ClinVar Miner

List of variants in gene MYBPC3 reported by GeneDx

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 669
Download table as spreadsheet
HGVS dbSNP
LRG_386t1:c.3315del
LRG_386t1:c.929insG
NM_000256.3(MYBPC3):c.*26+13C>T rs756818187
NM_000256.3(MYBPC3):c.*26+14G>A rs375011839
NM_000256.3(MYBPC3):c.-5T>C rs886048383
NM_000256.3(MYBPC3):c.1000G>A (p.Glu334Lys) rs573916965
NM_000256.3(MYBPC3):c.1003C>T (p.Arg335Cys) rs730880630
NM_000256.3(MYBPC3):c.1008C>T (p.Ile336=) rs397515880
NM_000256.3(MYBPC3):c.1015C>T (p.Gln339Ter) rs730880631
NM_000256.3(MYBPC3):c.1021G>A (p.Gly341Ser) rs397515881
NM_000256.3(MYBPC3):c.1028delC (p.Thr343Metfs) rs730880686
NM_000256.3(MYBPC3):c.1037G>A (p.Arg346His) rs397515883
NM_000256.3(MYBPC3):c.1038_1042dupCGGCA (p.Met348Thrfs) rs730880336
NM_000256.3(MYBPC3):c.1040G>A (p.Gly347Asp) rs1555122753
NM_000256.3(MYBPC3):c.104G>A (p.Arg35Gln) rs397515885
NM_000256.3(MYBPC3):c.1062C>A (p.Gly354=) rs1555122748
NM_000256.3(MYBPC3):c.1069_1072delCGCGinsGC (p.Arg357Alafs) rs730880687
NM_000256.3(MYBPC3):c.1070G>A (p.Arg357His) rs199741162
NM_000256.3(MYBPC3):c.1080G>C (p.Lys360Asn) rs730880632
NM_000256.3(MYBPC3):c.1084A>G (p.Ser362Gly) rs730880633
NM_000256.3(MYBPC3):c.1084dupA (p.Ser362Lysfs) rs730880723
NM_000256.3(MYBPC3):c.1090+1G>A rs727504269
NM_000256.3(MYBPC3):c.1090+1G>T rs727504269
NM_000256.3(MYBPC3):c.1090+2T>G rs730880634
NM_000256.3(MYBPC3):c.1091C>T (p.Ala364Val) rs778161908
NM_000256.3(MYBPC3):c.110G>A (p.Gly37Glu) rs1085307653
NM_000256.3(MYBPC3):c.1112C>T (p.Pro371Leu) rs397515887
NM_000256.3(MYBPC3):c.1120C>T (p.Gln374Ter) rs730880635
NM_000256.3(MYBPC3):c.1120dupC (p.Gln374Profs) rs730880688
NM_000256.3(MYBPC3):c.1144C>T (p.Arg382Trp) rs11570076
NM_000256.3(MYBPC3):c.1147C>G (p.Leu383Val) rs11570077
NM_000256.3(MYBPC3):c.1149G>T (p.Leu383=) rs1407534196
NM_000256.3(MYBPC3):c.1156_1171dup (p.Asp391Glyfs) rs730880689
NM_000256.3(MYBPC3):c.1162dupG (p.Ala388Glyfs) rs730880724
NM_000256.3(MYBPC3):c.1168delC (p.His390Metfs) rs397515889
NM_000256.3(MYBPC3):c.1182C>A (p.Val394=) rs730880636
NM_000256.3(MYBPC3):c.1188G>A (p.Trp396Ter) rs397515890
NM_000256.3(MYBPC3):c.1201C>T (p.Gln401Ter) rs730880637
NM_000256.3(MYBPC3):c.1210C>T (p.Gln404Ter) rs727504329
NM_000256.3(MYBPC3):c.1222A>C (p.Ser408Arg) rs730880638
NM_000256.3(MYBPC3):c.1223+14T>G rs587781045
NM_000256.3(MYBPC3):c.1223+1G>A rs730880639
NM_000256.3(MYBPC3):c.1223+2T>G rs730880641
NM_000256.3(MYBPC3):c.1224-19G>A rs587776699
NM_000256.3(MYBPC3):c.1224-2A>G rs397515891
NM_000256.3(MYBPC3):c.1224-3C>T rs1555122359
NM_000256.3(MYBPC3):c.1227-10C>T rs374673836
NM_000256.3(MYBPC3):c.1227-2A>G rs730880531
NM_000256.3(MYBPC3):c.1227-4C>G rs113628269
NM_000256.3(MYBPC3):c.1235_1236delTT (p.Phe412Terfs) rs397515894
NM_000256.3(MYBPC3):c.1238A>G (p.Glu413Gly) rs730880532
NM_000256.3(MYBPC3):c.1246G>A (p.Gly416Ser) rs371513491
NM_000256.3(MYBPC3):c.1252A>T (p.Lys418Ter) rs730880533
NM_000256.3(MYBPC3):c.1255C>T (p.Arg419Cys) rs368770848
NM_000256.3(MYBPC3):c.1256G>A (p.Arg419His) rs770030288
NM_000256.3(MYBPC3):c.1286C>A (p.Ala429Glu) rs370412052
NM_000256.3(MYBPC3):c.1286C>T (p.Ala429Val) rs370412052
NM_000256.3(MYBPC3):c.1288G>A (p.Asp430Asn) rs730880534
NM_000256.3(MYBPC3):c.1291G>A (p.Asp431Asn) rs753321277
NM_000256.3(MYBPC3):c.12G>A (p.Pro4=) rs377292092
NM_000256.3(MYBPC3):c.1303C>T (p.Gln435Ter) rs1432810664
NM_000256.3(MYBPC3):c.1309G>A (p.Val437Met) rs730880535
NM_000256.3(MYBPC3):c.131G>A (p.Arg44His) rs369205562
NM_000256.3(MYBPC3):c.1321G>A (p.Glu441Lys) rs193922377
NM_000256.3(MYBPC3):c.1351+1G>C rs727503204
NM_000256.3(MYBPC3):c.1351+2T>C rs397515897
NM_000256.3(MYBPC3):c.1352-10G>T rs745645848
NM_000256.3(MYBPC3):c.1355C>A (p.Pro452His) rs730880536
NM_000256.3(MYBPC3):c.1357_1358delCC (p.Pro453Cysfs) rs727503203
NM_000256.3(MYBPC3):c.1358dupC (p.Val454Cysfs) rs727503203
NM_000256.3(MYBPC3):c.1372C>T (p.Arg458Cys) rs377577698
NM_000256.3(MYBPC3):c.1374C>T (p.Arg458=) rs1057521555
NM_000256.3(MYBPC3):c.1377delC (p.Leu460Trpfs) rs786204339
NM_000256.3(MYBPC3):c.1387C>T (p.Gln463Ter) rs730880538
NM_000256.3(MYBPC3):c.1397T>A (p.Met466Lys) rs397515899
NM_000256.3(MYBPC3):c.13G>C (p.Gly5Arg) rs201278114
NM_000256.3(MYBPC3):c.1404delG (p.Gln469Serfs) rs886037900
NM_000256.3(MYBPC3):c.1405C>T (p.Gln469Ter) rs730880539
NM_000256.3(MYBPC3):c.1410_1411delGG (p.Val471Glyfs) rs730880642
NM_000256.3(MYBPC3):c.1418T>C (p.Phe473Ser) rs397515900
NM_000256.3(MYBPC3):c.1422G>A (p.Glu474=) rs397515901
NM_000256.3(MYBPC3):c.1431A>G (p.Val477=) rs587781042
NM_000256.3(MYBPC3):c.1433C>T (p.Ser478Leu) rs730880540
NM_000256.3(MYBPC3):c.1434G>A (p.Ser478=) rs770568659
NM_000256.3(MYBPC3):c.1445C>T (p.Ala482Val) rs370285346
NM_000256.3(MYBPC3):c.1457+20G>T rs377491959
NM_000256.3(MYBPC3):c.1457+5G>A rs727503202
NM_000256.3(MYBPC3):c.1457G>A (p.Trp486Ter) rs730880542
NM_000256.3(MYBPC3):c.1458-1G>A rs397515903
NM_000256.3(MYBPC3):c.1458-5G>A rs746542705
NM_000256.3(MYBPC3):c.1458-6G>A rs375347534
NM_000256.3(MYBPC3):c.1458G>A (p.Trp486Ter) rs1057517920
NM_000256.3(MYBPC3):c.1467C>T (p.Asp489=) rs35690719
NM_000256.3(MYBPC3):c.1468G>A (p.Gly490Arg) rs200625851
NM_000256.3(MYBPC3):c.146_148delTCA (p.Ile49del) rs781207661
NM_000256.3(MYBPC3):c.1471G>A (p.Val491Met) rs730880543
NM_000256.3(MYBPC3):c.147C>T (p.Ile49=) rs774273586
NM_000256.3(MYBPC3):c.1483C>G (p.Arg495Gly) rs397515905
NM_000256.3(MYBPC3):c.1484G>A (p.Arg495Gln) rs200411226
NM_000256.3(MYBPC3):c.1486G>C (p.Glu496Gln) rs1057517768
NM_000256.3(MYBPC3):c.148A>G (p.Ser50Gly) rs373164247
NM_000256.3(MYBPC3):c.1504C>T (p.Arg502Trp) rs375882485
NM_000256.3(MYBPC3):c.1504delC (p.Arg502Glyfs) rs1555122188
NM_000256.3(MYBPC3):c.1505G>A (p.Arg502Gln) rs397515907
NM_000256.3(MYBPC3):c.1519G>A (p.Gly507Arg) rs35736435
NM_000256.3(MYBPC3):c.151G>A (p.Ala51Thr) rs534282225
NM_000256.3(MYBPC3):c.151G>T (p.Ala51Ser) rs534282225
NM_000256.3(MYBPC3):c.1521delG (p.Gln508Argfs) rs1555122177
NM_000256.3(MYBPC3):c.1522C>T (p.Gln508Ter) rs730880544
NM_000256.3(MYBPC3):c.1543_1545delAAC (p.Asn515del) rs730880643
NM_000256.3(MYBPC3):c.1544A>G (p.Asn515Ser) rs181834806
NM_000256.3(MYBPC3):c.1546G>A (p.Glu516Lys) rs730880545
NM_000256.3(MYBPC3):c.1563C>T (p.Asp521=) rs367915627
NM_000256.3(MYBPC3):c.1564G>A (p.Ala522Thr) rs11570082
NM_000256.3(MYBPC3):c.1565C>T (p.Ala522Val) rs370362589
NM_000256.3(MYBPC3):c.1573T>C (p.Tyr525His) rs1555122164
NM_000256.3(MYBPC3):c.1577_1580dupCACT (p.Cys528Thrfs) rs730880712
NM_000256.3(MYBPC3):c.1591G>A (p.Gly531Arg) rs397515912
NM_000256.3(MYBPC3):c.1591G>C (p.Gly531Arg) rs397515912
NM_000256.3(MYBPC3):c.1593G>A (p.Gly531=) rs727503199
NM_000256.3(MYBPC3):c.1595G>T (p.Gly532Val) rs730880547
NM_000256.3(MYBPC3):c.1595delG (p.Gly532Alafs) rs730880640
NM_000256.3(MYBPC3):c.1602G>A (p.Ala534=) rs370945942
NM_000256.3(MYBPC3):c.1604T>C (p.Leu535Pro) rs730880548
NM_000256.3(MYBPC3):c.1621C>T (p.Gln541Ter) rs1064794209
NM_000256.3(MYBPC3):c.1624+13G>A rs397515913
NM_000256.3(MYBPC3):c.1624+13G>C rs397515913
NM_000256.3(MYBPC3):c.1624+14_1624+15insA rs369096037
NM_000256.3(MYBPC3):c.1624+18G>C rs767468093
NM_000256.3(MYBPC3):c.1624+19delG rs750990030
NM_000256.3(MYBPC3):c.1624+2T>C rs111437311
NM_000256.3(MYBPC3):c.1624+3G>C rs730880690
NM_000256.3(MYBPC3):c.1624+4A>T rs397515916
NM_000256.3(MYBPC3):c.1624+5G>A rs730880691
NM_000256.3(MYBPC3):c.1624G>C (p.Glu542Gln) rs121909374
NM_000256.3(MYBPC3):c.1624G>T (p.Glu542Ter) rs121909374
NM_000256.3(MYBPC3):c.1633C>A (p.Leu545Met) rs377163678
NM_000256.3(MYBPC3):c.1641_1642delGT (p.Tyr548Profs) rs398123279
NM_000256.3(MYBPC3):c.1644C>G (p.Tyr548Ter)
NM_000256.3(MYBPC3):c.1654G>T (p.Ala552Ser) rs727504887
NM_000256.3(MYBPC3):c.165C>A (p.Tyr55Ter) rs780012957
NM_000256.3(MYBPC3):c.1664T>C (p.Met555Thr) rs730880692
NM_000256.3(MYBPC3):c.1669G>A (p.Gly557Ser) rs730880693
NM_000256.3(MYBPC3):c.1670G>A (p.Gly557Asp) rs730880549
NM_000256.3(MYBPC3):c.1685C>A (p.Ala562Glu) rs730880694
NM_000256.3(MYBPC3):c.1696T>C (p.Cys566Arg) rs730880695
NM_000256.3(MYBPC3):c.1700_1701delAG (p.Glu567Glyfs) rs727503197
NM_000256.3(MYBPC3):c.1720C>A (p.Arg574=) rs61897383
NM_000256.3(MYBPC3):c.1720C>T (p.Arg574Trp) rs61897383
NM_000256.3(MYBPC3):c.1721G>A (p.Arg574Gln) rs397515922
NM_000256.3(MYBPC3):c.172delG (p.Ala58Profs) rs730880662
NM_000256.3(MYBPC3):c.1731G>A (p.Trp577Ter) rs730880546
NM_000256.3(MYBPC3):c.1734delG (p.Lys579Argfs) rs730880646
NM_000256.3(MYBPC3):c.1759G>A (p.Asp587Asn) rs730880526
NM_000256.3(MYBPC3):c.1766G>A (p.Arg589His) rs397515923
NM_000256.3(MYBPC3):c.1776_1777delGT (p.Ser593Profs) rs730880713
NM_000256.3(MYBPC3):c.1778C>T (p.Ser593Phe) rs397515924
NM_000256.3(MYBPC3):c.177_187delAGAGGGCACAC (p.Glu60Alafs) rs397515925
NM_000256.3(MYBPC3):c.1783A>G (p.Ile595Val) rs730880550
NM_000256.3(MYBPC3):c.1786G>A (p.Gly596Arg) rs199728019
NM_000256.3(MYBPC3):c.1789C>T (p.Arg597Trp) rs201596087
NM_000256.3(MYBPC3):c.1790G>A (p.Arg597Gln) rs727503195
NM_000256.3(MYBPC3):c.1791-2A>C rs112179534
NM_000256.3(MYBPC3):c.1791-8C>T rs1346693579
NM_000256.3(MYBPC3):c.1792delG (p.Val598Serfs) rs730880647
NM_000256.3(MYBPC3):c.1800delA (p.Lys600Asnfs) rs397515926
NM_000256.3(MYBPC3):c.1805C>T (p.Thr602Ile) rs730880551
NM_000256.3(MYBPC3):c.1806delC (p.Ile603Leufs) rs730880648
NM_000256.3(MYBPC3):c.1809delT (p.Ile603Metfs) rs1064794471
NM_000256.3(MYBPC3):c.1812C>T (p.Asp604=) rs397515929
NM_000256.3(MYBPC3):c.1812_1813dup (p.Asp605Alafs) rs764743402
NM_000256.3(MYBPC3):c.1814A>G (p.Asp605Gly) rs372371774
NM_000256.3(MYBPC3):c.1816G>A (p.Val606Ile) rs368482358
NM_000256.3(MYBPC3):c.1822C>T (p.Pro608Ser) rs730880552
NM_000256.3(MYBPC3):c.1823_1830delCTGCCGACinsA (p.Pro608Glnfs) rs1555121924
NM_000256.3(MYBPC3):c.1826C>T (p.Ala609Val) rs730880553
NM_000256.3(MYBPC3):c.1828G>C (p.Asp610His) rs371564200
NM_000256.3(MYBPC3):c.1829A>T (p.Asp610Val) rs730880554
NM_000256.3(MYBPC3):c.182delG (p.Gly61Alafs) rs730880663
NM_000256.3(MYBPC3):c.1838dupA (p.Asp613Glufs) rs730880649
NM_000256.3(MYBPC3):c.1841A>G (p.Tyr614Cys) rs727503194
NM_000256.3(MYBPC3):c.184A>C (p.Thr62Pro) rs377225516
NM_000256.3(MYBPC3):c.1855G>A (p.Glu619Lys) rs200352299
NM_000256.3(MYBPC3):c.1859G>T (p.Gly620Val) rs730880556
NM_000256.3(MYBPC3):c.1869C>T (p.Cys623=) rs397515932
NM_000256.3(MYBPC3):c.187C>T (p.Arg63Trp) rs373315466
NM_000256.3(MYBPC3):c.1881C>A (p.Ala627=) rs1555121890
NM_000256.3(MYBPC3):c.1892delT (p.Phe631Serfs) rs397515933
NM_000256.3(MYBPC3):c.1895delT (p.Met632Argfs) rs397515934
NM_000256.3(MYBPC3):c.1897+1G>A rs397515935
NM_000256.3(MYBPC3):c.1897+4A>C rs730880557
NM_000256.3(MYBPC3):c.1898-1G>A rs730880558
NM_000256.3(MYBPC3):c.1927+16C>G rs1057521019
NM_000256.3(MYBPC3):c.1927+3A>C rs730880559
NM_000256.3(MYBPC3):c.1928-19T>A rs1057521020
NM_000256.3(MYBPC3):c.1928-2A>G rs397515937
NM_000256.3(MYBPC3):c.1934C>T (p.Pro645Leu) rs397515938
NM_000256.3(MYBPC3):c.1944C>T (p.His648=) rs750861887
NM_000256.3(MYBPC3):c.1968A>G (p.Pro656=) rs397515940
NM_000256.3(MYBPC3):c.1978G>A (p.Val660Met) rs730880560
NM_000256.3(MYBPC3):c.1989T>A (p.Ala663=) rs375467797
NM_000256.3(MYBPC3):c.1999_2000delCTinsG (p.Leu667Aspfs) rs727503192
NM_000256.3(MYBPC3):c.2003G>A (p.Arg668His) rs727503191
NM_000256.3(MYBPC3):c.2058delT (p.Ile687Serfs) rs1064793642
NM_000256.3(MYBPC3):c.2063C>A (p.Thr688Lys) rs3729946
NM_000256.3(MYBPC3):c.2067+1G>A rs1444727212
NM_000256.3(MYBPC3):c.2074A>C (p.Lys692Gln) rs730880562
NM_000256.3(MYBPC3):c.207G>C (p.Arg69=) rs397515946
NM_000256.3(MYBPC3):c.208G>T (p.Glu70Ter) rs11570045
NM_000256.3(MYBPC3):c.2096delC (p.Pro699Glnfs) rs397515947
NM_000256.3(MYBPC3):c.2148+6_2148+9delTGAG rs397515949
NM_000256.3(MYBPC3):c.2149-3C>T rs113182334
NM_000256.3(MYBPC3):c.2149-8C>G rs397515950
NM_000256.3(MYBPC3):c.2149-9C>G rs773882783
NM_000256.3(MYBPC3):c.2155T>C (p.Cys719Arg) rs1384644997
NM_000256.3(MYBPC3):c.2157_2158delTG (p.Cys719Terfs) rs1064793429
NM_000256.3(MYBPC3):c.2164G>A (p.Glu722Lys) rs730880696
NM_000256.3(MYBPC3):c.216C>A (p.Gly72=) rs760007714
NM_000256.3(MYBPC3):c.2179G>A (p.Val727Met) rs564378953
NM_000256.3(MYBPC3):c.2182G>T (p.Glu728Ter) rs397515954
NM_000256.3(MYBPC3):c.2197C>A (p.Arg733Ser) rs397515956
NM_000256.3(MYBPC3):c.2197C>T (p.Arg733Cys) rs397515956
NM_000256.3(MYBPC3):c.2198G>A (p.Arg733His) rs534345197
NM_000256.3(MYBPC3):c.2210C>T (p.Thr737Met) rs199893357
NM_000256.3(MYBPC3):c.2221delG (p.Ala741Glnfs) rs730880650
NM_000256.3(MYBPC3):c.2242G>A (p.Val748Ile) rs730880563
NM_000256.3(MYBPC3):c.2250G>A (p.Thr750=) rs373338699
NM_000256.3(MYBPC3):c.2267delC (p.Pro756Leufs) rs730880651
NM_000256.3(MYBPC3):c.2269G>A (p.Val757Met) rs369790992
NM_000256.3(MYBPC3):c.2271G>A (p.Val757=) rs766029254
NM_000256.3(MYBPC3):c.2288A>G (p.Asn763Ser) rs730880527
NM_000256.3(MYBPC3):c.2308+13G>A rs780086088
NM_000256.3(MYBPC3):c.2308+1G>A rs112738974
NM_000256.3(MYBPC3):c.2308+1G>T rs112738974
NM_000256.3(MYBPC3):c.2308+8C>T rs373135387
NM_000256.3(MYBPC3):c.2309-2A>G rs111729952
NM_000256.3(MYBPC3):c.2309-9C>A rs730880528
NM_000256.3(MYBPC3):c.230G>A (p.Gly77Glu) rs730880580
NM_000256.3(MYBPC3):c.2310C>T (p.Asp770=) rs397515959
NM_000256.3(MYBPC3):c.2311G>A (p.Val771Met) rs371488302
NM_000256.3(MYBPC3):c.2311dupG (p.Val771Glyfs) rs397515960
NM_000256.3(MYBPC3):c.2320G>A (p.Ala774Thr) rs368104687
NM_000256.3(MYBPC3):c.2324C>G (p.Pro775Arg) rs730880564
NM_000256.3(MYBPC3):c.2330C>T (p.Ala777Val) rs759631792
NM_000256.3(MYBPC3):c.2334delC (p.Lys779Argfs) rs1057518030
NM_000256.3(MYBPC3):c.2346C>T (p.Asn782=) rs768638405
NM_000256.3(MYBPC3):c.2347G>A (p.Val783Met) rs1060499878
NM_000256.3(MYBPC3):c.2347G>T (p.Val783Leu) rs1060499878
NM_000256.3(MYBPC3):c.235T>A (p.Tyr79Asn) rs730880581
NM_000256.3(MYBPC3):c.236dupA (p.Tyr79Terfs) rs1057517939
NM_000256.3(MYBPC3):c.2372_2373insG (p.Trp792Valfs) rs397515963
NM_000256.3(MYBPC3):c.2374T>C (p.Trp792Arg) rs187830361
NM_000256.3(MYBPC3):c.237C>A (p.Tyr79Ter) rs730880698
NM_000256.3(MYBPC3):c.237C>G (p.Tyr79Ter) rs730880698
NM_000256.3(MYBPC3):c.237delC (p.Tyr79Terfs) rs730880664
NM_000256.3(MYBPC3):c.2382delG (p.Pro795Leufs) rs730880714
NM_000256.3(MYBPC3):c.238G>A (p.Ala80Thr) rs730880700
NM_000256.3(MYBPC3):c.2391C>G (p.Tyr797Ter) rs727504864
NM_000256.3(MYBPC3):c.2397C>T (p.Gly799=) rs756512665
NM_000256.3(MYBPC3):c.2409C>A (p.Ile803=) rs202088839
NM_000256.3(MYBPC3):c.240A>G (p.Ala80=) rs770089112
NM_000256.3(MYBPC3):c.2413+18G>C rs768281173
NM_000256.3(MYBPC3):c.2414-2_2414-1delAGinsTCCA rs1555121260
NM_000256.3(MYBPC3):c.2414G>A (p.Gly805Asp) rs730880566
NM_000256.3(MYBPC3):c.2429G>A (p.Arg810His) rs375675796
NM_000256.3(MYBPC3):c.2429G>T (p.Arg810Leu) rs375675796
NM_000256.3(MYBPC3):c.2441_2443delAGA (p.Lys814del) rs727504288
NM_000256.3(MYBPC3):c.2449C>T (p.Arg817Trp) rs727503188
NM_000256.3(MYBPC3):c.2450G>A (p.Arg817Gln) rs397515964
NM_000256.3(MYBPC3):c.2450G>T (p.Arg817Leu) rs397515964
NM_000256.3(MYBPC3):c.2453G>A (p.Trp818Ter)
NM_000256.3(MYBPC3):c.2454G>A (p.Trp818Ter) rs397515965
NM_000256.3(MYBPC3):c.2455_2459delATGCG (p.Met819Alafs) rs730880652
NM_000256.3(MYBPC3):c.2459G>A (p.Arg820Gln) rs2856655
NM_000256.3(MYBPC3):c.2459G>C (p.Arg820Pro) rs2856655
NM_000256.3(MYBPC3):c.2479C>A (p.Gln827Lys) rs375322174
NM_000256.3(MYBPC3):c.2487G>T (p.Leu829=) rs201040413
NM_000256.3(MYBPC3):c.2490dupT (p.His831Serfs) rs397515966
NM_000256.3(MYBPC3):c.2497G>A (p.Ala833Thr) rs199865688
NM_000256.3(MYBPC3):c.2511delC (p.Ile837Metfs) rs730880653
NM_000256.3(MYBPC3):c.2517C>T (p.Gly839=) rs370561202
NM_000256.3(MYBPC3):c.2518G>A (p.Val840Met) rs376936056
NM_000256.3(MYBPC3):c.2526C>A (p.Tyr842Ter) rs373792537
NM_000256.3(MYBPC3):c.2526C>G (p.Tyr842Ter) rs373792537
NM_000256.3(MYBPC3):c.2527G>A (p.Glu843Lys) rs730880567
NM_000256.3(MYBPC3):c.2532_2538delGCGCGTC (p.Met844Ilefs) rs730880654
NM_000256.3(MYBPC3):c.2534G>A (p.Arg845His) rs730880568
NM_000256.3(MYBPC3):c.2534G>C (p.Arg845Pro) rs730880568
NM_000256.3(MYBPC3):c.2534_2538delGCGTC (p.Arg845Leufs) rs397515973
NM_000256.3(MYBPC3):c.2539T>C (p.Tyr847His) rs768963157
NM_000256.3(MYBPC3):c.2541C>G (p.Tyr847Ter) rs397515974
NM_000256.3(MYBPC3):c.2543C>G (p.Ala848Gly) rs730880569
NM_000256.3(MYBPC3):c.2543delC (p.Ala848Glyfs) rs730880715
NM_000256.3(MYBPC3):c.2544G>A (p.Ala848=) rs369904619
NM_000256.3(MYBPC3):c.2549A>T (p.Asn850Ile) rs730880570
NM_000256.3(MYBPC3):c.2551G>A (p.Ala851Thr) rs730880571
NM_000256.3(MYBPC3):c.2556C>T (p.Ile852=) rs754062873
NM_000256.3(MYBPC3):c.2556_2557delCGinsTCT (p.Gly853Leufs) rs397515975
NM_000256.3(MYBPC3):c.2556delC (p.Ile852Metfs) rs727503186
NM_000256.3(MYBPC3):c.2558delG (p.Gly853Alafs) rs397515977
NM_000256.3(MYBPC3):c.2562G>A (p.Met854Ile) rs730880572
NM_000256.3(MYBPC3):c.2568G>A (p.Arg856=) rs773032022
NM_000256.3(MYBPC3):c.2573G>A (p.Ser858Asn) rs727503185
NM_000256.3(MYBPC3):c.25G>C (p.Val9Leu) rs1064793201
NM_000256.3(MYBPC3):c.26-2A>G rs376395543
NM_000256.3(MYBPC3):c.2602+2T>G rs1555121145
NM_000256.3(MYBPC3):c.2602+9G>A rs960769310
NM_000256.3(MYBPC3):c.2603-11C>T rs11570105
NM_000256.3(MYBPC3):c.2603-1G>C rs977277400
NM_000256.3(MYBPC3):c.2604delT (p.Ser871Alafs) rs730880655
NM_000256.3(MYBPC3):c.2610delC (p.Ser871Alafs) rs397515979
NM_000256.3(MYBPC3):c.2610dupC (p.Ser871Glnfs) rs397515979
NM_000256.3(MYBPC3):c.2613C>T (p.Ser871=) rs531228202
NM_000256.3(MYBPC3):c.2614G>A (p.Glu872Lys) rs190765116
NM_000256.3(MYBPC3):c.2618C>A (p.Pro873His) rs371401403
NM_000256.3(MYBPC3):c.2618C>T (p.Pro873Leu) rs371401403
NM_000256.3(MYBPC3):c.2622C>T (p.Thr874=) rs886048375
NM_000256.3(MYBPC3):c.2632G>A (p.Val878Ile) rs730880574
NM_000256.3(MYBPC3):c.263T>A (p.Val88Asp) rs730880583
NM_000256.3(MYBPC3):c.2640C>T (p.Asp880=) rs397515980
NM_000256.3(MYBPC3):c.2670G>A (p.Trp890Ter) rs397515982
NM_000256.3(MYBPC3):c.2672G>A (p.Arg891Gln) rs727504378
NM_000256.3(MYBPC3):c.2684G>A (p.Arg895His) rs372628478
NM_000256.3(MYBPC3):c.2692G>T (p.Ala898Ser) rs1555120929
NM_000256.3(MYBPC3):c.2700_2703dupCCTG (p.Asp902Profs) rs1555120927
NM_000256.3(MYBPC3):c.2715C>G (p.Ser905Arg) rs759920601
NM_000256.3(MYBPC3):c.2716G>A (p.Val906Met) rs774634021
NM_000256.3(MYBPC3):c.2716delG (p.Val906Trpfs) rs886041320
NM_000256.3(MYBPC3):c.2719G>T (p.Glu907Ter) rs1555120920
NM_000256.3(MYBPC3):c.2728C>A (p.Pro910Thr) rs397515985
NM_000256.3(MYBPC3):c.2733G>A (p.Glu911=) rs1385242275
NM_000256.3(MYBPC3):c.2737delT (p.Cys913Alafs) rs730880658
NM_000256.3(MYBPC3):c.2738-1G>A rs1555120792
NM_000256.3(MYBPC3):c.2739delC (p.Ser914Glnfs) rs730880660
NM_000256.3(MYBPC3):c.2744delA (p.Glu915Glyfs) rs730880661
NM_000256.3(MYBPC3):c.2747G>A (p.Trp916Ter) rs727504349
NM_000256.3(MYBPC3):c.2748G>A (p.Trp916Ter) rs730880576
NM_000256.3(MYBPC3):c.275_276delTC (p.Leu92Glnfs) rs1057517766
NM_000256.3(MYBPC3):c.2761C>G (p.Gln921Glu) rs367729718
NM_000256.3(MYBPC3):c.2771C>T (p.Thr924Ile) rs200406864
NM_000256.3(MYBPC3):c.2780_2781delCA (p.Thr927Ilefs) rs727504265
NM_000256.3(MYBPC3):c.2783C>T (p.Ser928Leu) rs773819168
NM_000256.3(MYBPC3):c.2792dupT (p.Lys932Glufs) rs730880716
NM_000256.3(MYBPC3):c.2807C>T (p.Thr936Met) rs374946555
NM_000256.3(MYBPC3):c.2808G>A (p.Thr936=) rs370530334
NM_000256.3(MYBPC3):c.2827C>T (p.Arg943Ter) rs387907267
NM_000256.3(MYBPC3):c.2833_2834delCG (p.Arg945Glyfs) rs397515987
NM_000256.3(MYBPC3):c.2838A>G (p.Ala946=) rs376858768
NM_000256.3(MYBPC3):c.2849C>T (p.Ala950Val) rs730880577
NM_000256.3(MYBPC3):c.284T>C (p.Ile95Thr) rs727504945
NM_000256.3(MYBPC3):c.2864_2865delCT (p.Pro955Argfs) rs397515990
NM_000256.3(MYBPC3):c.2870C>G (p.Thr957Ser) rs193922380
NM_000256.3(MYBPC3):c.2873C>T (p.Thr958Ile) rs376504548
NM_000256.3(MYBPC3):c.2875_2876delAC (p.Thr959Glyfs) rs727503182
NM_000256.3(MYBPC3):c.2876C>T (p.Thr959Met) rs730880697
NM_000256.3(MYBPC3):c.2882C>T (p.Pro961Leu) rs373056282
NM_000256.3(MYBPC3):c.2893C>T (p.Gln965Ter) rs730880578
NM_000256.3(MYBPC3):c.2894_2905+4del rs730880717
NM_000256.3(MYBPC3):c.2895G>A (p.Gln965=) rs1057524069
NM_000256.3(MYBPC3):c.2897A>T (p.Glu966Val) rs730880579
NM_000256.3(MYBPC3):c.2905+1G>A rs397515991
NM_000256.3(MYBPC3):c.2905+5G>T rs193922381
NM_000256.3(MYBPC3):c.2905+9C>T rs1057520951
NM_000256.3(MYBPC3):c.2905C>T (p.Gln969Ter) rs397515992
NM_000256.3(MYBPC3):c.2906-1G>C rs1409755826
NM_000256.3(MYBPC3):c.2914C>T (p.Arg972Trp) rs193922382
NM_000256.3(MYBPC3):c.2920C>T (p.Gln974Ter) rs727503180
NM_000256.3(MYBPC3):c.2942A>C (p.Gln981Pro) rs730880582
NM_000256.3(MYBPC3):c.2953A>T (p.Lys985Ter) rs727504423
NM_000256.3(MYBPC3):c.2961C>T (p.Val987=) rs761700877
NM_000256.3(MYBPC3):c.2980C>T (p.Leu994Phe) rs375776406
NM_000256.3(MYBPC3):c.2992C>G (p.Gln998Glu) rs11570112
NM_000256.3(MYBPC3):c.2992C>T (p.Gln998Ter) rs11570112
NM_000256.3(MYBPC3):c.2995-1G>A rs730880584
NM_000256.3(MYBPC3):c.2995-5C>G rs376083315
NM_000256.3(MYBPC3):c.2997C>T (p.Gly999=) rs377283955
NM_000256.3(MYBPC3):c.3004C>T (p.Arg1002Trp) rs3729799
NM_000256.3(MYBPC3):c.3005G>A (p.Arg1002Gln) rs727504235
NM_000256.3(MYBPC3):c.3019T>C (p.Trp1007Arg) rs730880585
NM_000256.3(MYBPC3):c.3021G>A (p.Trp1007Ter) rs730880701
NM_000256.3(MYBPC3):c.3029_3030delAG (p.Glu1010Glyfs) rs730880665
NM_000256.3(MYBPC3):c.3034C>T (p.Gln1012Ter) rs730880586
NM_000256.3(MYBPC3):c.3049G>A (p.Glu1017Lys) rs368180702
NM_000256.3(MYBPC3):c.3057G>A (p.Val1019=) rs750618688
NM_000256.3(MYBPC3):c.305C>T (p.Pro102Leu) rs730880610
NM_000256.3(MYBPC3):c.3064C>T (p.Arg1022Cys) rs397515999
NM_000256.3(MYBPC3):c.3065G>C (p.Arg1022Pro) rs397516000
NM_000256.3(MYBPC3):c.3079delGinsAA (p.Asp1027Lysfs) rs730880666
NM_000256.3(MYBPC3):c.3083C>T (p.Thr1028Ile) rs397516002
NM_000256.3(MYBPC3):c.3086T>A (p.Ile1029Asn) rs730880587
NM_000256.3(MYBPC3):c.3089T>C (p.Leu1030Pro) rs730880588
NM_000256.3(MYBPC3):c.3097C>A (p.Arg1033=) rs748909815
NM_000256.3(MYBPC3):c.3097C>T (p.Arg1033Trp) rs748909815
NM_000256.3(MYBPC3):c.3098G>A (p.Arg1033Gln) rs397516003
NM_000256.3(MYBPC3):c.3106C>T (p.Arg1036Cys) rs61729664
NM_000256.3(MYBPC3):c.3107G>A (p.Arg1036His) rs374255381
NM_000256.3(MYBPC3):c.3108C>A (p.Arg1036=) rs747059136
NM_000256.3(MYBPC3):c.3123C>T (p.Gly1041=) rs374626656
NM_000256.3(MYBPC3):c.3124_3125insAA (p.Thr1042Lysfs) rs1064793202
NM_000256.3(MYBPC3):c.3137C>T (p.Thr1046Met) rs371061770
NM_000256.3(MYBPC3):c.3138G>A (p.Thr1046=) rs762154672
NM_000256.3(MYBPC3):c.3154A>G (p.Met1052Val) rs730880589
NM_000256.3(MYBPC3):c.3168C>T (p.Ala1056=) rs373208282
NM_000256.3(MYBPC3):c.3181C>T (p.Gln1061Ter) rs397516005
NM_000256.3(MYBPC3):c.3182_3190+4del rs730880718
NM_000256.3(MYBPC3):c.3190+1G>A rs111683277
NM_000256.3(MYBPC3):c.3190+2T>G rs113358486
NM_000256.3(MYBPC3):c.3190+3delG rs730880667
NM_000256.3(MYBPC3):c.3190+4C>T rs571457875
NM_000256.3(MYBPC3):c.3190+5G>A rs587782958
NM_000256.3(MYBPC3):c.3191-3C>G rs1064793891
NM_000256.3(MYBPC3):c.3191-9C>T rs1316069252
NM_000256.3(MYBPC3):c.3192dupC (p.Lys1065Glnfs) rs397516007
NM_000256.3(MYBPC3):c.3217delC (p.Arg1073Glyfs) rs730880668
NM_000256.3(MYBPC3):c.3223A>G (p.Thr1075Ala) rs767927162
NM_000256.3(MYBPC3):c.3224C>G (p.Thr1075Ser) rs150786409
NM_000256.3(MYBPC3):c.3226_3227insT (p.Asp1076Valfs) rs397516008
NM_000256.3(MYBPC3):c.3229G>A (p.Ala1077Thr) rs397516009
NM_000256.3(MYBPC3):c.322C>T (p.Pro108Ser) rs749233808
NM_000256.3(MYBPC3):c.324delT (p.Ala109Profs) rs730880721
NM_000256.3(MYBPC3):c.3253G>T (p.Glu1085Ter) rs397516010
NM_000256.3(MYBPC3):c.3257G>A (p.Trp1086Ter) rs779650200
NM_000256.3(MYBPC3):c.3264A>G (p.Pro1088=) rs758229677
NM_000256.3(MYBPC3):c.3276C>T (p.Val1092=) rs376344765
NM_000256.3(MYBPC3):c.3279C>T (p.Gly1093=) rs36212064
NM_000256.3(MYBPC3):c.3284C>T (p.Thr1095Met) rs755653624
NM_000256.3(MYBPC3):c.3285G>A (p.Thr1095=) rs367927327
NM_000256.3(MYBPC3):c.3286G>T (p.Glu1096Ter) rs121909377
NM_000256.3(MYBPC3):c.3288G>A (p.Glu1096=) rs1052373
NM_000256.3(MYBPC3):c.3288delG (p.Glu1096Aspfs) rs727503172
NM_000256.3(MYBPC3):c.3293G>T (p.Trp1098Leu) rs397516013
NM_000256.3(MYBPC3):c.3295G>C (p.Gly1099Arg) rs1064794364
NM_000256.3(MYBPC3):c.3302_3303delCA (p.Thr1101Serfs) rs730880671
NM_000256.3(MYBPC3):c.3305T>A (p.Val1102Glu) rs730880590
NM_000256.3(MYBPC3):c.3308A>C (p.Gln1103Pro) rs730880591
NM_000256.3(MYBPC3):c.3315C>T (p.Ala1105=) rs200372325
NM_000256.3(MYBPC3):c.3316G>A (p.Asp1106Asn) rs377106864
NM_000256.3(MYBPC3):c.3321dupG (p.Lys1108Glufs) rs730880672
NM_000256.3(MYBPC3):c.3323A>C (p.Lys1108Thr) rs397516015
NM_000256.3(MYBPC3):c.3326C>T (p.Thr1109Ile) rs397516016
NM_000256.3(MYBPC3):c.3327delC (p.Met1110Trpfs) rs730880719
NM_000256.3(MYBPC3):c.332C>T (p.Ala111Val) rs730880530
NM_000256.3(MYBPC3):c.3330+2T>C rs387906397
NM_000256.3(MYBPC3):c.3330+2T>G rs387906397
NM_000256.3(MYBPC3):c.3330+5G>A rs373746463
NM_000256.3(MYBPC3):c.3330+5G>C rs373746463
NM_000256.3(MYBPC3):c.3330+5G>T rs373746463
NM_000256.3(MYBPC3):c.3331-2A>C rs869025469
NM_000256.3(MYBPC3):c.3335G>A (p.Trp1112Ter) rs727504276
NM_000256.3(MYBPC3):c.3335_3337dupGGT (p.Trp1112_Phe1113insTrp) rs730880673
NM_000256.3(MYBPC3):c.3362G>A (p.Arg1121His) rs397516018
NM_000256.3(MYBPC3):c.3372C>A (p.Cys1124Ter) rs727504289
NM_000256.3(MYBPC3):c.3373G>A (p.Val1125Met) rs121909378
NM_000256.3(MYBPC3):c.3384G>C (p.Glu1128Asp) rs375116558
NM_000256.3(MYBPC3):c.338C>A (p.Ala113Asp) rs730880611
NM_000256.3(MYBPC3):c.3392T>C (p.Ile1131Thr) rs370890951
NM_000256.3(MYBPC3):c.3407_3409delACT (p.Tyr1136del) rs730880674
NM_000256.3(MYBPC3):c.3408C>A (p.Tyr1136Ter) rs193922383
NM_000256.3(MYBPC3):c.340A>G (p.Thr114Ala) rs730880612
NM_000256.3(MYBPC3):c.3412C>T (p.Arg1138Cys) rs377171707
NM_000256.3(MYBPC3):c.3413G>A (p.Arg1138His) rs187705120
NM_000256.3(MYBPC3):c.3413G>C (p.Arg1138Pro) rs187705120
NM_000256.3(MYBPC3):c.3415G>A (p.Val1139Ile) rs373519667
NM_000256.3(MYBPC3):c.3431T>C (p.Met1144Thr) rs730880529
NM_000256.3(MYBPC3):c.3442A>C (p.Ser1148Arg) rs370658083
NM_000256.3(MYBPC3):c.3467dupA (p.Pro1157Alafs) rs730880720
NM_000256.3(MYBPC3):c.3472G>A (p.Val1158Ile) rs542350927
NM_000256.3(MYBPC3):c.3472_3481del (p.Val1158Profs) rs730880675
NM_000256.3(MYBPC3):c.3476_3479dup (p.Pro1161Tyrfs) rs397516019
NM_000256.3(MYBPC3):c.3490+1G>T rs397516020
NM_000256.3(MYBPC3):c.3491-2A>T rs397516022
NM_000256.3(MYBPC3):c.3491-3C>A rs730880592
NM_000256.3(MYBPC3):c.3491-3C>G rs730880592
NM_000256.3(MYBPC3):c.350delC (p.Pro117Leufs) rs397516023
NM_000256.3(MYBPC3):c.3514_3517dupTATA (p.Lys1173Ilefs) rs1555120309
NM_000256.3(MYBPC3):c.3535G>A (p.Glu1179Lys) rs199669878
NM_000256.3(MYBPC3):c.3541C>G (p.Pro1181Ala) rs730880593
NM_000256.3(MYBPC3):c.3553C>T (p.Gln1185Ter) rs730880699
NM_000256.3(MYBPC3):c.3569G>A (p.Arg1190His) rs117354682
NM_000256.3(MYBPC3):c.3580G>A (p.Ala1194Thr) rs397516026
NM_000256.3(MYBPC3):c.3581C>T (p.Ala1194Val) rs730880594
NM_000256.3(MYBPC3):c.3584G>T (p.Gly1195Val) rs730880595
NM_000256.3(MYBPC3):c.3599T>C (p.Leu1200Pro) rs397516028
NM_000256.3(MYBPC3):c.3613C>T (p.Arg1205Trp) rs727503171
NM_000256.3(MYBPC3):c.3614G>A (p.Arg1205Gln) rs730880596
NM_000256.3(MYBPC3):c.3617G>A (p.Gly1206Asp) rs1057517769
NM_000256.3(MYBPC3):c.3624delC (p.Lys1209Serfs) rs397516029
NM_000256.3(MYBPC3):c.3627+14G>A rs1057521242
NM_000256.3(MYBPC3):c.3627+17G>A rs778235604
NM_000256.3(MYBPC3):c.3627+1G>A rs397516031
NM_000256.3(MYBPC3):c.3628-41_3628-17delAGCCTGGATGGCTTCCCTCCCTCTC rs36212066
NM_000256.3(MYBPC3):c.3628-6T>C rs1057520329
NM_000256.3(MYBPC3):c.362C>T (p.Pro121Leu) rs551888783
NM_000256.3(MYBPC3):c.362delC (p.Pro121Argfs) rs397516032
NM_000256.3(MYBPC3):c.363G>A (p.Pro121=) rs780768974
NM_000256.3(MYBPC3):c.3641G>A (p.Trp1214Ter) rs730880597
NM_000256.3(MYBPC3):c.3642G>A (p.Trp1214Ter) rs368765949
NM_000256.3(MYBPC3):c.3664G>T (p.Gly1222Ter) rs730880598
NM_000256.3(MYBPC3):c.3672C>T (p.Asp1224=) rs368221517
NM_000256.3(MYBPC3):c.3679T>A (p.Phe1227Ile) rs730880599
NM_000256.3(MYBPC3):c.3682C>T (p.Arg1228Cys) rs201312636
NM_000256.3(MYBPC3):c.3683G>C (p.Arg1228Pro) rs528940575
NM_000256.3(MYBPC3):c.3697C>T (p.Gln1233Ter) rs397516037
NM_000256.3(MYBPC3):c.3699G>A (p.Gln1233=) rs200162906
NM_000256.3(MYBPC3):c.3708G>A (p.Leu1236=) rs767400149
NM_000256.3(MYBPC3):c.3713T>C (p.Leu1238Pro) rs730880702
NM_000256.3(MYBPC3):c.3716A>G (p.Glu1239Gly) rs1085308024
NM_000256.3(MYBPC3):c.3726G>T (p.Lys1242Asn) rs778267366
NM_000256.3(MYBPC3):c.3726delG (p.Lys1242Asnfs) rs1064796231
NM_000256.3(MYBPC3):c.372C>T (p.Ala124=) rs11570046
NM_000256.3(MYBPC3):c.3732C>A (p.Cys1244Ter) rs730880600
NM_000256.3(MYBPC3):c.373_374delGC (p.Ala125Terfs) rs1057517767
NM_000256.3(MYBPC3):c.3740A>G (p.Asp1247Gly) rs1085307978
NM_000256.3(MYBPC3):c.3742G>A (p.Gly1248Arg) rs202147520
NM_000256.3(MYBPC3):c.3742_3759dup18 (p.Cys1253_Arg1254insGlyGlyIleTyrValCys) rs193922384
NM_000256.3(MYBPC3):c.3744_3758del (p.Gly1249_Cys1253del) rs730880676
NM_000256.3(MYBPC3):c.3746G>T (p.Gly1249Val) rs727504259
NM_000256.3(MYBPC3):c.3751T>C (p.Tyr1251His) rs730880601
NM_000256.3(MYBPC3):c.3752A>G (p.Tyr1251Cys) rs730880602
NM_000256.3(MYBPC3):c.3763G>A (p.Ala1255Thr) rs727503167
NM_000256.3(MYBPC3):c.3767_3769delCCA (p.Thr1256del) rs397516040
NM_000256.3(MYBPC3):c.3771C>A (p.Asn1257Lys) rs730880603
NM_000256.3(MYBPC3):c.3773T>G (p.Leu1258Ter) rs730880604
NM_000256.3(MYBPC3):c.3775C>T (p.Gln1259Ter) rs730880605
NM_000256.3(MYBPC3):c.3777G>A (p.Gln1259=) rs746042492
NM_000256.3(MYBPC3):c.3779G>A (p.Gly1260Asp) rs730880606
NM_000256.3(MYBPC3):c.3781G>T (p.Glu1261Ter) rs730880141
NM_000256.3(MYBPC3):c.3782_3792delAGGCACGGTGTinsCCTG (p.Glu1261Alafs) rs1085307897
NM_000256.3(MYBPC3):c.3787C>T (p.Arg1263Trp) rs370338674
NM_000256.3(MYBPC3):c.3791G>A (p.Cys1264Tyr) rs397514751
NM_000256.3(MYBPC3):c.3791G>T (p.Cys1264Phe) rs397514751
NM_000256.3(MYBPC3):c.3794A>T (p.Glu1265Val) rs730880607
NM_000256.3(MYBPC3):c.3796T>C (p.Cys1266Arg) rs730880608
NM_000256.3(MYBPC3):c.3797G>A (p.Cys1266Tyr) rs397516041
NM_000256.3(MYBPC3):c.3801C>T (p.Arg1267=) rs541377415
NM_000256.3(MYBPC3):c.3808G>T (p.Val1270Leu) rs1064796634
NM_000256.3(MYBPC3):c.3809T>G (p.Val1270Gly) rs1064793310
NM_000256.3(MYBPC3):c.3811C>T (p.Arg1271Ter) rs397516042
NM_000256.3(MYBPC3):c.3814+13C>A rs764528392
NM_000256.3(MYBPC3):c.3814+1G>A rs1057521823
NM_000256.3(MYBPC3):c.3814G>A (p.Val1272Met) rs730880609
NM_000256.3(MYBPC3):c.3815-1G>A rs397516044
NM_000256.3(MYBPC3):c.3816G>A (p.Val1272=) rs776112819
NM_000256.3(MYBPC3):c.3G>C (p.Met1Ile) rs397516045
NM_000256.3(MYBPC3):c.406G>A (p.Gly136Arg) rs730880613
NM_000256.3(MYBPC3):c.408G>C (p.Gly136=) rs1057520977
NM_000256.3(MYBPC3):c.410C>G (p.Ser137Ter) rs730880703
NM_000256.3(MYBPC3):c.416C>G (p.Ser139Ter) rs730880704
NM_000256.3(MYBPC3):c.418G>C (p.Ala140Pro) rs730880614
NM_000256.3(MYBPC3):c.41A>G (p.Lys14Arg) rs779049126
NM_000256.3(MYBPC3):c.428A>G (p.Asn143Ser) rs730880705
NM_000256.3(MYBPC3):c.436dupA (p.Thr146Asnfs) rs397516049
NM_000256.3(MYBPC3):c.440C>T (p.Pro147Leu) rs730880615
NM_000256.3(MYBPC3):c.442G>A (p.Gly148Arg) rs397516050
NM_000256.3(MYBPC3):c.450C>T (p.Pro150=) rs377520770
NM_000256.3(MYBPC3):c.450delC (p.Asp151Metfs) rs730880677
NM_000256.3(MYBPC3):c.453delT (p.Asp151Glufs) rs730880679
NM_000256.3(MYBPC3):c.455_456delAC (p.Asp152Alafs) rs730880680
NM_000256.3(MYBPC3):c.458C>A (p.Pro153His) rs756328813
NM_000256.3(MYBPC3):c.459delC (p.Ile154Leufs) rs397516052
NM_000256.3(MYBPC3):c.461T>C (p.Ile154Thr) rs373946195
NM_000256.3(MYBPC3):c.46C>T (p.Pro16Ser) rs730880573
NM_000256.3(MYBPC3):c.471C>T (p.Phe157=) rs150291001
NM_000256.3(MYBPC3):c.472G>A (p.Val158Met) rs3729986
NM_000256.3(MYBPC3):c.477G>A (p.Met159Ile) rs730880706
NM_000256.3(MYBPC3):c.478C>T (p.Arg160Trp) rs193068692
NM_000256.3(MYBPC3):c.479G>A (p.Arg160Gln) rs730880617
NM_000256.3(MYBPC3):c.481C>A (p.Pro161Thr) rs397516053
NM_000256.3(MYBPC3):c.495G>C (p.Glu165Asp) rs730880619
NM_000256.3(MYBPC3):c.49C>T (p.Arg17Trp) rs747857800
NM_000256.3(MYBPC3):c.502G>A (p.Val168Met) rs569740494
NM_000256.3(MYBPC3):c.505+1G>A rs730880620
NM_000256.3(MYBPC3):c.506-12delC rs11570050
NM_000256.3(MYBPC3):c.506-17C>T rs561595897
NM_000256.3(MYBPC3):c.50G>A (p.Arg17Gln) rs374630007
NM_000256.3(MYBPC3):c.518C>T (p.Thr173Ile) rs113941605
NM_000256.3(MYBPC3):c.521_523delTCT (p.Phe174del) rs730880722
NM_000256.3(MYBPC3):c.529C>T (p.Arg177Cys) rs193922385
NM_000256.3(MYBPC3):c.530G>A (p.Arg177His) rs201012766
NM_000256.3(MYBPC3):c.531C>T (p.Arg177=) rs368035400
NM_000256.3(MYBPC3):c.540C>T (p.Gly180=) rs371842442
NM_000256.3(MYBPC3):c.547C>G (p.Leu183Val) rs1293264960
NM_000256.3(MYBPC3):c.551dupT (p.Lys185Glufs) rs397516059
NM_000256.3(MYBPC3):c.553A>T (p.Lys185Ter) rs375607980
NM_000256.3(MYBPC3):c.557C>T (p.Pro186Leu) rs727503216
NM_000256.3(MYBPC3):c.566T>A (p.Val189Asp) rs397516060
NM_000256.3(MYBPC3):c.567C>G (p.Val189=) rs1290069260
NM_000256.3(MYBPC3):c.571T>C (p.Trp191Arg) rs730880622
NM_000256.3(MYBPC3):c.586delT (p.Trp196Glyfs) rs730880681
NM_000256.3(MYBPC3):c.604A>C (p.Lys202Gln) rs730880623
NM_000256.3(MYBPC3):c.613C>T (p.Gln205Ter) rs397516061
NM_000256.3(MYBPC3):c.624G>C (p.Gln208His) rs202139499
NM_000256.3(MYBPC3):c.627_637delGCACGACAGCT (p.His210Argfs) rs1555123389
NM_000256.3(MYBPC3):c.639C>T (p.Tyr213=) rs727504858
NM_000256.3(MYBPC3):c.646G>A (p.Ala216Thr) rs201098973
NM_000256.3(MYBPC3):c.648C>T (p.Ala216=) rs777418402
NM_000256.3(MYBPC3):c.649A>G (p.Ser217Gly) rs138753870
NM_000256.3(MYBPC3):c.653A>G (p.Lys218Arg) rs730880707
NM_000256.3(MYBPC3):c.654+17C>T rs369864892
NM_000256.3(MYBPC3):c.654+2_654+4dupTGG rs730880682
NM_000256.3(MYBPC3):c.655-15C>T rs188327777
NM_000256.3(MYBPC3):c.655-1G>A rs397516067
NM_000256.3(MYBPC3):c.655G>C (p.Val219Leu) rs397516068
NM_000256.3(MYBPC3):c.655G>T (p.Val219Phe) rs397516068
NM_000256.3(MYBPC3):c.659A>G (p.Tyr220Cys) rs779693951
NM_000256.3(MYBPC3):c.682G>A (p.Asp228Asn) rs369300885
NM_000256.3(MYBPC3):c.706A>G (p.Ser236Gly) rs3729989
NM_000256.3(MYBPC3):c.709T>C (p.Tyr237His) rs730880624
NM_000256.3(MYBPC3):c.710A>C (p.Tyr237Ser) rs397516070
NM_000256.3(MYBPC3):c.713G>A (p.Arg238His) rs727504396
NM_000256.3(MYBPC3):c.721G>A (p.Val241Met) rs886039000
NM_000256.3(MYBPC3):c.721G>C (p.Val241Leu) rs886039000
NM_000256.3(MYBPC3):c.722dupT (p.Ser242Valfs) rs730880683
NM_000256.3(MYBPC3):c.727A>C (p.Thr243Pro) rs730880625
NM_000256.3(MYBPC3):c.747C>A (p.Cys249Ter) rs771929829
NM_000256.3(MYBPC3):c.772+10C>T rs375525278
NM_000256.3(MYBPC3):c.772+9G>T rs566339669
NM_000256.3(MYBPC3):c.772G>A (p.Glu258Lys) rs397516074
NM_000256.3(MYBPC3):c.786C>T (p.Thr262=) rs11570058
NM_000256.3(MYBPC3):c.787G>A (p.Gly263Arg) rs373730381
NM_000256.3(MYBPC3):c.799C>G (p.Leu267Val) rs370941975
NM_000256.3(MYBPC3):c.814C>T (p.Arg272Cys) rs397516075
NM_000256.3(MYBPC3):c.815G>A (p.Arg272His) rs759515993
NM_000256.3(MYBPC3):c.818G>A (p.Arg273His) rs376461745
NM_000256.3(MYBPC3):c.81C>T (p.Ala27=) rs761547225
NM_000256.3(MYBPC3):c.821+13C>G rs1057521528
NM_000256.3(MYBPC3):c.821+1G>A rs397516073
NM_000256.3(MYBPC3):c.821+5G>A rs397516077
NM_000256.3(MYBPC3):c.822-3C>T rs730880628
NM_000256.3(MYBPC3):c.833G>A (p.Gly278Glu) rs147315081
NM_000256.3(MYBPC3):c.833delG (p.Gly278Glufs) rs727503212
NM_000256.3(MYBPC3):c.841C>T (p.Arg281Trp) rs371711564
NM_000256.3(MYBPC3):c.851+18C>T rs377287239
NM_000256.3(MYBPC3):c.852-10C>G rs750425291
NM_000256.3(MYBPC3):c.882C>T (p.Asp294=) rs1459586065
NM_000256.3(MYBPC3):c.884delT (p.Phe295Serfs) rs730880684
NM_000256.3(MYBPC3):c.901A>T (p.Lys301Ter) rs730880629
NM_000256.3(MYBPC3):c.905+11G>T rs1025510303
NM_000256.3(MYBPC3):c.906-11C>T rs1296550753
NM_000256.3(MYBPC3):c.906-13T>A rs730881219
NM_000256.3(MYBPC3):c.906-1G>A rs587776700
NM_000256.3(MYBPC3):c.906-1G>C rs587776700
NM_000256.3(MYBPC3):c.906-7G>T rs397516079
NM_000256.3(MYBPC3):c.908+13G>A rs1321998052
NM_000256.3(MYBPC3):c.909-13A>C rs587781044
NM_000256.3(MYBPC3):c.909-19A>C rs587781043
NM_000256.3(MYBPC3):c.909-20C>T rs377262354
NM_000256.3(MYBPC3):c.913_914delTT (p.Phe305Profs) rs397516080
NM_000256.3(MYBPC3):c.917G>A (p.Arg306Gln) rs373204728
NM_000256.3(MYBPC3):c.921C>A (p.Thr307=) rs370632180
NM_000256.3(MYBPC3):c.923_924insAACT (p.Arg309Thrfs) rs730880678
NM_000256.3(MYBPC3):c.927-10C>G rs201078659
NM_000256.3(MYBPC3):c.927-10C>T rs201078659
NM_000256.3(MYBPC3):c.927-2A>G rs397516082
NM_000256.3(MYBPC3):c.927-9G>A rs397516083
NM_000256.3(MYBPC3):c.929A>G (p.Asp310Gly) rs1131692033
NM_000256.3(MYBPC3):c.932C>A (p.Ser311Ter) rs193922386
NM_000256.3(MYBPC3):c.933G>C (p.Ser311=) rs374326087
NM_000256.3(MYBPC3):c.93C>T (p.Ala31=) rs397516085
NM_000256.3(MYBPC3):c.960C>T (p.Asp320=) rs369900803
NM_000256.3(MYBPC3):c.961G>A (p.Val321Met) rs200119454
NM_000256.3(MYBPC3):c.964T>C (p.Trp322Arg) rs730880708
NM_000256.3(MYBPC3):c.966G>A (p.Trp322Ter) rs727503211
NM_000256.3(MYBPC3):c.977G>A (p.Arg326Gln) rs34580776
NM_000256.3(MYBPC3):c.978delG (p.Gln327Argfs) rs1064793536
NM_000256.3(MYBPC3):c.98_99delCA (p.Thr33Argfs) rs745811346
NM_000256.3(MYBPC3):c.994G>A (p.Glu332Lys) rs397516086
NM_000256.3(MYBPC3):c.999C>G (p.Tyr333Ter) rs367947846
NM_000256.3(MYBPC3):c.999C>T (p.Tyr333=) rs367947846

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.