ClinVar Miner

List of variants in gene MYBPC3 reported as likely pathogenic by Bioinformatics dept.,Datar Cancer Genetics Limited, India

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 1
Download table as spreadsheet
NM_000256.3(MYBPC3):c.3628-41_3628-17delAGCCTGGATGGCTTCCCTCCCTCTC rs36212066

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.