ClinVar Miner

List of variants in gene MYO7A studied for not specified

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 349
Download table as spreadsheet
NM_000260.3(MYO7A):c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG rs111033223
NM_000260.4(MYO7A):c.1004-35C>G rs2071151
NM_000260.4(MYO7A):c.1006C>T (p.Arg336Cys) rs369997614
NM_000260.4(MYO7A):c.1007G>A (p.Arg336His) rs45629132
NM_000260.4(MYO7A):c.1117C>T (p.Arg373Cys) rs868979094
NM_000260.4(MYO7A):c.1123C>G (p.Leu375Val) rs782728522
NM_000260.4(MYO7A):c.1126A>G (p.Ile376Val) rs368716988
NM_000260.4(MYO7A):c.1132C>T (p.Arg378Cys) rs199818783
NM_000260.4(MYO7A):c.1133G>A (p.Arg378His) rs397516282
NM_000260.4(MYO7A):c.1133G>C (p.Arg378Pro) rs397516282
NM_000260.4(MYO7A):c.1138G>A (p.Glu380Lys) rs876657913
NM_000260.4(MYO7A):c.1195G>A (p.Val399Ile) rs1162724549
NM_000260.4(MYO7A):c.1232T>C (p.Val411Ala) rs369916141
NM_000260.4(MYO7A):c.1239G>A (p.Lys413=) rs782729773
NM_000260.4(MYO7A):c.1284C>T (p.Asn428=) rs573454806
NM_000260.4(MYO7A):c.1288C>T (p.Arg430Cys) rs201839693
NM_000260.4(MYO7A):c.133-14C>T rs116228809
NM_000260.4(MYO7A):c.133-6C>T rs376963984
NM_000260.4(MYO7A):c.133-7C>T rs111033221
NM_000260.4(MYO7A):c.1343+50T>A rs77568474
NM_000260.4(MYO7A):c.1343+8G>A rs2276278
NM_000260.4(MYO7A):c.1343+8G>T rs2276278
NM_000260.4(MYO7A):c.1368C>T (p.Phe456=) rs559209306
NM_000260.4(MYO7A):c.1374T>G (p.Asn458Lys) rs782293740
NM_000260.4(MYO7A):c.1401_1403dup (p.His468_Val469insGln) rs111033219
NM_000260.4(MYO7A):c.1422G>A (p.Gln474=) rs201332147
NM_000260.4(MYO7A):c.1455G>A (p.Leu485=) rs375528761
NM_000260.4(MYO7A):c.1496T>C (p.Ile499Thr) rs397516286
NM_000260.4(MYO7A):c.1506G>A (p.Lys502=) rs181126043
NM_000260.4(MYO7A):c.1543A>C (p.Lys515Gln) rs782023308
NM_000260.4(MYO7A):c.1554+7C>T rs150114658
NM_000260.4(MYO7A):c.1554+8G>A rs111033227
NM_000260.4(MYO7A):c.1555-15C>T rs782573211
NM_000260.4(MYO7A):c.1555-5C>T rs569844918
NM_000260.4(MYO7A):c.1587C>T (p.Asn529=) rs372325609
NM_000260.4(MYO7A):c.1605C>T (p.Asn535=) rs111033228
NM_000260.4(MYO7A):c.1606G>A (p.Ala536Thr) rs201046979
NM_000260.4(MYO7A):c.1617C>G (p.Ile539Met) rs782450807
NM_000260.4(MYO7A):c.1619C>A (p.Pro540His) rs782607566
NM_000260.4(MYO7A):c.1623C>G (p.Pro541=) rs373327248
NM_000260.4(MYO7A):c.1690+15C>T rs781801012
NM_000260.4(MYO7A):c.1721A>C (p.His574Pro) rs397516287
NM_000260.4(MYO7A):c.1726G>A (p.Asp576Asn) rs187165412
NM_000260.4(MYO7A):c.1797+8G>A rs781801358
NM_000260.4(MYO7A):c.1798-11C>T rs782146561
NM_000260.4(MYO7A):c.1798-15C>T rs115708180
NM_000260.4(MYO7A):c.1801G>A (p.Ala601Thr) rs782481491
NM_000260.4(MYO7A):c.1814A>G (p.Lys605Arg) rs968552859
NM_000260.4(MYO7A):c.1817G>A (p.Arg606His) rs782311929
NM_000260.4(MYO7A):c.1821G>A (p.Ser607=) rs397516288
NM_000260.4(MYO7A):c.182C>G (p.Pro61Arg) rs397516289
NM_000260.4(MYO7A):c.1846C>T (p.Arg616Trp) rs369195493
NM_000260.4(MYO7A):c.1854G>A (p.Leu618=) rs35429535
NM_000260.4(MYO7A):c.1868G>A (p.Arg623His) rs111033416
NM_000260.4(MYO7A):c.1901G>A (p.Arg634Gln) rs781812509
NM_000260.4(MYO7A):c.1903T>C (p.Cys635Arg) rs797044514
NM_000260.4(MYO7A):c.1936-23G>A rs2276283
NM_000260.4(MYO7A):c.1945C>T (p.Arg649Trp) rs782503314
NM_000260.4(MYO7A):c.1956C>T (p.Cys652=) rs367693437
NM_000260.4(MYO7A):c.1984A>T (p.Met662Leu) rs782485961
NM_000260.4(MYO7A):c.2002C>T (p.Arg668Cys) rs397516292
NM_000260.4(MYO7A):c.2006G>A (p.Arg669Gln) rs201178011
NM_000260.4(MYO7A):c.2011G>A (p.Gly671Ser) rs387906699
NM_000260.4(MYO7A):c.2035G>A (p.Val679Ile) rs35641839
NM_000260.4(MYO7A):c.2039A>G (p.Glu680Gly) rs1555079057
NM_000260.4(MYO7A):c.2091G>A (p.Lys697=) rs768972429
NM_000260.4(MYO7A):c.2094+8G>A rs781886473
NM_000260.4(MYO7A):c.2106C>T (p.Arg702=) rs369787754
NM_000260.4(MYO7A):c.2122A>G (p.Met708Val) rs397516293
NM_000260.4(MYO7A):c.2181T>C (p.Phe727=) rs373656667
NM_000260.4(MYO7A):c.2218C>T (p.Arg740Trp) rs201234369
NM_000260.4(MYO7A):c.2236G>A (p.Asp746Asn) rs36090425
NM_000260.4(MYO7A):c.2248C>T (p.Leu750Phe) rs1224881006
NM_000260.4(MYO7A):c.2282+5G>A rs540145750
NM_000260.4(MYO7A):c.2283G>A (p.Arg761=) rs111033229
NM_000260.4(MYO7A):c.2293C>A (p.Leu765Met) rs201203036
NM_000260.4(MYO7A):c.2308G>A (p.Ala770Thr) rs375253473
NM_000260.4(MYO7A):c.2386C>G (p.Arg796Gly) rs111033339
NM_000260.4(MYO7A):c.2387G>A (p.Arg796Gln) rs111033224
NM_000260.4(MYO7A):c.2421C>T (p.His807=) rs782218928
NM_000260.4(MYO7A):c.2447G>A (p.Arg816His) rs148343670
NM_000260.4(MYO7A):c.2467C>T (p.Arg823Cys)
NM_000260.4(MYO7A):c.2476G>A (p.Ala826Thr) rs368341987
NM_000260.4(MYO7A):c.247C>A (p.Arg83Ser) rs781790246
NM_000260.4(MYO7A):c.2488C>T (p.Arg830Cys) rs797044493
NM_000260.4(MYO7A):c.2506C>T (p.Arg836Cys) rs375510570
NM_000260.4(MYO7A):c.2522T>C (p.Leu841Pro) rs397516296
NM_000260.4(MYO7A):c.2527G>A (p.Val843Met) rs140559111
NM_000260.4(MYO7A):c.2558G>A (p.Arg853His) rs111033437
NM_000260.4(MYO7A):c.2587-14C>T rs180774455
NM_000260.4(MYO7A):c.2597G>A (p.Arg866His) rs199607235
NM_000260.4(MYO7A):c.2598C>T (p.Arg866=)
NM_000260.4(MYO7A):c.2617C>T (p.Arg873Trp) rs200454015
NM_000260.4(MYO7A):c.2618G>A (p.Arg873Gln) rs1052032
NM_000260.4(MYO7A):c.2625G>A (p.Ala875=) rs375489617
NM_000260.4(MYO7A):c.2636A>C (p.Lys879Thr) rs1591374351
NM_000260.4(MYO7A):c.2656G>A (p.Ala886Thr)
NM_000260.4(MYO7A):c.2724C>T (p.Asp908=) rs199979876
NM_000260.4(MYO7A):c.2754C>T (p.Ala918=) rs78072361
NM_000260.4(MYO7A):c.2759G>T (p.Arg920Leu) rs565162134
NM_000260.4(MYO7A):c.2798G>A (p.Arg933His) rs201489714
NM_000260.4(MYO7A):c.2829G>A (p.Val943=) rs797044494
NM_000260.4(MYO7A):c.2836A>C (p.Met946Leu) rs1357072694
NM_000260.4(MYO7A):c.285+14C>G rs876657532
NM_000260.4(MYO7A):c.2850G>A (p.Leu950=) rs397516297
NM_000260.4(MYO7A):c.286-5C>T rs111033471
NM_000260.4(MYO7A):c.2882G>A (p.Gly961Asp) rs199575418
NM_000260.4(MYO7A):c.2886G>C (p.Gln962His) rs200641606
NM_000260.4(MYO7A):c.288G>A (p.Thr96=) rs56023295
NM_000260.4(MYO7A):c.2928G>A (p.Glu976=) rs372223659
NM_000260.4(MYO7A):c.2960C>T (p.Pro987Leu) rs397516298
NM_000260.4(MYO7A):c.3036A>G (p.Thr1012=) rs111033251
NM_000260.4(MYO7A):c.3038C>T (p.Thr1013Ile) rs369539923
NM_000260.4(MYO7A):c.3042G>T (p.Thr1014=) rs111033507
NM_000260.4(MYO7A):c.3086A>G (p.His1029Arg) rs60103800
NM_000260.4(MYO7A):c.3109-13_3109-12insTCTGGCCTCTGACATGTGCGC rs869312123
NM_000260.4(MYO7A):c.3157C>T (p.Pro1053Ser) rs370104824
NM_000260.4(MYO7A):c.3246G>A (p.Thr1082=) rs35963362
NM_000260.4(MYO7A):c.324C>T (p.Tyr108=) rs116892396
NM_000260.4(MYO7A):c.3270G>A (p.Leu1090=) rs370305347
NM_000260.4(MYO7A):c.3283G>A (p.Glu1095Lys) rs199810429
NM_000260.4(MYO7A):c.3297C>T (p.Pro1099=) rs367668576
NM_000260.4(MYO7A):c.3375+14C>A rs782500012
NM_000260.4(MYO7A):c.3375+33G>C rs948972
NM_000260.4(MYO7A):c.3375+3G>A rs397516299
NM_000260.4(MYO7A):c.3384G>C (p.Lys1128Asn) rs372050452
NM_000260.4(MYO7A):c.3404C>A (p.Ser1135Tyr) rs376688581
NM_000260.4(MYO7A):c.3451C>G (p.Leu1151Val) rs782465732
NM_000260.4(MYO7A):c.3469A>G (p.Ile1157Val) rs397516300
NM_000260.4(MYO7A):c.3472A>G (p.Ile1158Val) rs797044517
NM_000260.4(MYO7A):c.3474C>T (p.Ile1158=) rs201834743
NM_000260.4(MYO7A):c.3491G>A (p.Arg1164Gln) rs782350886
NM_000260.4(MYO7A):c.3503+9C>T rs1481745974
NM_000260.4(MYO7A):c.3503G>A (p.Arg1168Gln) rs797044516
NM_000260.4(MYO7A):c.3527G>A (p.Ser1176Asn) rs373147966
NM_000260.4(MYO7A):c.3536T>A (p.Leu1179Gln) rs199918940
NM_000260.4(MYO7A):c.3583G>A (p.Val1195Met) rs781958107
NM_000260.4(MYO7A):c.358C>A (p.Arg120Ser) rs397516302
NM_000260.4(MYO7A):c.359G>A (p.Arg120His) rs369493667
NM_000260.4(MYO7A):c.3602G>C (p.Cys1201Ser) rs117966637
NM_000260.4(MYO7A):c.3630+7A>G rs373958166
NM_000260.4(MYO7A):c.3652G>A (p.Gly1218Arg) rs111033195
NM_000260.4(MYO7A):c.3656G>T (p.Gly1219Val) rs1555090958
NM_000260.4(MYO7A):c.3659C>T (p.Pro1220Leu) rs727504710
NM_000260.4(MYO7A):c.3669C>T (p.Tyr1223=) rs727504631
NM_000260.4(MYO7A):c.3702C>G (p.Thr1234=) rs77299211
NM_000260.4(MYO7A):c.3750+5G>A rs111033391
NM_000260.4(MYO7A):c.3750+7G>A rs397516305
NM_000260.4(MYO7A):c.3750+9G>A rs111033252
NM_000260.4(MYO7A):c.380T>C (p.Ile127Thr) rs41298131
NM_000260.4(MYO7A):c.3828G>A (p.Ser1276=) rs78871677
NM_000260.4(MYO7A):c.3836C>T (p.Thr1279Met) rs766245260
NM_000260.4(MYO7A):c.3856G>A (p.Ala1286Thr) rs727503328
NM_000260.4(MYO7A):c.3858G>A (p.Ala1286=) rs372623270
NM_000260.4(MYO7A):c.3864C>T (p.Ala1288=) rs144657938
NM_000260.4(MYO7A):c.3924+10CCCGGAAGCACCTCCT[3] rs759572835
NM_000260.4(MYO7A):c.3924+12C>T rs2276285
NM_000260.4(MYO7A):c.3925-8G>A rs367645097
NM_000260.4(MYO7A):c.3943G>A (p.Gly1315Ser) rs769771981
NM_000260.4(MYO7A):c.3978C>T (p.Cys1326=) rs111033376
NM_000260.4(MYO7A):c.397C>A (p.His133Asn) rs111033403
NM_000260.4(MYO7A):c.4018G>A (p.Ala1340Thr) rs376291076
NM_000260.4(MYO7A):c.4023C>T (p.Pro1341=) rs73495790
NM_000260.4(MYO7A):c.4074C>T (p.Ser1358=) rs78996818
NM_000260.4(MYO7A):c.4084G>A (p.Val1362Met) rs774773009
NM_000260.4(MYO7A):c.4153-10C>G rs397516306
NM_000260.4(MYO7A):c.4153-11C>T rs727503330
NM_000260.4(MYO7A):c.4153-7C>A rs369489756
NM_000260.4(MYO7A):c.4153-8C>G rs143216377
NM_000260.4(MYO7A):c.4153-8C>T rs143216377
NM_000260.4(MYO7A):c.4171C>G (p.Leu1391Val) rs727504594
NM_000260.4(MYO7A):c.4195G>C (p.Asp1399His) rs373080197
NM_000260.4(MYO7A):c.4222C>G (p.Arg1408Gly) rs377391891
NM_000260.4(MYO7A):c.4251C>T (p.Ile1417=) rs397516307
NM_000260.4(MYO7A):c.4254C>T (p.Pro1418=) rs548434591
NM_000260.4(MYO7A):c.4281G>A (p.Thr1427=) rs185607254
NM_000260.4(MYO7A):c.4323+12G>A rs115708951
NM_000260.4(MYO7A):c.4323+35G>T rs1109977
NM_000260.4(MYO7A):c.4360G>A (p.Val1454Ile) rs397516309
NM_000260.4(MYO7A):c.4362C>A (p.Val1454=) rs374492441
NM_000260.4(MYO7A):c.440G>A (p.Arg147His) rs111033512
NM_000260.4(MYO7A):c.4441+19T>C rs11237114
NM_000260.4(MYO7A):c.4441+7C>T rs372493678
NM_000260.4(MYO7A):c.4450C>T (p.Leu1484Phe) rs200416912
NM_000260.4(MYO7A):c.4461C>T (p.Asn1487=) rs56174006
NM_000260.4(MYO7A):c.4471G>A (p.Val1491Met) rs369768947
NM_000260.4(MYO7A):c.4488G>A (p.Thr1496=) rs376743356
NM_000260.4(MYO7A):c.448C>A (p.Arg150=) rs121965079
NM_000260.4(MYO7A):c.449G>A (p.Arg150Gln) rs202245413
NM_000260.4(MYO7A):c.4505A>G (p.Asp1502Gly) rs757460257
NM_000260.4(MYO7A):c.4568+12C>G rs72933642
NM_000260.4(MYO7A):c.4568+13G>A rs532356676
NM_000260.4(MYO7A):c.4577G>A (p.Arg1526His) rs397516311
NM_000260.4(MYO7A):c.4589C>T (p.Ser1530Leu) rs111033183
NM_000260.4(MYO7A):c.4619C>T (p.Ala1540Val) rs111033511
NM_000260.4(MYO7A):c.4620G>A (p.Ala1540=) rs41298745
NM_000260.4(MYO7A):c.4650G>A (p.Pro1550=) rs751242817
NM_000260.4(MYO7A):c.4667C>T (p.Pro1556Leu) rs150654627
NM_000260.4(MYO7A):c.468C>T (p.Ile156=) rs12420129
NM_000260.4(MYO7A):c.4695G>A (p.Thr1565=) rs397516313
NM_000260.4(MYO7A):c.4697C>T (p.Thr1566Met) rs41298747
NM_000260.4(MYO7A):c.4698G>A (p.Thr1566=) rs200207753
NM_000260.4(MYO7A):c.470+6C>A rs370905994
NM_000260.4(MYO7A):c.4728G>A (p.Lys1576=) rs758921557
NM_000260.4(MYO7A):c.4732G>A (p.Asp1578Asn)
NM_000260.4(MYO7A):c.4735G>A (p.Glu1579Lys) rs374766654
NM_000260.4(MYO7A):c.4739A>G (p.Tyr1580Cys) rs370232066
NM_000260.4(MYO7A):c.4755C>T (p.Ser1585=) rs7927472
NM_000260.4(MYO7A):c.4757A>G (p.Asn1586Ser) rs201251963
NM_000260.4(MYO7A):c.47T>C (p.Leu16Ser) rs1052030
NM_000260.4(MYO7A):c.4800G>T (p.Gly1600=) rs397516314
NM_000260.4(MYO7A):c.4805G>A (p.Arg1602Gln) rs139889944
NM_000260.4(MYO7A):c.4844C>T (p.Pro1615Leu) rs201321140
NM_000260.4(MYO7A):c.4845C>A (p.Pro1615=) rs61900036
NM_000260.4(MYO7A):c.484G>A (p.Ala162Thr) rs111033485
NM_000260.4(MYO7A):c.4851C>T (p.Pro1617=) rs372535399
NM_000260.4(MYO7A):c.4857C>T (p.Gly1619=)
NM_000260.4(MYO7A):c.486C>T (p.Ala162=) rs367687624
NM_000260.4(MYO7A):c.4910A>G (p.His1637Arg) rs372054499
NM_000260.4(MYO7A):c.4916C>T (p.Thr1639Met) rs200848641
NM_000260.4(MYO7A):c.4927G>A (p.Val1643Ile) rs1591467534
NM_000260.4(MYO7A):c.4950C>T (p.Asn1650=) rs80033599
NM_000260.4(MYO7A):c.4978G>A (p.Gly1660Arg) rs771889662
NM_000260.4(MYO7A):c.4983C>T (p.Asp1661=) rs111033331
NM_000260.4(MYO7A):c.4992C>T (p.Thr1664=) rs181573957
NM_000260.4(MYO7A):c.4996A>T (p.Ser1666Cys) rs2276288
NM_000260.4(MYO7A):c.5043+20C>T rs112969118
NM_000260.4(MYO7A):c.5095C>G (p.Gln1699Glu) rs530520654
NM_000260.4(MYO7A):c.5108C>T (p.Ala1703Val) rs199561332
NM_000260.4(MYO7A):c.510G>A (p.Leu170=) rs34477144
NM_000260.4(MYO7A):c.5115C>T (p.Pro1705=) rs111033411
NM_000260.4(MYO7A):c.5116G>A (p.Glu1706Lys)
NM_000260.4(MYO7A):c.514C>T (p.Leu172=) rs368246776
NM_000260.4(MYO7A):c.5156A>G (p.Tyr1719Cys) rs77625410
NM_000260.4(MYO7A):c.5169-5G>A rs727505232
NM_000260.4(MYO7A):c.5169-6C>T rs768594224
NM_000260.4(MYO7A):c.5172C>G (p.Pro1724=) rs727505004
NM_000260.4(MYO7A):c.5215C>A (p.Arg1739=) rs111033477
NM_000260.4(MYO7A):c.5227C>A (p.Arg1743=) rs111033287
NM_000260.4(MYO7A):c.5227C>T (p.Arg1743Trp) rs111033287
NM_000260.4(MYO7A):c.5243C>T (p.Thr1748Met) rs752373714
NM_000260.4(MYO7A):c.5246G>A (p.Arg1749Gln) rs781537330
NM_000260.4(MYO7A):c.5253G>T (p.Pro1751=) rs377388669
NM_000260.4(MYO7A):c.5259G>A (p.Lys1753=) rs370062187
NM_000260.4(MYO7A):c.5263G>A (p.Ala1755Thr) rs762131185
NM_000260.4(MYO7A):c.5264C>T (p.Ala1755Val) rs574917232
NM_000260.4(MYO7A):c.5324T>C (p.Ile1775Thr) rs115123584
NM_000260.4(MYO7A):c.5326+13C>T rs114157944
NM_000260.4(MYO7A):c.5355G>A (p.Pro1785=) rs372311564
NM_000260.4(MYO7A):c.5356T>A (p.Ser1786Thr) rs374576916
NM_000260.4(MYO7A):c.5373C>T (p.Ser1791=) rs376301325
NM_000260.4(MYO7A):c.5380G>A (p.Glu1794Lys) rs762836180
NM_000260.4(MYO7A):c.5418C>T (p.Ala1806=) rs368749248
NM_000260.4(MYO7A):c.5481-14G>A rs113075052
NM_000260.4(MYO7A):c.5481-15C>T rs727504955
NM_000260.4(MYO7A):c.5486_5487delinsTT (p.Ser1829Ile)
NM_000260.4(MYO7A):c.5487C>T (p.Ser1829=) rs397516318
NM_000260.4(MYO7A):c.548C>T (p.Ser183Leu)
NM_000260.4(MYO7A):c.5494C>T (p.Arg1832Trp) rs748080151
NM_000260.4(MYO7A):c.5495G>A (p.Arg1832Gln) rs372768607
NM_000260.4(MYO7A):c.5497G>C (p.Gly1833Arg) rs1367496020
NM_000260.4(MYO7A):c.5504A>G (p.Glu1835Gly) rs727503331
NM_000260.4(MYO7A):c.5528T>G (p.Leu1843Arg) rs397516319
NM_000260.4(MYO7A):c.5559C>T (p.His1853=) rs373612656
NM_000260.4(MYO7A):c.5598C>A (p.Leu1866=) rs111033504
NM_000260.4(MYO7A):c.5598C>T (p.Leu1866=) rs111033504
NM_000260.4(MYO7A):c.5600C>T (p.Ala1867Val) rs876657914
NM_000260.4(MYO7A):c.5619G>A (p.Arg1873=) rs45450893
NM_000260.4(MYO7A):c.562C>G (p.Gln188Glu) rs572959359
NM_000260.4(MYO7A):c.5641G>A (p.Gly1881Arg) rs373886432
NM_000260.4(MYO7A):c.5665C>T (p.Leu1889=) rs778051833
NM_000260.4(MYO7A):c.5688G>A (p.Gln1896=) rs570316231
NM_000260.4(MYO7A):c.5715A>G (p.Lys1905=) rs2276293
NM_000260.4(MYO7A):c.5743-12T>C rs2276291
NM_000260.4(MYO7A):c.5743-17C>T rs180929855
NM_000260.4(MYO7A):c.5748C>T (p.Phe1916=) rs756514910
NM_000260.4(MYO7A):c.5752G>A (p.Val1918Met) rs958153438
NM_000260.4(MYO7A):c.5824G>A (p.Gly1942Arg) rs111033192
NM_000260.4(MYO7A):c.5835C>T (p.Leu1945=) rs111033476
NM_000260.4(MYO7A):c.5856+50G>A rs2276290
NM_000260.4(MYO7A):c.5857-3C>A rs727505114
NM_000260.4(MYO7A):c.5857-7A>C rs1320703
NM_000260.4(MYO7A):c.5857-7A>T rs1320703
NM_000260.4(MYO7A):c.5860C>A (p.Leu1954Ile) rs948962
NM_000260.4(MYO7A):c.5866G>A (p.Val1956Ile) rs142293185
NM_000260.4(MYO7A):c.5904C>T (p.His1968=) rs41298753
NM_000260.4(MYO7A):c.593-4G>A rs876657534
NM_000260.4(MYO7A):c.593-5C>T rs762666
NM_000260.4(MYO7A):c.5945-4G>A rs372510327
NM_000260.4(MYO7A):c.6013A>G (p.Lys2005Glu) rs186644871
NM_000260.4(MYO7A):c.6025G>A (p.Ala2009Thr) rs397516325
NM_000260.4(MYO7A):c.6027C>T (p.Ala2009=) rs140575390
NM_000260.4(MYO7A):c.6051+17T>A rs1320702
NM_000260.4(MYO7A):c.6052-11G>C rs112564978
NM_000260.4(MYO7A):c.6054G>A (p.Glu2018=) rs1239820996
NM_000260.4(MYO7A):c.6063G>A (p.Lys2021=) rs111033209
NM_000260.4(MYO7A):c.6092G>A (p.Arg2031Gln) rs762258869
NM_000260.4(MYO7A):c.612C>A (p.Thr204=) rs1555062863
NM_000260.4(MYO7A):c.614T>C (p.Ile205Thr) rs200241993
NM_000260.4(MYO7A):c.6165C>T (p.Ser2055=) rs397516327
NM_000260.4(MYO7A):c.6173A>G (p.Lys2058Arg) rs111033336
NM_000260.4(MYO7A):c.617G>A (p.Arg206His) rs781998354
NM_000260.4(MYO7A):c.618C>T (p.Arg206=) rs375851346
NM_000260.4(MYO7A):c.6205A>T (p.Ile2069Phe)
NM_000260.4(MYO7A):c.6209G>A (p.Arg2070Gln) rs397516328
NM_000260.4(MYO7A):c.6214G>A (p.Val2072Ile) rs200313391
NM_000260.4(MYO7A):c.6236G>A (p.Arg2079Gln) rs765083332
NM_000260.4(MYO7A):c.6240C>T (p.Ser2080=) rs41298757
NM_000260.4(MYO7A):c.6243C>A (p.Ile2081=) rs727504834
NM_000260.4(MYO7A):c.6247G>A (p.Ala2083Thr) rs41298759
NM_000260.4(MYO7A):c.6264C>T (p.His2088=) rs188278264
NM_000260.4(MYO7A):c.6267A>G (p.Ala2089=) rs564910239
NM_000260.4(MYO7A):c.6272A>G (p.Lys2091Arg) rs781713344
NM_000260.4(MYO7A):c.6318G>A (p.Lys2106=) rs11237123
NM_000260.4(MYO7A):c.6339C>A (p.Ala2113=) rs764862807
NM_000260.4(MYO7A):c.6345C>T (p.Phe2115=) rs397516329
NM_000260.4(MYO7A):c.6356A>C (p.Gln2119Pro) rs1029122324
NM_000260.4(MYO7A):c.6362C>T (p.Thr2121Met)
NM_000260.4(MYO7A):c.6363G>A (p.Thr2121=) rs367738288
NM_000260.4(MYO7A):c.6384C>T (p.Ile2128=) rs748743374
NM_000260.4(MYO7A):c.639C>T (p.Phe213=) rs540197003
NM_000260.4(MYO7A):c.6424G>A (p.Asp2142Asn) rs1132036
NM_000260.4(MYO7A):c.6438+50A>T rs2276289
NM_000260.4(MYO7A):c.6439-31G>A rs883223
NM_000260.4(MYO7A):c.6475A>G (p.Asn2159Asp) rs1555111106
NM_000260.4(MYO7A):c.6519C>T (p.Asn2173=) rs111033230
NM_000260.4(MYO7A):c.6558+16G>A rs883224
NM_000260.4(MYO7A):c.6558+9G>A rs111033184
NM_000260.4(MYO7A):c.6559-11C>T rs34517202
NM_000260.4(MYO7A):c.6570G>A (p.Met2190Ile) rs376900309
NM_000260.4(MYO7A):c.6577C>T (p.Leu2193Phe) rs397516333
NM_000260.4(MYO7A):c.6614_6634dup (p.Met2205_Ser2211dup) rs111033388
NM_000260.4(MYO7A):c.6615G>A (p.Met2205Ile) rs200359303
NM_000260.4(MYO7A):c.6622C>T (p.Gln2208Ter) rs747095250
NM_000260.4(MYO7A):c.6640G>A (p.Gly2214Ser) rs111033231
NM_000260.4(MYO7A):c.687C>T (p.Gly229=) rs371142158
NM_000260.4(MYO7A):c.689C>T (p.Ala230Val) rs797044512
NM_000260.4(MYO7A):c.72C>T (p.Ile24=) rs397516334
NM_000260.4(MYO7A):c.731G>A (p.Arg244His) rs121965081
NM_000260.4(MYO7A):c.736-15_736-4dup rs111033503
NM_000260.4(MYO7A):c.736-47C>A rs3737454
NM_000260.4(MYO7A):c.758A>G (p.His253Arg) rs375200566
NM_000260.4(MYO7A):c.765C>T (p.Phe255=) rs782702948
NM_000260.4(MYO7A):c.783T>C (p.Gly261=) rs762667
NM_000260.4(MYO7A):c.803A>G (p.Lys268Arg) rs184866544
NM_000260.4(MYO7A):c.849+7C>G rs370740228
NM_000260.4(MYO7A):c.904C>T (p.Arg302Cys) rs781922871
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135
NM_000260.4(MYO7A):c.93C>T (p.Cys31=) rs35689081

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.