p.Ter1361LeuextTer?) rs1064794082
NM_000179.2(MSH6):c.4083G>C (p.Ter1361Tyr) rs1553334125
NM_000179.2(MSH6):c.4083_*3GACT[3] (p.Ter1361=) rs765313977
NM_000179.2(MSH6):c.408C>T (p.Asp136=) rs878853746
NM_000179.2(MSH6):c.415A>G (p.Thr139Ala) rs991924818
NM_000179.2(MSH6):c.417A>G (p.Thr139=) rs758390144
NM_000179.2(MSH6):c.419G>T (p.Arg140Met) rs876661293
NM_000179.2(MSH6):c.41C>T (p.Ser14Phe) rs863224628
NM_000179.2(MSH6):c.423del (p.Trp142fs) rs1114167728
NM_000179.2(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000179.2(MSH6):c.432C>T (p.Ser144=) rs1046304919
NM_000179.2(MSH6):c.435A>C (p.Lys145Asn) rs1321666742
NM_000179.2(MSH6):c.43C>G (p.Pro15Ala) rs776745497
NM_000179.2(MSH6):c.43C>T (p.Pro15Ser) rs776745497
NM_000179.2(MSH6):c.442_443del (p.Leu148fs) rs1060502875
NM_000179.2(MSH6):c.447G>C (p.Lys149Asn) rs1553410379
NM_000179.2(MSH6):c.448C>T (p.Pro150Ser) rs587782406
NM_000179.2(MSH6):c.44C>T (p.Pro15Leu) rs869312800
NM_000179.2(MSH6):c.450A>G (p.Pro150=) rs1553410383
NM_000179.2(MSH6):c.451T>A (p.Tyr151Asn) rs1060502904
NM_000179.2(MSH6):c.451T>C (p.Tyr151His) rs1060502904
NM_000179.2(MSH6):c.455C>T (p.Thr152Ile) rs1553410385
NM_000179.2(MSH6):c.457+2dupT rs876661224
NM_000179.2(MSH6):c.457+3A>G rs1060502921
NM_000179.2(MSH6):c.457+7G>C rs781280171
NM_000179.2(MSH6):c.457+9delC rs1553410391
NM_000179.2(MSH6):c.457G>A (p.Gly153Ser) rs1060502885
NM_000179.2(MSH6):c.457G>C (p.Gly153Arg) rs1060502885
NM_000179.2(MSH6):c.458-1G>T
NM_000179.2(MSH6):c.458-4C>G
NM_000179.2(MSH6):c.458-5T>C rs1553411388
NM_000179.2(MSH6):c.458-5delT rs587781955
NM_000179.2(MSH6):c.458-6T>C rs1060504740
NM_000179.2(MSH6):c.458-8C>G rs372091232
NM_000179.2(MSH6):c.458-?_3172+?del
NM_000179.2(MSH6):c.458-?_3556+?del
NM_000179.2(MSH6):c.458-?_4001+?del
NM_000179.2(MSH6):c.461C>G (p.Ser154Ter) rs1553411391
NM_000179.2(MSH6):c.463A>C (p.Lys155Gln) rs1276159036
NM_000179.2(MSH6):c.463A>T (p.Lys155Ter)
NM_000179.2(MSH6):c.467C>G (p.Ser156Ter) rs63749873
NM_000179.2(MSH6):c.468_471del (p.Glu158fs) rs587779941
NM_000179.2(MSH6):c.470A>T (p.Lys157Met) rs1060502923
NM_000179.2(MSH6):c.471G>A (p.Lys157=) rs786202690
NM_000179.2(MSH6):c.474A>G (p.Glu158=) rs878853747
NM_000179.2(MSH6):c.476C>T (p.Ala159Val) rs587778528
NM_000179.2(MSH6):c.479A>G (p.Gln160Arg)
NM_000179.2(MSH6):c.479A>T (p.Gln160Leu) rs1553411397
NM_000179.2(MSH6):c.483G>A (p.Lys161=) rs63751030
NM_000179.2(MSH6):c.491A>C (p.His164Pro) rs146469162
NM_000179.2(MSH6):c.491A>T (p.His164Leu) rs146469162
NM_000179.2(MSH6):c.494T>G (p.Phe165Cys) rs763841886
NM_000179.2(MSH6):c.503C>G (p.Ala168Gly) rs774162322
NM_000179.2(MSH6):c.504A>G (p.Ala168=) rs1057520319
NM_000179.2(MSH6):c.508C>T (p.Pro170Ser) rs878853748
NM_000179.2(MSH6):c.509C>G (p.Pro170Arg)
NM_000179.2(MSH6):c.50T>C (p.Leu17Pro) rs1553408119
NM_000179.2(MSH6):c.517C>G (p.Leu173Val) rs1553411421
NM_000179.2(MSH6):c.517_520del (p.Leu173fs) rs1553411419
NM_000179.2(MSH6):c.521G>A (p.Arg174Lys) rs863224629
NM_000179.2(MSH6):c.524C>G (p.Ala175Gly) rs1060502929
NM_000179.2(MSH6):c.526A>G (p.Met176Val) rs750327994
NM_000179.2(MSH6):c.527T>C (p.Met176Thr) rs1553411432
NM_000179.2(MSH6):c.52A>C (p.Ser18Arg) rs1553408122
NM_000179.2(MSH6):c.531A>T (p.Gln177His) rs886056142
NM_000179.2(MSH6):c.532C>T (p.Arg178Cys) rs730881813
NM_000179.2(MSH6):c.533G>A (p.Arg178His) rs786204186
NM_000179.2(MSH6):c.535G>T (p.Ala179Ser) rs587781817
NM_000179.2(MSH6):c.538G>A (p.Asp180Asn) rs1553411440
NM_000179.2(MSH6):c.540T>G (p.Asp180Glu)
NM_000179.2(MSH6):c.545C>G (p.Ala182Gly)
NM_000179.2(MSH6):c.552T>C (p.Asn184=) rs786203679
NM_000179.2(MSH6):c.555A>C (p.Lys185Asn) rs1558656651
NM_000179.2(MSH6):c.556G>A (p.Asp186Asn) rs1212607928
NM_000179.2(MSH6):c.558C>G (p.Asp186Glu) rs587779943
NM_000179.2(MSH6):c.560A>G (p.Lys187Arg) rs1553411459
NM_000179.2(MSH6):c.564dup (p.Lys189Ter)
NM_000179.2(MSH6):c.566A>G (p.Lys189Arg) rs1060502889
NM_000179.2(MSH6):c.566A>T (p.Lys189Met) rs1060502889
NM_000179.2(MSH6):c.56A>G (p.Asp19Gly) rs1553408133
NM_000179.2(MSH6):c.578del (p.Leu193fs) rs587782281
NM_000179.2(MSH6):c.57T>C (p.Asp19=) rs752794296
NM_000179.2(MSH6):c.581C>G (p.Ala194Gly) rs1558656693
NM_000179.2(MSH6):c.589G>C (p.Asp197His) rs148517241
NM_000179.2(MSH6):c.58dup (p.Ala20fs) rs1553408136
NM_000179.2(MSH6):c.592G>A (p.Glu198Lys) rs1553411490
NM_000179.2(MSH6):c.596C>T (p.Pro199Leu) rs587782315
NM_000179.2(MSH6):c.599C>G (p.Ser200Ter) rs63751077
NM_000179.2(MSH6):c.59C>T (p.Ala20Val) rs63750664
NM_000179.2(MSH6):c.603G>A (p.Glu201=) rs587779314
NM_000179.2(MSH6):c.605C>G (p.Pro202Arg) rs367644746
NM_000179.2(MSH6):c.609A>G (p.Glu203=) rs536686679
NM_000179.2(MSH6):c.60C>T (p.Ala20=) rs878853749
NM_000179.2(MSH6):c.615A>G (p.Glu205=) rs1334827373
NM_000179.2(MSH6):c.618A>G (p.Glu206=) rs758635514
NM_000179.2(MSH6):c.61A>G (p.Asn21Asp) rs1223476490
NM_000179.2(MSH6):c.621G>T (p.Glu207Asp) rs1553411509
NM_000179.2(MSH6):c.622A>G (p.Met208Val) rs369058374
NM_000179.2(MSH6):c.624G>A (p.Met208Ile) rs1060502878
NM_000179.2(MSH6):c.627+10G>A rs1346594345
NM_000179.2(MSH6):c.627+1G>A
NM_000179.2(MSH6):c.627+7C>T rs1553411516
NM_000179.2(MSH6):c.627+8A>C rs1060504754
NM_000179.2(MSH6):c.627+9C>T rs373155872
NM_000179.2(MSH6):c.628-10T>C rs779603037
NM_000179.2(MSH6):c.628-2A>G rs1114167725
NM_000179.2(MSH6):c.628-3C>T
NM_000179.2(MSH6):c.628-7C>A rs373129248
NM_000179.2(MSH6):c.628-7C>T rs373129248
NM_000179.2(MSH6):c.628-8C>G rs767991179
NM_000179.2(MSH6):c.628-8C>T rs767991179
NM_000179.2(MSH6):c.628-9G>T rs748816043
NM_000179.2(MSH6):c.629T>C (p.Val210Ala) rs201431515
NM_000179.2(MSH6):c.631G>A (p.Gly211Ser) rs786204153
NM_000179.2(MSH6):c.637A>C (p.Thr213Pro) rs876659071
NM_000179.2(MSH6):c.639_647del (p.Tyr214_Thr216del) rs1553412048
NM_000179.2(MSH6):c.63C>G (p.Asn21Lys) rs876660097
NM_000179.2(MSH6):c.642C>G (p.Tyr214Ter) rs1800937
NM_000179.2(MSH6):c.643G>A (p.Val215Ile) rs145959653
NM_000179.2(MSH6):c.643G>T (p.Val215Leu) rs145959653
NM_000179.2(MSH6):c.644dup (p.Thr216fs)
NM_000179.2(MSH6):c.647C>T (p.Thr216Ile) rs765195534
NM_000179.2(MSH6):c.648_649delinsTT (p.Asp217Tyr) rs63750471
NM_000179.2(MSH6):c.64A>G (p.Lys22Glu) rs1060502897
NM_000179.2(MSH6):c.650A>G (p.Asp217Gly) rs554012110
NM_000179.2(MSH6):c.651dup (p.Lys218Ter) rs63750955
NM_000179.2(MSH6):c.659A>C (p.Glu220Ala) rs764478569
NM_000179.2(MSH6):c.659A>G (p.Glu220Gly) rs764478569
NM_000179.2(MSH6):c.660A>C (p.Glu220Asp) rs1800938
NM_000179.2(MSH6):c.661_672del (p.Glu221_Glu224del) rs1553412079
NM_000179.2(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000179.2(MSH6):c.665A>T (p.Asp222Val)
NM_000179.2(MSH6):c.666T>A (p.Asp222Glu)
NM_000179.2(MSH6):c.667A>G (p.Asn223Asp) rs374041375
NM_000179.2(MSH6):c.668A>G (p.Asn223Ser) rs587779316
NM_000179.2(MSH6):c.670G>A (p.Glu224Lys) rs1060502933
NM_000179.2(MSH6):c.674T>G (p.Ile225Ser)
NM_000179.2(MSH6):c.677A>G (p.Glu226Gly) rs587781777
NM_000179.2(MSH6):c.67G>A (p.Ala23Thr) rs730881810
NM_000179.2(MSH6):c.67G>C (p.Ala23Pro) rs730881810
NM_000179.2(MSH6):c.680G>A (p.Ser227Asn) rs587779317
NM_000179.2(MSH6):c.680G>T (p.Ser227Ile) rs587779317
NM_000179.2(MSH6):c.682G>A (p.Glu228Lys) rs587779947
NM_000179.2(MSH6):c.686A>G (p.Glu229Gly) rs587782591
NM_000179.2(MSH6):c.68C>G (p.Ala23Gly) rs1060502912
NM_000179.2(MSH6):c.68C>T (p.Ala23Val)
NM_000179.2(MSH6):c.694_700del (p.Gln232fs)
NM_000179.2(MSH6):c.697_698del (p.Gln232_Pro233insTer)
NM_000179.2(MSH6):c.698C>G (p.Pro233Arg) rs142949377
NM_000179.2(MSH6):c.698_713del (p.Pro233fs) rs1558658971
NM_000179.2(MSH6):c.69C>G (p.Ala23=) rs1057522077
NM_000179.2(MSH6):c.6G>A (p.Ser2=) rs1437951642
NM_000179.2(MSH6):c.6_7delinsCT (p.Arg3Ter) rs1558644683
NM_000179.2(MSH6):c.703_709del (p.Thr235fs) rs1558658980
NM_000179.2(MSH6):c.704_705CA[1] (p.Gln236fs) rs1553412129
NM_000179.2(MSH6):c.708A>T (p.Gln236His) rs1322117538
NM_000179.2(MSH6):c.709G>A (p.Gly237Arg) rs1424907900
NM_000179.2(MSH6):c.713C>A (p.Ser238Tyr) rs587782510
NM_000179.2(MSH6):c.713C>G (p.Ser238Cys) rs587782510
NM_000179.2(MSH6):c.718C>G (p.Arg240Gly)
NM_000179.2(MSH6):c.718C>T (p.Arg240Ter) rs63750019
NM_000179.2(MSH6):c.719G>A (p.Arg240Gln) rs542848931
NM_000179.2(MSH6):c.71C>T (p.Ser24Leu) rs786201684
NM_000179.2(MSH6):c.722G>A (p.Ser241Asn) rs1060502906
NM_000179.2(MSH6):c.723dup (p.Ser242Ter) rs1558659056
NM_000179.2(MSH6):c.725G>C (p.Ser242Thr) rs1060502925
NM_000179.2(MSH6):c.726C>A (p.Ser242Arg) rs1553412151
NM_000179.2(MSH6):c.727C>T (p.Arg243Cys) rs377216828
NM_000179.2(MSH6):c.728G>A (p.Arg243His) rs370157832
NM_000179.2(MSH6):c.733A>G (p.Ile245Val) rs762168786
NM_000179.2(MSH6):c.733A>T (p.Ile245Leu) rs762168786
NM_000179.2(MSH6):c.73G>T (p.Ala25Ser) rs267608026
NM_000179.2(MSH6):c.741del (p.Lys247fs) rs267608041
NM_000179.2(MSH6):c.741dup (p.Arg248fs) rs267608041
NM_000179.2(MSH6):c.742C>G (p.Arg248Gly) rs63749980
NM_000179.2(MSH6):c.742C>T (p.Arg248Ter) rs63749980
NM_000179.2(MSH6):c.742del (p.Arg248fs) rs587781691
NM_000179.2(MSH6):c.743G>A (p.Arg248Gln) rs764870249
NM_000179.2(MSH6):c.743G>C (p.Arg248Pro) rs764870249
NM_000179.2(MSH6):c.743G>T (p.Arg248Leu) rs764870249
NM_000179.2(MSH6):c.744_746del (p.Arg249del) rs1553412174
NM_000179.2(MSH6):c.746G>C (p.Arg249Thr) rs752135996
NM_000179.2(MSH6):c.747G>A (p.Arg249=) rs63750372
NM_000179.2(MSH6):c.749T>C (p.Val250Ala) rs587781275
NM_000179.2(MSH6):c.751A>G (p.Ile251Val) rs554884560
NM_000179.2(MSH6):c.751A>T (p.Ile251Leu) rs554884560
NM_000179.2(MSH6):c.753A>G (p.Ile251Met) rs587779321
NM_000179.2(MSH6):c.754T>G (p.Ser252Ala) rs746623981
NM_000179.2(MSH6):c.759T>C (p.Asp253=) rs757143365
NM_000179.2(MSH6):c.762T>C (p.Ser254=) rs1553412191
NM_000179.2(MSH6):c.767G>A (p.Ser256Asn) rs1553412194
NM_000179.2(MSH6):c.76A>G (p.Arg26Gly) rs757622849
NM_000179.2(MSH6):c.773T>C (p.Ile258Thr) rs1553412195
NM_000179.2(MSH6):c.780C>T (p.Gly260=) rs1553412204
NM_000179.2(MSH6):c.782C>T (p.Ser261Phe) rs876661250
NM_000179.2(MSH6):c.784G>A (p.Asp262Asn)
NM_000179.2(MSH6):c.785A>G (p.Asp262Gly)
NM_000179.2(MSH6):c.78G>A (p.Arg26=) rs1395190094
NM_000179.2(MSH6):c.798G>A (p.Lys266=) rs1553412208
NM_000179.2(MSH6):c.79del (p.Ala27fs) rs1553408158
NM_000179.2(MSH6):c.7C>G (p.Arg3Gly) rs1553408074
NM_000179.2(MSH6):c.802G>C (p.Asp268His) rs1553412217
NM_000179.2(MSH6):c.806C>G (p.Thr269Ser) rs587779322
NM_000179.2(MSH6):c.806C>T (p.Thr269Ile) rs587779322
NM_000179.2(MSH6):c.807T>C (p.Thr269=) rs1057522991
NM_000179.2(MSH6):c.809A>G (p.Lys270Arg)
NM_000179.2(MSH6):c.809A>T (p.Lys270Met)
NM_000179.2(MSH6):c.809del (p.Lys270fs) rs1114167696
NM_000179.2(MSH6):c.816A>C (p.Glu272Asp) rs863224631
NM_000179.2(MSH6):c.816A>G (p.Glu272=) rs863224631
NM_000179.2(MSH6):c.817G>A (p.Gly273Arg) rs587779948
NM_000179.2(MSH6):c.818G>A (p.Gly273Glu) rs769610487
NM_000179.2(MSH6):c.818G>C (p.Gly273Ala)
NM_000179.2(MSH6):c.818G>T (p.Gly273Val) rs769610487
NM_000179.2(MSH6):c.81C>G (p.Ala27=) rs781496151
NM_000179.2(MSH6):c.820A>G (p.Ser274Gly)
NM_000179.2(MSH6):c.821G>A (p.Ser274Asn) rs587779949
NM_000179.2(MSH6):c.82T>C (p.Ser28Pro)
NM_000179.2(MSH6):c.831A>C (p.Glu277Asp) rs374486449
NM_000179.2(MSH6):c.834A>C (p.Ile278=) rs368523339
NM_000179.2(MSH6):c.837C>A (p.Ser279Arg) rs1558659436
NM_000179.2(MSH6):c.83C>T (p.Ser28Leu) rs750949635
NM_000179.2(MSH6):c.842G>A (p.Gly281Glu) rs773445382
NM_000179.2(MSH6):c.842G>C (p.Gly281Ala) rs773445382
NM_000179.2(MSH6):c.842G>T (p.Gly281Val) rs773445382
NM_000179.2(MSH6):c.845dup (p.Asp284fs) rs1553412283
NM_000179.2(MSH6):c.846G>C (p.Val282=) rs573638836
NM_000179.2(MSH6):c.84A>T (p.Ser28=) rs1060504748
NM_000179.2(MSH6):c.84_85del (p.Glu30fs) rs1558644886
NM_000179.2(MSH6):c.850G>C (p.Asp284His) rs1553412286
NM_000179.2(MSH6):c.850_851insC (p.Asp284fs)
NM_000179.2(MSH6):c.852T>C (p.Asp284=) rs1057520320
NM_000179.2(MSH6):c.854G>T (p.Ser285Ile) rs63750878
NM_000179.2(MSH6):c.856G>C (p.Glu286Gln)
NM_000179.2(MSH6):c.85C>G (p.Arg29Gly) rs756589186
NM_000179.2(MSH6):c.85C>T (p.Arg29Cys) rs756589186
NM_000179.2(MSH6):c.860G>C (p.Ser287Thr) rs876660299
NM_000179.2(MSH6):c.866G>T (p.Gly289Val) rs368318845
NM_000179.2(MSH6):c.866_867delinsAA (p.Gly289Glu) rs267608079
NM_000179.2(MSH6):c.867C>T (p.Gly289=) rs267608047
NM_000179.2(MSH6):c.869T>C (p.Leu290Pro) rs751309721
NM_000179.2(MSH6):c.869T>G (p.Leu290Arg)
NM_000179.2(MSH6):c.873C>T (p.Asn291=) rs876660529
NM_000179.2(MSH6):c.873_874del (p.Asn291fs) rs1060502888
NM_000179.2(MSH6):c.877C>T (p.Pro293Ser) rs756935130
NM_000179.2(MSH6):c.878C>T (p.Pro293Leu) rs1553412308
NM_000179.2(MSH6):c.878_883delinsTTCG (p.Pro293fs) rs1114167748
NM_000179.2(MSH6):c.87C>G (p.Arg29=) rs778354962
NM_000179.2(MSH6):c.880G>A (p.Val294Ile) rs1553412313
NM_000179.2(MSH6):c.881T>A (p.Val294Asp) rs1482153450
NM_000179.2(MSH6):c.881T>G (p.Val294Gly) rs1482153450
NM_000179.2(MSH6):c.883A>G (p.Lys295Glu) rs373958499
NM_000179.2(MSH6):c.884A>G (p.Lys295Arg) rs267608051
NM_000179.2(MSH6):c.884A>T (p.Lys295Ile) rs267608051
NM_000179.2(MSH6):c.885dup (p.Val296fs)
NM_000179.2(MSH6):c.887T>G (p.Val296Gly)
NM_000179.2(MSH6):c.88G>A (p.Glu30Lys) rs1445690889
NM_000179.2(MSH6):c.88G>C (p.Glu30Gln) rs1445690889
NM_000179.2(MSH6):c.890C>T (p.Ala297Val) rs1324211895
NM_000179.2(MSH6):c.892C>T (p.Arg298Ter) rs146816935
NM_000179.2(MSH6):c.893G>A (p.Arg298Gln) rs765237563
NM_000179.2(MSH6):c.896del (p.Lys299fs) rs1060502941
NM_000179.2(MSH6):c.897G>T (p.Lys299Asn) rs755878786
NM_000179.2(MSH6):c.898C>T (p.Arg300Trp) rs779858670
NM_000179.2(MSH6):c.899G>A (p.Arg300Gln) rs55760494
NM_000179.2(MSH6):c.899G>T (p.Arg300Leu) rs55760494
NM_000179.2(MSH6):c.900dup (p.Lys301fs) rs863225421
NM_000179.2(MSH6):c.902A>C (p.Lys301Thr)
NM_000179.2(MSH6):c.905G>A (p.Arg302Lys) rs587781510
NM_000179.2(MSH6):c.905G>C (p.Arg302Thr) rs587781510
NM_000179.2(MSH6):c.905G>T (p.Arg302Ile) rs587781510
NM_000179.2(MSH6):c.906_907del (p.Arg302fs) rs1558659699
NM_000179.2(MSH6):c.907A>T (p.Met303Leu)
NM_000179.2(MSH6):c.908T>C (p.Met303Thr) rs1558659703
NM_000179.2(MSH6):c.908dup (p.Met303fs) rs1057517551
NM_000179.2(MSH6):c.909G>A (p.Met303Ile)
NM_000179.2(MSH6):c.90A>G (p.Glu30=) rs1060504760
NM_000179.2(MSH6):c.910G>A (p.Val304Met) rs876661207
NM_000179.2(MSH6):c.911T>A (p.Val304Glu)
NM_000179.2(MSH6):c.913A>T (p.Thr305Ser)
NM_000179.2(MSH6):c.921T>C (p.Asn307=) rs876659492
NM_000179.2(MSH6):c.922G>A (p.Gly308Ser)
NM_000179.2(MSH6):c.923G>A (p.Gly308Asp) rs1553412354
NM_000179.2(MSH6):c.926C>G (p.Ser309Cys) rs544222338
NM_000179.2(MSH6):c.926C>T (p.Ser309Phe) rs544222338
NM_000179.2(MSH6):c.927T>C (p.Ser309=) rs771288794
NM_000179.2(MSH6):c.928C>G (p.Leu310Val) rs1060502900
NM_000179.2(MSH6):c.930T>G (p.Leu310=) rs1456412042
NM_000179.2(MSH6):c.936_941del (p.Arg312_Lys313del) rs1553412361
NM_000179.2(MSH6):c.938A>G (p.Lys313Arg) rs753373644
NM_000179.2(MSH6):c.93C>T (p.Gly31=) rs370817805
NM_000179.2(MSH6):c.942C>A (p.Ser314Arg)
NM_000179.2(MSH6):c.942C>G (p.Ser314Arg) rs150440246
NM_000179.2(MSH6):c.944C>G (p.Ser315Cys) rs63750491
NM_000179.2(MSH6):c.945T>G (p.Ser315=) rs761581941
NM_000179.2(MSH6):c.947G>A (p.Arg316Lys) rs562487553
NM_000179.2(MSH6):c.94G>T (p.Gly32Cys) rs776859837
NM_000179.2(MSH6):c.952G>C (p.Glu318Gln)
NM_000179.2(MSH6):c.956C>T (p.Thr319Met) rs188252826
NM_000179.2(MSH6):c.957G>A (p.Thr319=) rs375210430
NM_000179.2(MSH6):c.957G>C (p.Thr319=) rs375210430
NM_000179.2(MSH6):c.958C>T (p.Pro320Ser) rs754879198
NM_000179.2(MSH6):c.959C>T (p.Pro320Leu) rs779022657
NM_000179.2(MSH6):c.95G>T (p.Gly32Val) rs771426932
NM_000179.2(MSH6):c.965C>A (p.Ala322Asp)
NM_000179.2(MSH6):c.965C>T (p.Ala322Val) rs1253844411
NM_000179.2(MSH6):c.968C>G (p.Thr323Ser) rs777890307
NM_000179.2(MSH6):c.968C>T (p.Thr323Ile) rs777890307
NM_000179.2(MSH6):c.96C>T (p.Gly32=) rs553046896
NM_000179.2(MSH6):c.970A>C (p.Lys324Gln) rs1413266657
NM_000179.2(MSH6):c.972A>C (p.Lys324Asn) rs876658610
NM_000179.2(MSH6):c.973C>T (p.Gln325Ter) rs1553412397
NM_000179.2(MSH6):c.975A>G (p.Gln325=) rs193922345
NM_000179.2(MSH6):c.979A>C (p.Thr327Pro) rs730881814
NM_000179.2(MSH6):c.979A>G (p.Thr327Ala) rs730881814
NM_000179.2(MSH6):c.97C>A (p.Arg33Ser) rs730881811
NM_000179.2(MSH6):c.980C>G (p.Thr327Ser) rs369568820
NM_000179.2(MSH6):c.983G>C (p.Ser328Thr) rs1060502879
NM_000179.2(MSH6):c.984C>G (p.Ser328Arg) rs138143769
NM_000179.2(MSH6):c.984C>T (p.Ser328=) rs138143769
NM_000179.2(MSH6):c.988dup (p.Ser330fs) rs1553412409
NM_000179.2(MSH6):c.989C>A (p.Ser330Ter) rs786202848
NM_000179.2(MSH6):c.989C>T (p.Ser330Leu)
NM_000179.2(MSH6):c.98G>C (p.Arg33Pro) rs878853751
NM_000179.2(MSH6):c.98G>T (p.Arg33Leu)
NM_000179.2(MSH6):c.993A>G (p.Ser331=) rs1060504750
NM_000179.2(MSH6):c.997A>G (p.Thr333Ala) rs886056143
NM_000179.2(MSH6):c.998C>G (p.Thr333Ser) rs587781983
NM_000179.2(MSH6):c.998C>T (p.Thr333Ile) rs587781983
NM_000179.2(MSH6):c.999del (p.Lys334fs) rs1060502932
NM_001281492.1(MSH6):c.3611+10dup rs730882138
NM_001281492.1(MSH6):c.3611+4_3611+8dup rs587782853
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.