ClinVar Miner

List of variants in gene MYO7A

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 1245
Download table as spreadsheet
HGVS dbSNP
GRCh37/hg19 11q13.5(chr11:76895772-76906312)x1
MYO7A, 1-BP INS, EX28
MYO7A, 9-BP DEL, EX22
MYO7A, IVS27AS, G-C, -1
NC_000011.10:g.(?_77166046)_(77177653_?)del
NC_000011.10:g.(?_77208430)_(77211937_?)del
NC_000011.10:g.(?_77212952)_(77214696_?)del
NC_000011.10:g.77147798_77147818dup
NC_000011.10:g.77147798del rs1591224147
NC_000011.10:g.77200615_77206132del
NM_000260.3(MYO7A):c.*546C>T rs115812166
NM_000260.3(MYO7A):c.*560C>T rs35776264
NM_000260.3(MYO7A):c.1556delG (p.Gly519Alafs) rs606231379
NM_000260.3(MYO7A):c.1969C>T rs878853236
NM_000260.3(MYO7A):c.22dup (p.Asp8Glyfs) rs1555051390
NM_000260.3(MYO7A):c.29T>C rs878853237
NM_000260.3(MYO7A):c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG rs111033223
NM_000260.3(MYO7A):c.[1969C>T];[29T>C]
NM_000260.4(MYO7A):c.*100C>T
NM_000260.4(MYO7A):c.*101G>A rs886048683
NM_000260.4(MYO7A):c.*142A>G rs369873505
NM_000260.4(MYO7A):c.*201T>C
NM_000260.4(MYO7A):c.*208C>G rs886048684
NM_000260.4(MYO7A):c.*230A>G rs112830819
NM_000260.4(MYO7A):c.*315C>G
NM_000260.4(MYO7A):c.*363A>C rs115872143
NM_000260.4(MYO7A):c.*38G>A
NM_000260.4(MYO7A):c.*392A>G
NM_000260.4(MYO7A):c.*416C>T
NM_000260.4(MYO7A):c.*440G>A
NM_000260.4(MYO7A):c.*442T>C rs115238711
NM_000260.4(MYO7A):c.*504C>T rs34765389
NM_000260.4(MYO7A):c.*75C>T
NM_000260.4(MYO7A):c.*8C>T rs370206645
NM_000260.4(MYO7A):c.-154G>A rs545774605
NM_000260.4(MYO7A):c.-160G>A rs576789908
NM_000260.4(MYO7A):c.-170C>T rs886048667
NM_000260.4(MYO7A):c.-196C>T rs886048666
NM_000260.4(MYO7A):c.-20G>A rs886048668
NM_000260.4(MYO7A):c.-211A>G rs41298129
NM_000260.4(MYO7A):c.-52C>G
NM_000260.4(MYO7A):c.1003+10C>T rs782382971
NM_000260.4(MYO7A):c.1003+1_1003+33delinsCAGTGCCTTG
NM_000260.4(MYO7A):c.1003+298C>G rs4944144
NM_000260.4(MYO7A):c.1004-32T>C rs782322410
NM_000260.4(MYO7A):c.1004-35C>G rs2071151
NM_000260.4(MYO7A):c.1006C>T (p.Arg336Cys) rs369997614
NM_000260.4(MYO7A):c.1007G>A (p.Arg336His) rs45629132
NM_000260.4(MYO7A):c.102G>A (p.Gly34=) rs782400814
NM_000260.4(MYO7A):c.1040T>C (p.Leu347Pro)
NM_000260.4(MYO7A):c.1046C>A (p.Ser349Tyr) rs782432573
NM_000260.4(MYO7A):c.1049C>T (p.Pro350Leu)
NM_000260.4(MYO7A):c.1052C>A (p.Ser351Ter)
NM_000260.4(MYO7A):c.1053G>A (p.Ser351=) rs187679481
NM_000260.4(MYO7A):c.1056G>A (p.Leu352=) rs886044867
NM_000260.4(MYO7A):c.1058C>T (p.Ala353Val)
NM_000260.4(MYO7A):c.1059C>T (p.Ala353=) rs573947142
NM_000260.4(MYO7A):c.1074del (p.Glu360fs)
NM_000260.4(MYO7A):c.1080+65T>C rs4944145
NM_000260.4(MYO7A):c.1081-7G>A rs782664993
NM_000260.4(MYO7A):c.1085_1086del (p.Asn362fs) rs1591286221
NM_000260.4(MYO7A):c.1091C>A (p.Pro364Gln) rs782441745
NM_000260.4(MYO7A):c.1094A>C (p.Asp365Ala)
NM_000260.4(MYO7A):c.1097T>C (p.Leu366Pro) rs397516281
NM_000260.4(MYO7A):c.1117C>T (p.Arg373Cys) rs868979094
NM_000260.4(MYO7A):c.1123C>G (p.Leu375Val) rs782728522
NM_000260.4(MYO7A):c.1126A>G (p.Ile376Val) rs368716988
NM_000260.4(MYO7A):c.1132C>T (p.Arg378Cys) rs199818783
NM_000260.4(MYO7A):c.1133G>A (p.Arg378His) rs397516282
NM_000260.4(MYO7A):c.1133G>C (p.Arg378Pro) rs397516282
NM_000260.4(MYO7A):c.1134_1146dup (p.Ser383fs) rs1591286671
NM_000260.4(MYO7A):c.1135G>A (p.Gly379Arg) rs878853377
NM_000260.4(MYO7A):c.1138G>A (p.Glu380Lys) rs876657913
NM_000260.4(MYO7A):c.1142C>T (p.Thr381Met) rs782681743
NM_000260.4(MYO7A):c.1168C>T (p.Gln390Ter) rs1555067598
NM_000260.4(MYO7A):c.1172C>T (p.Ala391Val) rs1555067608
NM_000260.4(MYO7A):c.117_132+6del rs1555051567
NM_000260.4(MYO7A):c.1183C>T (p.Arg395Cys) rs782279338
NM_000260.4(MYO7A):c.1184G>A (p.Arg395His) rs387906700
NM_000260.4(MYO7A):c.1186G>A (p.Asp396Asn)
NM_000260.4(MYO7A):c.1188C>T (p.Asp396=) rs781935045
NM_000260.4(MYO7A):c.1189G>A (p.Ala397Thr) rs1297886521
NM_000260.4(MYO7A):c.1190C>A (p.Ala397Asp) rs1555067667
NM_000260.4(MYO7A):c.1195G>A (p.Val399Ile) rs1162724549
NM_000260.4(MYO7A):c.1198_1199dup (p.Gly401fs) rs1591287317
NM_000260.4(MYO7A):c.1200+1G>A rs397516283
NM_000260.4(MYO7A):c.1201-12A>G
NM_000260.4(MYO7A):c.1201-5T>C
NM_000260.4(MYO7A):c.1208A>G (p.Tyr403Cys) rs797044511
NM_000260.4(MYO7A):c.1209C>T (p.Tyr403=) rs782397746
NM_000260.4(MYO7A):c.1213C>T (p.Arg405Trp)
NM_000260.4(MYO7A):c.1221C>T (p.Phe407=) rs782131912
NM_000260.4(MYO7A):c.1232T>C (p.Val411Ala) rs369916141
NM_000260.4(MYO7A):c.1239G>A (p.Lys413=) rs782729773
NM_000260.4(MYO7A):c.1240A>G (p.Ile414Val)
NM_000260.4(MYO7A):c.1242C>T (p.Ile414=) rs886048673
NM_000260.4(MYO7A):c.1258A>T (p.Lys420Ter) rs782539587
NM_000260.4(MYO7A):c.1284C>T (p.Asn428=) rs573454806
NM_000260.4(MYO7A):c.1288C>T (p.Arg430Cys) rs201839693
NM_000260.4(MYO7A):c.1299C>T (p.Ile433=) rs782163200
NM_000260.4(MYO7A):c.132+5G>A rs397516284
NM_000260.4(MYO7A):c.133-14C>T rs116228809
NM_000260.4(MYO7A):c.133-1G>T
NM_000260.4(MYO7A):c.133-2A>C rs782064437
NM_000260.4(MYO7A):c.133-2A>G rs782064437
NM_000260.4(MYO7A):c.133-6C>T rs376963984
NM_000260.4(MYO7A):c.133-7C>T rs111033221
NM_000260.4(MYO7A):c.133-7_146dup rs1555054558
NM_000260.4(MYO7A):c.133G>T (p.Glu45Ter) rs368877140
NM_000260.4(MYO7A):c.1343+1G>A rs914189193
NM_000260.4(MYO7A):c.1343+253C>G rs11605022
NM_000260.4(MYO7A):c.1343+50T>A rs77568474
NM_000260.4(MYO7A):c.1343+5C>T
NM_000260.4(MYO7A):c.1343+7C>T rs782595035
NM_000260.4(MYO7A):c.1343+8G>A rs2276278
NM_000260.4(MYO7A):c.1343+8G>T rs2276278
NM_000260.4(MYO7A):c.1344-2A>G rs111033415
NM_000260.4(MYO7A):c.1344-7C>G rs886048674
NM_000260.4(MYO7A):c.1344-9C>A rs782467233
NM_000260.4(MYO7A):c.1348G>C (p.Glu450Gln) rs1269622956
NM_000260.4(MYO7A):c.1349A>T (p.Glu450Val) rs1555069238
NM_000260.4(MYO7A):c.1353_1360del (p.Gln451fs) rs1555069242
NM_000260.4(MYO7A):c.1354C>T (p.Leu452Phe)
NM_000260.4(MYO7A):c.1358G>A (p.Cys453Tyr) rs202080237
NM_000260.4(MYO7A):c.135_136AC[3] (p.Trp47fs) rs1057519225
NM_000260.4(MYO7A):c.1368C>T (p.Phe456=) rs559209306
NM_000260.4(MYO7A):c.1370C>T (p.Ala457Val) rs111033286
NM_000260.4(MYO7A):c.1373A>T (p.Asn458Ile) rs121965084
NM_000260.4(MYO7A):c.1374T>G (p.Asn458Lys) rs782293740
NM_000260.4(MYO7A):c.13C>T (p.Gln5Ter)
NM_000260.4(MYO7A):c.1401_1403dup (p.His468_Val469insGln) rs111033219
NM_000260.4(MYO7A):c.1403A>G (p.His468Arg) rs200304238
NM_000260.4(MYO7A):c.141G>A (p.Trp47Ter) rs397516285
NM_000260.4(MYO7A):c.1422G>A (p.Gln474=) rs201332147
NM_000260.4(MYO7A):c.1426G>T (p.Glu476Ter)
NM_000260.4(MYO7A):c.1455G>A (p.Leu485=) rs375528761
NM_000260.4(MYO7A):c.1461C>T (p.Ile487=) rs782195221
NM_000260.4(MYO7A):c.1496T>C (p.Ile499Thr) rs397516286
NM_000260.4(MYO7A):c.1506G>A (p.Lys502=) rs181126043
NM_000260.4(MYO7A):c.1522T>C (p.Ser508Pro)
NM_000260.4(MYO7A):c.1530C>T (p.Ile510=) rs746423219
NM_000260.4(MYO7A):c.1543A>C (p.Lys515Gln) rs782023308
NM_000260.4(MYO7A):c.1549C>T (p.Pro517Ser)
NM_000260.4(MYO7A):c.1554+244T>C rs3740763
NM_000260.4(MYO7A):c.1554+7C>T rs150114658
NM_000260.4(MYO7A):c.1554+8G>A rs111033227
NM_000260.4(MYO7A):c.1554G>A (p.Lys518=) rs886048675
NM_000260.4(MYO7A):c.1555-15C>T rs782573211
NM_000260.4(MYO7A):c.1555-5C>T rs569844918
NM_000260.4(MYO7A):c.1555-8C>G rs1057517774
NM_000260.4(MYO7A):c.1556G>A (p.Gly519Asp) rs111033206
NM_000260.4(MYO7A):c.1563del (p.Asp521fs) rs1064794012
NM_000260.4(MYO7A):c.156C>G (p.Asn52Lys) rs886048669
NM_000260.4(MYO7A):c.1574T>G (p.Leu525Ter)
NM_000260.4(MYO7A):c.1575_1592del (p.Ser530_Asn535del) rs1555070062
NM_000260.4(MYO7A):c.1581G>A (p.Lys527=) rs1591299256
NM_000260.4(MYO7A):c.1583T>G (p.Leu528Arg) rs797044492
NM_000260.4(MYO7A):c.1587C>T (p.Asn529=) rs372325609
NM_000260.4(MYO7A):c.1588_1605dup (p.Ser530_Asn535dup) rs1555070084
NM_000260.4(MYO7A):c.1591C>T (p.Gln531Ter) rs781951909
NM_000260.4(MYO7A):c.1595A>G (p.His532Arg)
NM_000260.4(MYO7A):c.1605C>T (p.Asn535=) rs111033228
NM_000260.4(MYO7A):c.1606G>A (p.Ala536Thr) rs201046979
NM_000260.4(MYO7A):c.160A>G (p.Thr54Ala) rs369142107
NM_000260.4(MYO7A):c.1611C>T (p.Asn537=) rs782806743
NM_000260.4(MYO7A):c.1617C>G (p.Ile539Met) rs782450807
NM_000260.4(MYO7A):c.1619C>A (p.Pro540His) rs782607566
NM_000260.4(MYO7A):c.1621C>A (p.Pro541Thr)
NM_000260.4(MYO7A):c.1623C>G (p.Pro541=) rs373327248
NM_000260.4(MYO7A):c.1623del (p.Lys542fs)
NM_000260.4(MYO7A):c.1623dup (p.Lys542fs) rs782077721
NM_000260.4(MYO7A):c.1652T>C (p.Ile551Thr) rs1131691833
NM_000260.4(MYO7A):c.1655A>G (p.Asn552Ser)
NM_000260.4(MYO7A):c.1667G>T (p.Gly556Val) rs527236085
NM_000260.4(MYO7A):c.1690+15C>T rs781801012
NM_000260.4(MYO7A):c.1690+1G>A rs111033389
NM_000260.4(MYO7A):c.1690+262A>G rs7937262
NM_000260.4(MYO7A):c.1690+3A>G
NM_000260.4(MYO7A):c.1690+4C>T
NM_000260.4(MYO7A):c.1690+80C>T rs147468060
NM_000260.4(MYO7A):c.1690+9G>T rs371146074
NM_000260.4(MYO7A):c.1691-126_1691-125insT rs11374303
NM_000260.4(MYO7A):c.1691-2A>G rs1555072299
NM_000260.4(MYO7A):c.1691-4G>A rs200382919
NM_000260.4(MYO7A):c.1708C>T (p.Arg570Ter) rs1591310948
NM_000260.4(MYO7A):c.1710A>G (p.Arg570=) rs782763913
NM_000260.4(MYO7A):c.1719G>T (p.Leu573=)
NM_000260.4(MYO7A):c.1721A>C (p.His574Pro) rs397516287
NM_000260.4(MYO7A):c.1726G>A (p.Asp576Asn) rs187165412
NM_000260.4(MYO7A):c.1771C>T (p.Gln591Ter)
NM_000260.4(MYO7A):c.1797+13C>T
NM_000260.4(MYO7A):c.1797+283T>C rs10736813
NM_000260.4(MYO7A):c.1797+8G>A rs781801358
NM_000260.4(MYO7A):c.1797G>A (p.Met599Ile) rs121965082
NM_000260.4(MYO7A):c.1798-11C>T rs782146561
NM_000260.4(MYO7A):c.1798-15C>T rs115708180
NM_000260.4(MYO7A):c.1798-1G>A rs1555076948
NM_000260.4(MYO7A):c.1798-1G>T rs1555076948
NM_000260.4(MYO7A):c.1798-3C>G rs1555076939
NM_000260.4(MYO7A):c.1798-7_1800delinsATCGGCTGCT
NM_000260.4(MYO7A):c.18+2T>A rs564622720
NM_000260.4(MYO7A):c.1801G>A (p.Ala601Thr) rs782481491
NM_000260.4(MYO7A):c.1814A>G (p.Lys605Arg) rs968552859
NM_000260.4(MYO7A):c.1816C>T (p.Arg606Cys)
NM_000260.4(MYO7A):c.1817G>A (p.Arg606His) rs782311929
NM_000260.4(MYO7A):c.1820C>A (p.Ser607Ter) rs782598897
NM_000260.4(MYO7A):c.1821G>A (p.Ser607=) rs397516288
NM_000260.4(MYO7A):c.182C>G (p.Pro61Arg) rs397516289
NM_000260.4(MYO7A):c.1833_1838dup (p.Gln613_Phe614insHisSer) rs397516290
NM_000260.4(MYO7A):c.1838A>G (p.Gln613Arg) rs1591338772
NM_000260.4(MYO7A):c.183del (p.Thr62fs) rs1446588093
NM_000260.4(MYO7A):c.1845del (p.Lys615fs) rs886037762
NM_000260.4(MYO7A):c.1846C>T (p.Arg616Trp) rs369195493
NM_000260.4(MYO7A):c.1849T>C (p.Ser617Pro) rs782063761
NM_000260.4(MYO7A):c.1852C>G (p.Leu618Val)
NM_000260.4(MYO7A):c.1853T>G (p.Leu618Arg)
NM_000260.4(MYO7A):c.1854G>A (p.Leu618=) rs35429535
NM_000260.4(MYO7A):c.1868G>A (p.Arg623His) rs111033416
NM_000260.4(MYO7A):c.1868G>T (p.Arg623Leu)
NM_000260.4(MYO7A):c.186G>A (p.Thr62=) rs368267301
NM_000260.4(MYO7A):c.1871C>A (p.Thr624Lys) rs953533173
NM_000260.4(MYO7A):c.1871C>T (p.Thr624Met)
NM_000260.4(MYO7A):c.1884C>A (p.Cys628Ter) rs121965083
NM_000260.4(MYO7A):c.1890C>G (p.Pro630=) rs940452289
NM_000260.4(MYO7A):c.1895T>G (p.Phe632Cys)
NM_000260.4(MYO7A):c.19-1G>A rs111033426
NM_000260.4(MYO7A):c.19-2A>G rs1555051384
NM_000260.4(MYO7A):c.19-34G>A rs139571031
NM_000260.4(MYO7A):c.19-3T>C
NM_000260.4(MYO7A):c.19-4A>T rs1267488205
NM_000260.4(MYO7A):c.19-8G>A rs782547470
NM_000260.4(MYO7A):c.19-9C>T rs368452072
NM_000260.4(MYO7A):c.1900C>T (p.Arg634Ter) rs111033180
NM_000260.4(MYO7A):c.1901G>A (p.Arg634Gln) rs781812509
NM_000260.4(MYO7A):c.1903T>C (p.Cys635Arg) rs797044514
NM_000260.4(MYO7A):c.1916A>G (p.Asn639Ser)
NM_000260.4(MYO7A):c.1929G>T (p.Lys643Asn)
NM_000260.4(MYO7A):c.1935+191A>T rs948968
NM_000260.4(MYO7A):c.1935+1G>C rs1343207038
NM_000260.4(MYO7A):c.1935+302C>T rs61900007
NM_000260.4(MYO7A):c.1936-23G>A rs2276283
NM_000260.4(MYO7A):c.1940del (p.Phe647fs)
NM_000260.4(MYO7A):c.1942G>A (p.Asp648Asn)
NM_000260.4(MYO7A):c.1945C>T (p.Arg649Trp) rs782503314
NM_000260.4(MYO7A):c.1952T>C (p.Leu651Pro) rs876657416
NM_000260.4(MYO7A):c.1952_1953insAG (p.Cys652fs) rs111033510
NM_000260.4(MYO7A):c.1956C>T (p.Cys652=) rs367693437
NM_000260.4(MYO7A):c.1960C>T (p.Arg654Cys) rs201928014
NM_000260.4(MYO7A):c.1961G>A (p.Arg654His)
NM_000260.4(MYO7A):c.1963C>T (p.Gln655Ter) rs397516291
NM_000260.4(MYO7A):c.196_210del (p.Gly66_Met70del) rs1555054736
NM_000260.4(MYO7A):c.1970G>A (p.Arg657Gln)
NM_000260.4(MYO7A):c.1976C>A (p.Ser659Ter) rs878853378
NM_000260.4(MYO7A):c.1977del (p.Gly660fs) rs1555078942
NM_000260.4(MYO7A):c.1979G>T (p.Gly660Val)
NM_000260.4(MYO7A):c.1984A>T (p.Met662Leu) rs782485961
NM_000260.4(MYO7A):c.1996C>T (p.Arg666Ter) rs121965085
NM_000260.4(MYO7A):c.1997G>A (p.Arg666Gln) rs782396605
NM_000260.4(MYO7A):c.1997G>C (p.Arg666Pro)
NM_000260.4(MYO7A):c.19G>A (p.Gly7Arg) rs372509310
NM_000260.4(MYO7A):c.1A>G (p.Met1Val) rs797044518
NM_000260.4(MYO7A):c.2002C>T (p.Arg668Cys) rs397516292
NM_000260.4(MYO7A):c.2003G>A (p.Arg668His)
NM_000260.4(MYO7A):c.2005C>T (p.Arg669Ter) rs111033201
NM_000260.4(MYO7A):c.2006G>A (p.Arg669Gln) rs201178011
NM_000260.4(MYO7A):c.2011G>A (p.Gly671Ser) rs387906699
NM_000260.4(MYO7A):c.2019del (p.Ile674fs)
NM_000260.4(MYO7A):c.2023C>T (p.Arg675Cys) rs782459520
NM_000260.4(MYO7A):c.2025C>T (p.Arg675=) rs797044658
NM_000260.4(MYO7A):c.2035G>A (p.Val679Ile) rs35641839
NM_000260.4(MYO7A):c.2039A>G (p.Glu680Gly) rs1555079057
NM_000260.4(MYO7A):c.2056C>T (p.Arg686Cys) rs782364394
NM_000260.4(MYO7A):c.2057G>A (p.Arg686His) rs781991817
NM_000260.4(MYO7A):c.2081C>T (p.Pro694Leu) rs200057810
NM_000260.4(MYO7A):c.2088C>T (p.Tyr696=) rs781964494
NM_000260.4(MYO7A):c.2091G>A (p.Lys697=) rs768972429
NM_000260.4(MYO7A):c.2094+1G>A rs111033404
NM_000260.4(MYO7A):c.2094+1G>C rs111033404
NM_000260.4(MYO7A):c.2094+8G>A rs781886473
NM_000260.4(MYO7A):c.2095-4C>G rs763060756
NM_000260.4(MYO7A):c.2097C>T (p.Gly699=) rs373495082
NM_000260.4(MYO7A):c.20G>T (p.Gly7Val) rs781989117
NM_000260.4(MYO7A):c.2106C>T (p.Arg702=) rs369787754
NM_000260.4(MYO7A):c.2107G>A (p.Gly703Arg) rs572300575
NM_000260.4(MYO7A):c.2115C>A (p.Cys705Ter) rs782255281
NM_000260.4(MYO7A):c.2116C>T (p.Gln706Ter)
NM_000260.4(MYO7A):c.2120G>A (p.Arg707His)
NM_000260.4(MYO7A):c.2120G>C (p.Arg707Pro)
NM_000260.4(MYO7A):c.2122A>G (p.Met708Val) rs397516293
NM_000260.4(MYO7A):c.2146C>G (p.His716Asp) rs886048676
NM_000260.4(MYO7A):c.215G>T (p.Arg72Leu) rs886048670
NM_000260.4(MYO7A):c.2172C>T (p.Thr724=) rs781809036
NM_000260.4(MYO7A):c.2172del (p.Lys725fs) rs397516294
NM_000260.4(MYO7A):c.2181T>C (p.Phe727=) rs373656667
NM_000260.4(MYO7A):c.2187+1G>A rs111033290
NM_000260.4(MYO7A):c.2187+1G>T rs111033290
NM_000260.4(MYO7A):c.2187+208G>A rs11237106
NM_000260.4(MYO7A):c.218T>C (p.Leu73Pro) rs372188355
NM_000260.4(MYO7A):c.2208G>A (p.Leu736=) rs373599360
NM_000260.4(MYO7A):c.2218C>T (p.Arg740Trp) rs201234369
NM_000260.4(MYO7A):c.2219G>C (p.Arg740Pro) rs782276748
NM_000260.4(MYO7A):c.2225A>T (p.Lys742Ile)
NM_000260.4(MYO7A):c.2236G>A (p.Asp746Asn) rs36090425
NM_000260.4(MYO7A):c.2239_2240AG[1] (p.Arg747fs) rs1555080760
NM_000260.4(MYO7A):c.223del (p.Asp75fs) rs876657415
NM_000260.4(MYO7A):c.2248C>T (p.Leu750Phe) rs1224881006
NM_000260.4(MYO7A):c.224dup (p.Asp75fs) rs1224819887
NM_000260.4(MYO7A):c.225C>A (p.Asp75Glu) rs782757893
NM_000260.4(MYO7A):c.2266C>T (p.Arg756Trp) rs782174733
NM_000260.4(MYO7A):c.2267G>A (p.Arg756Gln)
NM_000260.4(MYO7A):c.2282+1G>C rs1565397890
NM_000260.4(MYO7A):c.2282+5G>A rs540145750
NM_000260.4(MYO7A):c.2283-1G>T rs397516295
NM_000260.4(MYO7A):c.2283-2_2293del rs1555082041
NM_000260.4(MYO7A):c.2283G>A (p.Arg761=) rs111033229
NM_000260.4(MYO7A):c.2287A>C (p.Asn763His)
NM_000260.4(MYO7A):c.2288_2292delinsCA (p.Asn763_Phe764delinsThr)
NM_000260.4(MYO7A):c.2293C>A (p.Leu765Met) rs201203036
NM_000260.4(MYO7A):c.2302A>T (p.Lys768Ter)
NM_000260.4(MYO7A):c.2307del (p.Asn769fs) rs1060499800
NM_000260.4(MYO7A):c.2308G>A (p.Ala770Thr) rs375253473
NM_000260.4(MYO7A):c.2311G>T (p.Ala771Ser) rs782384464
NM_000260.4(MYO7A):c.2316A>G (p.Thr772=) rs369466539
NM_000260.4(MYO7A):c.2323C>T (p.Gln775Ter) rs201892914
NM_000260.4(MYO7A):c.2339del (p.Gly780fs) rs1565402473
NM_000260.4(MYO7A):c.2340T>G (p.Gly780=) rs782747237
NM_000260.4(MYO7A):c.2348G>A (p.Cys783Tyr) rs376014415
NM_000260.4(MYO7A):c.2355del (p.Asn786fs) rs1591369118
NM_000260.4(MYO7A):c.2361C>A (p.Tyr787Ter) rs1555082145
NM_000260.4(MYO7A):c.2362G>A (p.Gly788Arg)
NM_000260.4(MYO7A):c.2367+225T>C rs12577334
NM_000260.4(MYO7A):c.2367+269A>G rs10899356
NM_000260.4(MYO7A):c.2367+67T>C rs10793239
NM_000260.4(MYO7A):c.2372G>A (p.Arg791His) rs782693893
NM_000260.4(MYO7A):c.2382C>T (p.Phe794=) rs970183279
NM_000260.4(MYO7A):c.2386C>G (p.Arg796Gly) rs111033339
NM_000260.4(MYO7A):c.2386C>T (p.Arg796Trp) rs111033339
NM_000260.4(MYO7A):c.2387G>A (p.Arg796Gln) rs111033224
NM_000260.4(MYO7A):c.239G>A (p.Gly80Asp) rs376796087
NM_000260.4(MYO7A):c.2404C>T (p.Arg802Cys)
NM_000260.4(MYO7A):c.2410C>T (p.Arg804Trp)
NM_000260.4(MYO7A):c.2411G>A (p.Arg804Gln) rs561347333
NM_000260.4(MYO7A):c.2421C>T (p.His807=) rs782218928
NM_000260.4(MYO7A):c.2427G>T (p.Gln809His) rs782650544
NM_000260.4(MYO7A):c.2446C>T (p.Arg816Cys)
NM_000260.4(MYO7A):c.2447G>A (p.Arg816His) rs148343670
NM_000260.4(MYO7A):c.2461C>T (p.Gln821Ter) rs1279918132
NM_000260.4(MYO7A):c.2464G>C (p.Ala822Pro)
NM_000260.4(MYO7A):c.2467C>T (p.Arg823Cys)
NM_000260.4(MYO7A):c.2468G>C (p.Arg823Pro)
NM_000260.4(MYO7A):c.2473C>T (p.Arg825Cys)
NM_000260.4(MYO7A):c.2475C>T (p.Arg825=) rs782711428
NM_000260.4(MYO7A):c.2476G>A (p.Ala826Thr) rs368341987
NM_000260.4(MYO7A):c.247C>A (p.Arg83Ser) rs781790246
NM_000260.4(MYO7A):c.2488C>T (p.Arg830Cys) rs797044493
NM_000260.4(MYO7A):c.2489G>A (p.Arg830His) rs371029653
NM_000260.4(MYO7A):c.2500C>T (p.Arg834Cys)
NM_000260.4(MYO7A):c.2506C>T (p.Arg836Cys) rs375510570
NM_000260.4(MYO7A):c.2507G>A (p.Arg836His) rs782179888
NM_000260.4(MYO7A):c.2522T>C (p.Leu841Pro) rs397516296
NM_000260.4(MYO7A):c.2526C>T (p.Thr842=) rs782594184
NM_000260.4(MYO7A):c.2527G>A (p.Val843Met) rs140559111
NM_000260.4(MYO7A):c.254T>C (p.Leu85Pro)
NM_000260.4(MYO7A):c.2553C>T (p.Ile851=) rs986413500
NM_000260.4(MYO7A):c.2558G>A (p.Arg853His) rs111033437
NM_000260.4(MYO7A):c.2558G>T (p.Arg853Leu) rs111033437
NM_000260.4(MYO7A):c.2572C>T (p.Arg858Cys) rs797044681
NM_000260.4(MYO7A):c.2587-14C>T rs180774455
NM_000260.4(MYO7A):c.2597G>A (p.Arg866His) rs199607235
NM_000260.4(MYO7A):c.2598C>T (p.Arg866=)
NM_000260.4(MYO7A):c.2601C>T (p.Leu867=) rs782554940
NM_000260.4(MYO7A):c.2617C>T (p.Arg873Trp) rs200454015
NM_000260.4(MYO7A):c.2618G>A (p.Arg873Gln) rs1052032
NM_000260.4(MYO7A):c.2625G>A (p.Ala875=) rs375489617
NM_000260.4(MYO7A):c.2636A>C (p.Lys879Thr) rs1591374351
NM_000260.4(MYO7A):c.2656G>A (p.Ala886Thr)
NM_000260.4(MYO7A):c.2679C>T (p.Ala893=) rs782279442
NM_000260.4(MYO7A):c.2680G>A (p.Glu894Lys)
NM_000260.4(MYO7A):c.268C>T (p.Arg90Trp) rs781834630
NM_000260.4(MYO7A):c.2694+134A>G rs1109162
NM_000260.4(MYO7A):c.2694+1G>A
NM_000260.4(MYO7A):c.2694+58G>A rs1109163
NM_000260.4(MYO7A):c.2695-58C>G rs3740762
NM_000260.4(MYO7A):c.2695-6G>A rs1591377741
NM_000260.4(MYO7A):c.2697G>A (p.Glu899=) rs782531164
NM_000260.4(MYO7A):c.2707C>T (p.Gln903Ter)
NM_000260.4(MYO7A):c.2717G>A (p.Arg906His)
NM_000260.4(MYO7A):c.2717G>T (p.Arg906Leu)
NM_000260.4(MYO7A):c.2724C>G (p.Asp908Glu) rs199979876
NM_000260.4(MYO7A):c.2724C>T (p.Asp908=) rs199979876
NM_000260.4(MYO7A):c.2750del (p.Glu917fs) rs1591378140
NM_000260.4(MYO7A):c.2754C>T (p.Ala918=) rs78072361
NM_000260.4(MYO7A):c.2755G>A (p.Ala919Thr)
NM_000260.4(MYO7A):c.2758C>G (p.Arg920Gly)
NM_000260.4(MYO7A):c.2759G>A (p.Arg920Gln) rs565162134
NM_000260.4(MYO7A):c.2759G>T (p.Arg920Leu) rs565162134
NM_000260.4(MYO7A):c.2761C>T (p.Arg921Trp)
NM_000260.4(MYO7A):c.2762G>A (p.Arg921Gln)
NM_000260.4(MYO7A):c.2764AAG[1] (p.Lys923del)
NM_000260.4(MYO7A):c.2787G>A (p.Met929Ile)
NM_000260.4(MYO7A):c.2798G>A (p.Arg933His) rs201489714
NM_000260.4(MYO7A):c.2827G>A (p.Val943Met) rs782008236
NM_000260.4(MYO7A):c.2829G>A (p.Val943=) rs797044494
NM_000260.4(MYO7A):c.2836A>C (p.Met946Leu) rs1357072694
NM_000260.4(MYO7A):c.2837T>G (p.Met946Arg) rs1296612982
NM_000260.4(MYO7A):c.2838del (p.Met946fs)
NM_000260.4(MYO7A):c.2847C>T (p.Phe949=) rs1555084293
NM_000260.4(MYO7A):c.284A>T (p.Tyr95Phe) rs797044489
NM_000260.4(MYO7A):c.285+14C>G rs876657532
NM_000260.4(MYO7A):c.285+1G>C rs782661097
NM_000260.4(MYO7A):c.285+2T>C rs782292032
NM_000260.4(MYO7A):c.285+2T>G rs782292032
NM_000260.4(MYO7A):c.2850G>A (p.Leu950=) rs397516297
NM_000260.4(MYO7A):c.285C>A (p.Tyr95Ter)
NM_000260.4(MYO7A):c.286-4G>A rs782708856
NM_000260.4(MYO7A):c.286-5C>T rs111033471
NM_000260.4(MYO7A):c.2863G>A (p.Gly955Ser) rs781988557
NM_000260.4(MYO7A):c.2868G>A (p.Leu956=) rs1591378680
NM_000260.4(MYO7A):c.2878G>T (p.Glu960Ter) rs782131913
NM_000260.4(MYO7A):c.287C>T (p.Thr96Met) rs781811444
NM_000260.4(MYO7A):c.2882G>A (p.Gly961Asp) rs199575418
NM_000260.4(MYO7A):c.2886G>C (p.Gln962His) rs200641606
NM_000260.4(MYO7A):c.288G>A (p.Thr96=) rs56023295
NM_000260.4(MYO7A):c.288G>T (p.Thr96=) rs56023295
NM_000260.4(MYO7A):c.2904G>A (p.Glu968=) rs111033233
NM_000260.4(MYO7A):c.2904G>T (p.Glu968Asp) rs111033233
NM_000260.4(MYO7A):c.2905-1G>A rs1171417339
NM_000260.4(MYO7A):c.2905-1G>C
NM_000260.4(MYO7A):c.2905-54A>G rs7117606
NM_000260.4(MYO7A):c.2914C>T (p.Arg972Ter)
NM_000260.4(MYO7A):c.2919G>A (p.Gly973=) rs1555084786
NM_000260.4(MYO7A):c.2920C>T (p.Arg974Trp)
NM_000260.4(MYO7A):c.2928G>A (p.Glu976=) rs372223659
NM_000260.4(MYO7A):c.2960C>T (p.Pro987Leu) rs397516298
NM_000260.4(MYO7A):c.2961C>G (p.Pro987=) rs1591381599
NM_000260.4(MYO7A):c.3012C>T (p.Phe1004=) rs544100095
NM_000260.4(MYO7A):c.3014C>T (p.Ala1005Val) rs113326082
NM_000260.4(MYO7A):c.3028_3029insTACACCCGGTTGTCC (p.Gln1010_Gly1011insLeuHisProValVal) rs782367511
NM_000260.4(MYO7A):c.3036A>G (p.Thr1012=) rs111033251
NM_000260.4(MYO7A):c.3038C>T (p.Thr1013Ile) rs369539923
NM_000260.4(MYO7A):c.3042G>T (p.Thr1014=) rs111033507
NM_000260.4(MYO7A):c.3049_3051del (p.Tyr1017del) rs1180304045
NM_000260.4(MYO7A):c.3055C>T (p.Arg1019Trp)
NM_000260.4(MYO7A):c.3056G>A (p.Arg1019Gln)
NM_000260.4(MYO7A):c.3064_3067del (p.Leu1022fs) rs1064796130
NM_000260.4(MYO7A):c.3086A>G (p.His1029Arg) rs60103800
NM_000260.4(MYO7A):c.3090C>A (p.Asp1030Glu)
NM_000260.4(MYO7A):c.3093C>T (p.Asp1031=) rs990625976
NM_000260.4(MYO7A):c.3109-13_3109-12insTCTGGCCTCTGACATGTGCGC rs869312123
NM_000260.4(MYO7A):c.3109-15C>T
NM_000260.4(MYO7A):c.3109-27_3109-7dup rs1555085333
NM_000260.4(MYO7A):c.3109-68G>A rs2276287
NM_000260.4(MYO7A):c.3120G>A (p.Ala1040=) rs782029820
NM_000260.4(MYO7A):c.3134T>C (p.Ile1045Thr) rs377326213
NM_000260.4(MYO7A):c.313del (p.Ala104_Val105insTer) rs1555061466
NM_000260.4(MYO7A):c.3143del (p.Phe1048fs)
NM_000260.4(MYO7A):c.314T>G (p.Val105Gly) rs876657654
NM_000260.4(MYO7A):c.3157C>T (p.Pro1053Ser) rs370104824
NM_000260.4(MYO7A):c.318C>G (p.Asn106Lys) rs1555061483
NM_000260.4(MYO7A):c.3215C>T (p.Thr1072Ile)
NM_000260.4(MYO7A):c.321_322insA (p.Tyr108fs) rs1324244950
NM_000260.4(MYO7A):c.3246G>A (p.Thr1082=) rs35963362
NM_000260.4(MYO7A):c.324C>A (p.Tyr108Ter) rs116892396
NM_000260.4(MYO7A):c.324C>T (p.Tyr108=) rs116892396
NM_000260.4(MYO7A):c.3260T>C (p.Leu1087Pro) rs375050157
NM_000260.4(MYO7A):c.3262C>T (p.Gln1088Ter) rs376535635
NM_000260.4(MYO7A):c.3270G>A (p.Leu1090=) rs370305347
NM_000260.4(MYO7A):c.3283G>A (p.Glu1095Lys) rs199810429
NM_000260.4(MYO7A):c.3291G>A (p.Gln1097=) rs561459113
NM_000260.4(MYO7A):c.3297C>T (p.Pro1099=) rs367668576
NM_000260.4(MYO7A):c.3298G>T (p.Glu1100Ter) rs782468194
NM_000260.4(MYO7A):c.3310A>T (p.Lys1104Ter) rs1555085978
NM_000260.4(MYO7A):c.3327del (p.His1109fs) rs111033433
NM_000260.4(MYO7A):c.3330G>C (p.Lys1110Asn)
NM_000260.4(MYO7A):c.3364C>A (p.Leu1122Ile) rs192378817
NM_000260.4(MYO7A):c.3369A>G (p.Thr1123=) rs1555086045
NM_000260.4(MYO7A):c.3375+12C>T
NM_000260.4(MYO7A):c.3375+14C>A rs782500012
NM_000260.4(MYO7A):c.3375+33G>C rs948972
NM_000260.4(MYO7A):c.3375+3G>A rs397516299
NM_000260.4(MYO7A):c.3384G>C (p.Lys1128Asn) rs372050452
NM_000260.4(MYO7A):c.338_348dup (p.Glu117fs) rs1064793208
NM_000260.4(MYO7A):c.3396C>T (p.Asp1132=) rs543234546
NM_000260.4(MYO7A):c.3397G>A (p.Gly1133Arg) rs782313913
NM_000260.4(MYO7A):c.3404C>A (p.Ser1135Tyr) rs376688581
NM_000260.4(MYO7A):c.3415G>A (p.Gly1139Ser) rs200840044
NM_000260.4(MYO7A):c.3424A>G (p.Met1142Val)
NM_000260.4(MYO7A):c.3437G>A (p.Arg1146Gln) rs782140421
NM_000260.4(MYO7A):c.3438G>A (p.Arg1146=) rs782818565
NM_000260.4(MYO7A):c.3451C>G (p.Leu1151Val) rs782465732
NM_000260.4(MYO7A):c.3469A>G (p.Ile1157Val) rs397516300
NM_000260.4(MYO7A):c.3472A>G (p.Ile1158Val) rs797044517
NM_000260.4(MYO7A):c.3474C>T (p.Ile1158=) rs201834743
NM_000260.4(MYO7A):c.3476G>T (p.Gly1159Val) rs199897298
NM_000260.4(MYO7A):c.3489G>A (p.Leu1163=) rs1555087287
NM_000260.4(MYO7A):c.3490C>T (p.Arg1164Trp)
NM_000260.4(MYO7A):c.3491G>A (p.Arg1164Gln) rs782350886
NM_000260.4(MYO7A):c.3502C>T (p.Arg1168Trp) rs554073390
NM_000260.4(MYO7A):c.3503+12G>A rs78509218
NM_000260.4(MYO7A):c.3503+17G>A rs369969967
NM_000260.4(MYO7A):c.3503+9C>T rs1481745974
NM_000260.4(MYO7A):c.3503G>A (p.Arg1168Gln) rs797044516
NM_000260.4(MYO7A):c.3504-122G>A rs12792197
NM_000260.4(MYO7A):c.3504-1G>C rs1555090171
NM_000260.4(MYO7A):c.3504-2A>G rs1555090168
NM_000260.4(MYO7A):c.3504-311G>A rs2186659
NM_000260.4(MYO7A):c.3507C>T (p.Asp1169=) rs782788403
NM_000260.4(MYO7A):c.3508G>A (p.Glu1170Lys) rs111033214
NM_000260.4(MYO7A):c.351G>T (p.Glu117Asp) rs886048671
NM_000260.4(MYO7A):c.3527G>A (p.Ser1176Asn) rs373147966
NM_000260.4(MYO7A):c.3532del (p.Gln1178fs) rs111033239
NM_000260.4(MYO7A):c.3533A>C (p.Gln1178Pro) rs111033482
NM_000260.4(MYO7A):c.3536T>A (p.Leu1179Gln) rs199918940
NM_000260.4(MYO7A):c.3541_3542CA[3] (p.Asn1182fs) rs111033390
NM_000260.4(MYO7A):c.3546C>A (p.Asn1182Lys) rs1555090294
NM_000260.4(MYO7A):c.3546C>T (p.Asn1182=) rs1555090294
NM_000260.4(MYO7A):c.3555G>A (p.Lys1185=) rs569204833
NM_000260.4(MYO7A):c.3560G>T (p.Ser1187Ile) rs1555090314
NM_000260.4(MYO7A):c.3564_3571delinsA (p.Tyr1188_Gly1191delinsTer) rs797044513
NM_000260.4(MYO7A):c.3568C>T (p.Arg1190Trp)
NM_000260.4(MYO7A):c.3570G>T (p.Arg1190=) rs1555090354
NM_000260.4(MYO7A):c.3572G>A (p.Gly1191Asp) rs397516301
NM_000260.4(MYO7A):c.3576G>A (p.Trp1192Ter) rs1253943370
NM_000260.4(MYO7A):c.3582C>T (p.Leu1194=) rs886044828
NM_000260.4(MYO7A):c.3583G>A (p.Val1195Met) rs781958107
NM_000260.4(MYO7A):c.3587C>A (p.Ser1196Tyr)
NM_000260.4(MYO7A):c.3587_3588CT[2] (p.Cys1198fs) rs1555090368
NM_000260.4(MYO7A):c.358C>A (p.Arg120Ser) rs397516302
NM_000260.4(MYO7A):c.3590T>C (p.Leu1197Pro) rs1565430886
NM_000260.4(MYO7A):c.3594C>A (p.Cys1198Ter) rs782694195
NM_000260.4(MYO7A):c.3594C>T (p.Cys1198=)
NM_000260.4(MYO7A):c.3595G>A (p.Val1199Met) rs782151104
NM_000260.4(MYO7A):c.359G>A (p.Arg120His) rs369493667
NM_000260.4(MYO7A):c.3602G>A (p.Cys1201Tyr) rs117966637
NM_000260.4(MYO7A):c.3602G>C (p.Cys1201Ser) rs117966637
NM_000260.4(MYO7A):c.3607G>T (p.Ala1203Ser)
NM_000260.4(MYO7A):c.3610C>A (p.Pro1204Thr) rs1555090442
NM_000260.4(MYO7A):c.3616G>A (p.Glu1206Lys)
NM_000260.4(MYO7A):c.3628A>T (p.Lys1210Ter) rs878853376
NM_000260.4(MYO7A):c.3630+7A>G rs373958166
NM_000260.4(MYO7A):c.3631-1G>C rs1555090885
NM_000260.4(MYO7A):c.3638G>A (p.Arg1213Gln)
NM_000260.4(MYO7A):c.3651C>T (p.His1217=) rs776731918
NM_000260.4(MYO7A):c.3652G>A (p.Gly1218Arg) rs111033195
NM_000260.4(MYO7A):c.3656G>T (p.Gly1219Val) rs1555090958
NM_000260.4(MYO7A):c.3659C>T (p.Pro1220Leu) rs727504710
NM_000260.4(MYO7A):c.3660G>A (p.Pro1220=) rs751497005
NM_000260.4(MYO7A):c.3662C>G (p.Pro1221Arg) rs780594308
NM_000260.4(MYO7A):c.3669C>T (p.Tyr1223=) rs727504631
NM_000260.4(MYO7A):c.3688C>T (p.Arg1230Cys)
NM_000260.4(MYO7A):c.3689G>A (p.Arg1230His) rs368705036
NM_000260.4(MYO7A):c.3696_3706del (p.Arg1232fs) rs397516303
NM_000260.4(MYO7A):c.3701C>G (p.Thr1234Ser) rs775908821
NM_000260.4(MYO7A):c.3702C>G (p.Thr1234=) rs77299211
NM_000260.4(MYO7A):c.3718C>T (p.Arg1240Trp)
NM_000260.4(MYO7A):c.3719G>A (p.Arg1240Gln) rs111033178
NM_000260.4(MYO7A):c.3723A>T (p.Thr1241=) rs767426033
NM_000260.4(MYO7A):c.3724C>T (p.Gln1242Ter) rs1057517857
NM_000260.4(MYO7A):c.3728C>G (p.Pro1243Arg) rs750358148
NM_000260.4(MYO7A):c.3728C>T (p.Pro1243Leu) rs750358148
NM_000260.4(MYO7A):c.3728dup (p.Pro1244fs) rs397516304
NM_000260.4(MYO7A):c.3729G>A (p.Pro1243=) rs727504023
NM_000260.4(MYO7A):c.3729dup (p.Pro1244fs)
NM_000260.4(MYO7A):c.3750+15_3750+38del rs769297324
NM_000260.4(MYO7A):c.3750+20C>T
NM_000260.4(MYO7A):c.3750+4C>T
NM_000260.4(MYO7A):c.3750+5G>A rs111033391
NM_000260.4(MYO7A):c.3750+7G>A rs397516305
NM_000260.4(MYO7A):c.3750+89C>T rs2276286
NM_000260.4(MYO7A):c.3750+8C>T
NM_000260.4(MYO7A):c.3750+9G>A rs111033252
NM_000260.4(MYO7A):c.3751-119_3751-118insGCTGGGGCCTGGAGC rs55637648
NM_000260.4(MYO7A):c.3751-14T>C
NM_000260.4(MYO7A):c.3751-94C>G rs7947922
NM_000260.4(MYO7A):c.3764del (p.Lys1255fs) rs111033347
NM_000260.4(MYO7A):c.3783C>T (p.Pro1261=) rs754599732
NM_000260.4(MYO7A):c.3784G>A (p.Val1262Met)
NM_000260.4(MYO7A):c.3795G>A (p.Met1265Ile)
NM_000260.4(MYO7A):c.3797A>G (p.Asp1266Gly) rs781670345
NM_000260.4(MYO7A):c.37G>C (p.Asp13His)
NM_000260.4(MYO7A):c.380T>C (p.Ile127Thr) rs41298131
NM_000260.4(MYO7A):c.3815_3822del (p.Leu1272fs) rs1555091636
NM_000260.4(MYO7A):c.3827C>T (p.Ser1276Leu) rs369458838
NM_000260.4(MYO7A):c.3828G>A (p.Ser1276=) rs78871677
NM_000260.4(MYO7A):c.3836C>T (p.Thr1279Met) rs766245260
NM_000260.4(MYO7A):c.3844G>C (p.Glu1282Gln)
NM_000260.4(MYO7A):c.3856G>A (p.Ala1286Thr) rs727503328
NM_000260.4(MYO7A):c.3858G>A (p.Ala1286=) rs372623270
NM_000260.4(MYO7A):c.385G>T (p.Glu129Ter)
NM_000260.4(MYO7A):c.3862G>C (p.Ala1288Pro)
NM_000260.4(MYO7A):c.3862G>T (p.Ala1288Ser)
NM_000260.4(MYO7A):c.3864C>T (p.Ala1288=) rs144657938
NM_000260.4(MYO7A):c.3865G>A (p.Asp1289Asn)
NM_000260.4(MYO7A):c.3872_3873TC[3] (p.Leu1293fs) rs760251968
NM_000260.4(MYO7A):c.3887G>A (p.Arg1296Gln)
NM_000260.4(MYO7A):c.388A>G (p.Met130Val) rs782473441
NM_000260.4(MYO7A):c.3892G>A (p.Gly1298Arg) rs727503329
NM_000260.4(MYO7A):c.3924+109G>A rs4944148
NM_000260.4(MYO7A):c.3924+10CCCGGAAGCACCTCCT[3] rs759572835
NM_000260.4(MYO7A):c.3924+12C>T rs2276285
NM_000260.4(MYO7A):c.3924+1G>C rs1226046110
NM_000260.4(MYO7A):c.3924+8C>T rs565801140
NM_000260.4(MYO7A):c.3924G>A (p.Lys1308=) rs1349274983
NM_000260.4(MYO7A):c.3925-169C>T rs7952285
NM_000260.4(MYO7A):c.3925-243A>G rs7938356
NM_000260.4(MYO7A):c.3925-8G>A rs367645097
NM_000260.4(MYO7A):c.3925-93C>G rs1944034
NM_000260.4(MYO7A):c.3927G>T (p.Val1309=) rs181729570
NM_000260.4(MYO7A):c.392C>T (p.Pro131Leu) rs1555061692
NM_000260.4(MYO7A):c.3943G>A (p.Gly1315Ser) rs769771981
NM_000260.4(MYO7A):c.3944_3945dup (p.Ser1316fs)
NM_000260.4(MYO7A):c.394C>T (p.Pro132Ser)
NM_000260.4(MYO7A):c.3954C>T (p.His1318=) rs749218462
NM_000260.4(MYO7A):c.3957dup (p.Met1320fs)
NM_000260.4(MYO7A):c.3963C>T (p.Asp1321=) rs376777290
NM_000260.4(MYO7A):c.3978C>T (p.Cys1326=) rs111033376
NM_000260.4(MYO7A):c.3979G>A (p.Glu1327Lys) rs373169422
NM_000260.4(MYO7A):c.397C>A (p.His133Asn) rs111033403
NM_000260.4(MYO7A):c.397C>G (p.His133Asp) rs111033403
NM_000260.4(MYO7A):c.397C>T (p.His133Tyr) rs111033403
NM_000260.4(MYO7A):c.397del (p.His133fs)
NM_000260.4(MYO7A):c.397dup (p.His133fs) rs111033187
NM_000260.4(MYO7A):c.3987C>T (p.Tyr1329=) rs560284703
NM_000260.4(MYO7A):c.398A>C (p.His133Pro) rs886044805
NM_000260.4(MYO7A):c.3998_4012del (p.Gln1333_Glu1337del) rs1555092931
NM_000260.4(MYO7A):c.39C>A (p.Asp13Glu) rs199989979
NM_000260.4(MYO7A):c.3G>A (p.Met1Ile) rs782787126
NM_000260.4(MYO7A):c.4003G>A (p.Ala1335Thr)
NM_000260.4(MYO7A):c.4006C>T (p.Gln1336Ter) rs750647872
NM_000260.4(MYO7A):c.4018G>A (p.Ala1340Thr) rs376291076
NM_000260.4(MYO7A):c.4018delinsCC (p.Ala1340fs) rs1555092993
NM_000260.4(MYO7A):c.401T>A (p.Ile134Asn) rs111033181
NM_000260.4(MYO7A):c.401T>C (p.Ile134Thr) rs111033181
NM_000260.4(MYO7A):c.4023C>T (p.Pro1341=) rs73495790
NM_000260.4(MYO7A):c.4024del (p.Trp1342fs) rs1555093028
NM_000260.4(MYO7A):c.4029G>C (p.Arg1343Ser) rs763469001
NM_000260.4(MYO7A):c.4033_4035TTC[1] (p.Phe1346del) rs1437625274
NM_000260.4(MYO7A):c.4037T>C (p.Phe1346Ser) rs767615975
NM_000260.4(MYO7A):c.4039C>A (p.Arg1347Ser) rs111534474
NM_000260.4(MYO7A):c.4039C>T (p.Arg1347Cys) rs111534474
NM_000260.4(MYO7A):c.4040G>A (p.Arg1347His)
NM_000260.4(MYO7A):c.4051T>C (p.Phe1351Leu)
NM_000260.4(MYO7A):c.4065del (p.His1355fs) rs111033202
NM_000260.4(MYO7A):c.4066A>T (p.Ser1356Cys) rs201195495
NM_000260.4(MYO7A):c.4074C>T (p.Ser1358=) rs78996818
NM_000260.4(MYO7A):c.4074del (p.Glu1359fs) rs754104546
NM_000260.4(MYO7A):c.4083C>T (p.Asn1361=) rs769001697
NM_000260.4(MYO7A):c.4084G>A (p.Val1362Met) rs774773009
NM_000260.4(MYO7A):c.4105C>T (p.Gln1369Ter) rs1565440205
NM_000260.4(MYO7A):c.4107G>T (p.Gln1369His) rs1565440220
NM_000260.4(MYO7A):c.4108_4111del (p.Gln1370fs) rs1480697910
NM_000260.4(MYO7A):c.4115T>G (p.Val1372Gly) rs869312181
NM_000260.4(MYO7A):c.4117C>T (p.Arg1373Ter) rs766641715
NM_000260.4(MYO7A):c.4118G>A (p.Arg1373Gln) rs886048677
NM_000260.4(MYO7A):c.4118G>C (p.Arg1373Pro)
NM_000260.4(MYO7A):c.4128G>C (p.Lys1376Asn)
NM_000260.4(MYO7A):c.4152+6dup
NM_000260.4(MYO7A):c.4153-10C>G rs397516306
NM_000260.4(MYO7A):c.4153-11C>T rs727503330
NM_000260.4(MYO7A):c.4153-2A>G rs1060499803
NM_000260.4(MYO7A):c.4153-7C>A rs369489756
NM_000260.4(MYO7A):c.4153-7C>G
NM_000260.4(MYO7A):c.4153-8C>G rs143216377
NM_000260.4(MYO7A):c.4153-8C>T rs143216377
NM_000260.4(MYO7A):c.4158C>T (p.Asp1386=) rs371789688
NM_000260.4(MYO7A):c.4171C>G (p.Leu1391Val) rs727504594
NM_000260.4(MYO7A):c.4184dup (p.Tyr1396fs) rs1555095933
NM_000260.4(MYO7A):c.4192G>A (p.Val1398Ile) rs369189548
NM_000260.4(MYO7A):c.4194A>G (p.Val1398=) rs1591438864
NM_000260.4(MYO7A):c.4195G>C (p.Asp1399His) rs373080197
NM_000260.4(MYO7A):c.4222C>G (p.Arg1408Gly) rs377391891
NM_000260.4(MYO7A):c.4222C>T (p.Arg1408Cys) rs377391891
NM_000260.4(MYO7A):c.4225del (p.Leu1409fs) rs1398609491
NM_000260.4(MYO7A):c.4248C>A (p.Tyr1416Ter) rs760292207
NM_000260.4(MYO7A):c.4251C>T (p.Ile1417=) rs397516307
NM_000260.4(MYO7A):c.4254C>T (p.Pro1418=) rs548434591
NM_000260.4(MYO7A):c.4254del (p.Asp1419fs) rs1555096070
NM_000260.4(MYO7A):c.4259G>A (p.Arg1420His)
NM_000260.4(MYO7A):c.4261G>A (p.Glu1421Lys)
NM_000260.4(MYO7A):c.4271C>G (p.Pro1424Arg)
NM_000260.4(MYO7A):c.4280C>T (p.Thr1427Met) rs547006116
NM_000260.4(MYO7A):c.4281G>A (p.Thr1427=) rs185607254
NM_000260.4(MYO7A):c.4285G>A (p.Glu1429Lys)
NM_000260.4(MYO7A):c.4293G>A (p.Trp1431Ter) rs397516308
NM_000260.4(MYO7A):c.4297del (p.Gln1433fs) rs1555096223
NM_000260.4(MYO7A):c.4308C>T (p.Ile1436=) rs189972611
NM_000260.4(MYO7A):c.4309G>A (p.Ala1437Thr) rs200934424
NM_000260.4(MYO7A):c.4313C>T (p.Ala1438Val) rs538178875
NM_000260.4(MYO7A):c.4323+12G>A rs115708951
NM_000260.4(MYO7A):c.4323+156C>T rs948958
NM_000260.4(MYO7A):c.4323+35G>T rs1109977
NM_000260.4(MYO7A):c.4324-202A>G rs12421897
NM_000260.4(MYO7A):c.4324-207C>G rs12802853
NM_000260.4(MYO7A):c.4324-7C>T rs1327395587
NM_000260.4(MYO7A):c.4338_4340GAG[1] (p.Arg1448del) rs1432069074
NM_000260.4(MYO7A):c.4351G>T (p.Ala1451Ser)
NM_000260.4(MYO7A):c.4353C>T (p.Ala1451=) rs372336857
NM_000260.4(MYO7A):c.4354C>T (p.Gln1452Ter)
NM_000260.4(MYO7A):c.4360G>A (p.Val1454Ile) rs397516309
NM_000260.4(MYO7A):c.4362C>A (p.Val1454=) rs374492441
NM_000260.4(MYO7A):c.4385C>A (p.Ala1462Asp)
NM_000260.4(MYO7A):c.4387C>T (p.Arg1463Cys)
NM_000260.4(MYO7A):c.4398G>A (p.Trp1466Ter)
NM_000260.4(MYO7A):c.439C>T (p.Arg147Cys) rs782808261
NM_000260.4(MYO7A):c.4407C>T (p.Leu1469=) rs747856394
NM_000260.4(MYO7A):c.440G>A (p.Arg147His) rs111033512
NM_000260.4(MYO7A):c.4411T>C (p.Ser1471Pro) rs397516310
NM_000260.4(MYO7A):c.4432A>C (p.Lys1478Gln)
NM_000260.4(MYO7A):c.4439C>A (p.Ser1480Ter) rs1565455391
NM_000260.4(MYO7A):c.4441+19T>C rs11237114
NM_000260.4(MYO7A):c.4441+333C>A rs4945158
NM_000260.4(MYO7A):c.4441+78_4441+147del rs1591450716
NM_000260.4(MYO7A):c.4441+7C>T rs372493678
NM_000260.4(MYO7A):c.4441+8G>A rs766743441
NM_000260.4(MYO7A):c.4442-113A>G rs3781692
NM_000260.4(MYO7A):c.4442-1G>A
NM_000260.4(MYO7A):c.4442-1G>C rs1485456037
NM_000260.4(MYO7A):c.4442-2A>C rs111033337
NM_000260.4(MYO7A):c.4442-7G>A rs372023062
NM_000260.4(MYO7A):c.4445C>T (p.Pro1482Leu)
NM_000260.4(MYO7A):c.444C>T (p.Asn148=) rs1253765162
NM_000260.4(MYO7A):c.4450C>T (p.Leu1484Phe) rs200416912
NM_000260.4(MYO7A):c.4461C>T (p.Asn1487=) rs56174006
NM_000260.4(MYO7A):c.4465G>A (p.Val1489Ile)
NM_000260.4(MYO7A):c.4470C>G (p.Ile1490Met)
NM_000260.4(MYO7A):c.4471G>A (p.Val1491Met) rs369768947
NM_000260.4(MYO7A):c.4476C>T (p.Ala1492=)
NM_000260.4(MYO7A):c.4488G>A (p.Thr1496=) rs376743356
NM_000260.4(MYO7A):c.4489G>C (p.Gly1497Arg) rs751769391
NM_000260.4(MYO7A):c.448C>A (p.Arg150=) rs121965079
NM_000260.4(MYO7A):c.448C>T (p.Arg150Ter) rs121965079
NM_000260.4(MYO7A):c.449G>A (p.Arg150Gln) rs202245413
NM_000260.4(MYO7A):c.44G>T (p.Arg15Ile)
NM_000260.4(MYO7A):c.4500_4501TG[1] (p.Val1501fs) rs1555099541
NM_000260.4(MYO7A):c.4505A>G (p.Asp1502Gly) rs757460257
NM_000260.4(MYO7A):c.4512G>A (p.Gln1504=) rs767236447
NM_000260.4(MYO7A):c.4530G>A (p.Glu1510=) rs574232710
NM_000260.4(MYO7A):c.4539C>T (p.Phe1513=) rs780198980
NM_000260.4(MYO7A):c.4544_4551delinsCA (p.Glu1515_Met1517delinsAla) rs111033259
NM_000260.4(MYO7A):c.4555del (p.Val1519fs) rs876657712
NM_000260.4(MYO7A):c.4568+10C>A rs367801483
NM_000260.4(MYO7A):c.4568+12C>G rs72933642
NM_000260.4(MYO7A):c.4568+13G>A rs532356676
NM_000260.4(MYO7A):c.4568+1G>A
NM_000260.4(MYO7A):c.4569-1G>A rs775792432
NM_000260.4(MYO7A):c.4569-261C>T rs3781691
NM_000260.4(MYO7A):c.4569-2A>C
NM_000260.4(MYO7A):c.4576del (p.Arg1526fs) rs1555100200
NM_000260.4(MYO7A):c.4577G>A (p.Arg1526His) rs397516311
NM_000260.4(MYO7A):c.4589C>T (p.Ser1530Leu) rs111033183
NM_000260.4(MYO7A):c.458G>A (p.Cys153Tyr) rs397516312
NM_000260.4(MYO7A):c.4613del (p.Cys1538fs)
NM_000260.4(MYO7A):c.4619C>T (p.Ala1540Val) rs111033511
NM_000260.4(MYO7A):c.4620G>A (p.Ala1540=) rs41298745
NM_000260.4(MYO7A):c.462C>A (p.Cys154Ter)
NM_000260.4(MYO7A):c.4630G>A (p.Gly1544Ser) rs886048678
NM_000260.4(MYO7A):c.4642del (p.Gly1547_Leu1548insTer) rs1555100273
NM_000260.4(MYO7A):c.4647C>A (p.Thr1549=) rs757971917
NM_000260.4(MYO7A):c.4650G>A (p.Pro1550=) rs751242817
NM_000260.4(MYO7A):c.4659_4660del (p.Cys1554fs) rs1555100315
NM_000260.4(MYO7A):c.4664C>A (p.Ser1555Tyr) rs779524499
NM_000260.4(MYO7A):c.4667C>T (p.Pro1556Leu) rs150654627
NM_000260.4(MYO7A):c.4667_4668delinsTA (p.Pro1556Leu)
NM_000260.4(MYO7A):c.4668G>A (p.Pro1556=) rs376892582
NM_000260.4(MYO7A):c.4685G>T (p.Gly1562Val)
NM_000260.4(MYO7A):c.4689G>A (p.Ala1563=)
NM_000260.4(MYO7A):c.468C>T (p.Ile156=) rs12420129
NM_000260.4(MYO7A):c.4694C>T (p.Thr1565Met)
NM_000260.4(MYO7A):c.4695G>A (p.Thr1565=) rs397516313
NM_000260.4(MYO7A):c.4697C>T (p.Thr1566Met) rs41298747
NM_000260.4(MYO7A):c.4698G>A (p.Thr1566=) rs200207753
NM_000260.4(MYO7A):c.470+1G>A rs797044510
NM_000260.4(MYO7A):c.470+6C>A rs370905994
NM_000260.4(MYO7A):c.470+7G>A rs782450386
NM_000260.4(MYO7A):c.470+96C>T rs55880704
NM_000260.4(MYO7A):c.471-1G>A rs548172627
NM_000260.4(MYO7A):c.4727A>G (p.Lys1576Arg)
NM_000260.4(MYO7A):c.4728G>A (p.Lys1576=) rs758921557
NM_000260.4(MYO7A):c.4732G>A (p.Asp1578Asn)
NM_000260.4(MYO7A):c.4735G>A (p.Glu1579Lys) rs374766654
NM_000260.4(MYO7A):c.4739A>G (p.Tyr1580Cys) rs370232066
NM_000260.4(MYO7A):c.4751C>G (p.Ser1584Cys)
NM_000260.4(MYO7A):c.4755C>T (p.Ser1585=) rs7927472
NM_000260.4(MYO7A):c.4757A>G (p.Asn1586Ser) rs201251963
NM_000260.4(MYO7A):c.4759G>T (p.Ala1587Ser)
NM_000260.4(MYO7A):c.4762G>A (p.Glu1588Lys)
NM_000260.4(MYO7A):c.4768A>G (p.Ile1590Val)
NM_000260.4(MYO7A):c.4772G>A (p.Arg1591His)
NM_000260.4(MYO7A):c.47T>A (p.Leu16Ter) rs1052030
NM_000260.4(MYO7A):c.47T>C (p.Leu16Ser) rs1052030
NM_000260.4(MYO7A):c.4800G>T (p.Gly1600=) rs397516314
NM_000260.4(MYO7A):c.4803C>G (p.Leu1601=) rs778484667
NM_000260.4(MYO7A):c.4804C>T (p.Arg1602Trp)
NM_000260.4(MYO7A):c.4805G>A (p.Arg1602Gln) rs139889944
NM_000260.4(MYO7A):c.4821T>A (p.Tyr1607Ter) rs397516315
NM_000260.4(MYO7A):c.4828dup (p.Ala1610fs) rs1555100603
NM_000260.4(MYO7A):c.4837_4839dup (p.Asp1613dup) rs1555100610
NM_000260.4(MYO7A):c.4838del (p.Asp1613fs) rs1199012623
NM_000260.4(MYO7A):c.4842C>A (p.Asn1614Lys) rs749146420
NM_000260.4(MYO7A):c.4844C>T (p.Pro1615Leu) rs201321140
NM_000260.4(MYO7A):c.4845C>A (p.Pro1615=) rs61900036
NM_000260.4(MYO7A):c.4845del (p.Asn1616fs) rs1555100625
NM_000260.4(MYO7A):c.484G>A (p.Ala162Thr) rs111033485
NM_000260.4(MYO7A):c.4851C>T (p.Pro1617=) rs372535399
NM_000260.4(MYO7A):c.4852+1G>A
NM_000260.4(MYO7A):c.4852G>A (p.Ala1618Thr)
NM_000260.4(MYO7A):c.4853-11C>G
NM_000260.4(MYO7A):c.4857C>T (p.Gly1619=)
NM_000260.4(MYO7A):c.486C>T (p.Ala162=) rs367687624
NM_000260.4(MYO7A):c.4871T>C (p.Phe1624Ser)
NM_000260.4(MYO7A):c.487G>A (p.Gly163Arg) rs1472566324
NM_000260.4(MYO7A):c.4894del (p.Leu1632fs) rs1188637368
NM_000260.4(MYO7A):c.4909_4914del (p.His1637_Asp1638del)
NM_000260.4(MYO7A):c.4910A>G (p.His1637Arg) rs372054499
NM_000260.4(MYO7A):c.4916C>T (p.Thr1639Met) rs200848641
NM_000260.4(MYO7A):c.4917G>A (p.Thr1639=)
NM_000260.4(MYO7A):c.4919del (p.Gly1640fs) rs1555101858
NM_000260.4(MYO7A):c.4921G>A (p.Glu1641Lys) rs767975012
NM_000260.4(MYO7A):c.4927G>A (p.Val1643Ile) rs1591467534
NM_000260.4(MYO7A):c.4938G>A (p.Ser1646=) rs550479429
NM_000260.4(MYO7A):c.4940G>C (p.Gly1647Ala)
NM_000260.4(MYO7A):c.494C>T (p.Thr165Met) rs111033174
NM_000260.4(MYO7A):c.4950C>T (p.Asn1650=) rs80033599
NM_000260.4(MYO7A):c.4951G>A (p.Gly1651Ser)
NM_000260.4(MYO7A):c.495G>A (p.Thr165=)
NM_000260.4(MYO7A):c.496del (p.Glu166fs) rs111033448
NM_000260.4(MYO7A):c.4973A>G (p.Gln1658Arg) rs1565464627
NM_000260.4(MYO7A):c.4978G>A (p.Gly1660Arg) rs771889662
NM_000260.4(MYO7A):c.4983C>T (p.Asp1661=) rs111033331
NM_000260.4(MYO7A):c.4992C>T (p.Thr1664=) rs181573957
NM_000260.4(MYO7A):c.4993G>A (p.Asp1665Asn)
NM_000260.4(MYO7A):c.4996A>T (p.Ser1666Cys) rs2276288
NM_000260.4(MYO7A):c.4996_4997del (p.Ser1666fs) rs1591467894
NM_000260.4(MYO7A):c.4997_4998GT[2] (p.Tyr1668fs) rs1591467918
NM_000260.4(MYO7A):c.5004C>T (p.Tyr1668=) rs1479835169
NM_000260.4(MYO7A):c.5005G>A (p.Val1669Ile) rs374655803
NM_000260.4(MYO7A):c.500G>C (p.Ser167Thr) rs886044857
NM_000260.4(MYO7A):c.5011C>A (p.Pro1671Thr)
NM_000260.4(MYO7A):c.5013del (p.Thr1672fs) rs1555102041
NM_000260.4(MYO7A):c.5018T>A (p.Val1673Asp)
NM_000260.4(MYO7A):c.5029C>T (p.Pro1677Ser)
NM_000260.4(MYO7A):c.5033G>A (p.Arg1678Gln) rs371115266
NM_000260.4(MYO7A):c.5037G>A (p.Glu1679=) rs886048679
NM_000260.4(MYO7A):c.5043+1G>T rs1555102147
NM_000260.4(MYO7A):c.5043+20C>T rs112969118
NM_000260.4(MYO7A):c.5044-247T>C rs11237118
NM_000260.4(MYO7A):c.5065G>A (p.Asp1689Asn) rs544639673
NM_000260.4(MYO7A):c.5069_5070insC (p.Gln1690fs) rs1591470904
NM_000260.4(MYO7A):c.5079C>T (p.Asp1693=) rs751298357
NM_000260.4(MYO7A):c.5080G>A (p.Val1694Ile)
NM_000260.4(MYO7A):c.5088G>T (p.Arg1696=) rs886048680
NM_000260.4(MYO7A):c.5095C>G (p.Gln1699Glu) rs530520654
NM_000260.4(MYO7A):c.5095C>T (p.Gln1699Ter) rs530520654
NM_000260.4(MYO7A):c.5101C>T (p.Arg1701Ter) rs111033182
NM_000260.4(MYO7A):c.5102G>A (p.Arg1701Gln)
NM_000260.4(MYO7A):c.5108C>T (p.Ala1703Val) rs199561332
NM_000260.4(MYO7A):c.5109G>A (p.Ala1703=) rs374162462
NM_000260.4(MYO7A):c.510G>A (p.Leu170=) rs34477144
NM_000260.4(MYO7A):c.5115C>T (p.Pro1705=) rs111033411
NM_000260.4(MYO7A):c.5116G>A (p.Glu1706Lys)
NM_000260.4(MYO7A):c.5122C>T (p.Arg1708Cys)
NM_000260.4(MYO7A):c.513C>A (p.Ile171=) rs375366269
NM_000260.4(MYO7A):c.5143_5145GAG[1] (p.Glu1716del) rs1555102843
NM_000260.4(MYO7A):c.5146G>T (p.Glu1716Ter)
NM_000260.4(MYO7A):c.514C>T (p.Leu172=) rs368246776
NM_000260.4(MYO7A):c.5151T>C (p.Phe1717=) rs1179508791
NM_000260.4(MYO7A):c.5156A>G (p.Tyr1719Cys) rs77625410
NM_000260.4(MYO7A):c.5156_5157del (p.Ser1718_Tyr1719insTer)
NM_000260.4(MYO7A):c.5162A>G (p.Tyr1721Cys)
NM_000260.4(MYO7A):c.5166C>T (p.Phe1722=) rs566614598
NM_000260.4(MYO7A):c.5168+2T>C rs1192104600
NM_000260.4(MYO7A):c.5169-5G>A rs727505232
NM_000260.4(MYO7A):c.5169-6C>T rs768594224
NM_000260.4(MYO7A):c.5172C>G (p.Pro1724=) rs727505004
NM_000260.4(MYO7A):c.5177C>T (p.Pro1726Leu) rs1478464275
NM_000260.4(MYO7A):c.5186C>T (p.Thr1729Met)
NM_000260.4(MYO7A):c.5196T>A (p.Arg1732=) rs1591474922
NM_000260.4(MYO7A):c.5197G>A (p.Val1733Ile) rs1555103433
NM_000260.4(MYO7A):c.519G>A (p.Gln173=) rs369757929
NM_000260.4(MYO7A):c.5208dup (p.Lys1737fs) rs111033276
NM_000260.4(MYO7A):c.5214C>A (p.Ala1738=) rs886048681
NM_000260.4(MYO7A):c.5215C>A (p.Arg1739=) rs111033477
NM_000260.4(MYO7A):c.5215C>T (p.Arg1739Ter) rs111033477
NM_000260.4(MYO7A):c.5227C>A (p.Arg1743=) rs111033287
NM_000260.4(MYO7A):c.5227C>T (p.Arg1743Trp) rs111033287
NM_000260.4(MYO7A):c.5228G>A (p.Arg1743Gln)
NM_000260.4(MYO7A):c.5229del (p.Leu1744fs) rs1555103458
NM_000260.4(MYO7A):c.5243C>T (p.Thr1748Met) rs752373714
NM_000260.4(MYO7A):c.5244G>A (p.Thr1748=) rs1189132240
NM_000260.4(MYO7A):c.5245C>T (p.Arg1749Trp)
NM_000260.4(MYO7A):c.5246G>A (p.Arg1749Gln) rs781537330
NM_000260.4(MYO7A):c.5253G>A (p.Pro1751=) rs377388669
NM_000260.4(MYO7A):c.5253G>T (p.Pro1751=) rs377388669
NM_000260.4(MYO7A):c.5259G>A (p.Lys1753=) rs370062187
NM_000260.4(MYO7A):c.5259del (p.Lys1753fs) rs1555103532
NM_000260.4(MYO7A):c.525G>A (p.Leu175=) rs782118827
NM_000260.4(MYO7A):c.5263G>A (p.Ala1755Thr) rs762131185
NM_000260.4(MYO7A):c.5264C>T (p.Ala1755Val) rs574917232
NM_000260.4(MYO7A):c.5265G>A (p.Ala1755=) rs773557376
NM_000260.4(MYO7A):c.5266C>T (p.Leu1756=) rs1238337322
NM_000260.4(MYO7A):c.5291A>G (p.Glu1764Gly) rs759346941
NM_000260.4(MYO7A):c.52C>T (p.Gln18Ter) rs1555051455
NM_000260.4(MYO7A):c.5300C>T (p.Ser1767Leu)
NM_000260.4(MYO7A):c.5315T>C (p.Leu1772Pro)
NM_000260.4(MYO7A):c.5324T>C (p.Ile1775Thr) rs115123584
NM_000260.4(MYO7A):c.5326+13C>T rs114157944
NM_000260.4(MYO7A):c.5326+3A>G rs1565469959
NM_000260.4(MYO7A):c.5327-10C>G
NM_000260.4(MYO7A):c.5327-11A>G rs397516316
NM_000260.4(MYO7A):c.5339A>C (p.Tyr1780Ser) rs1555104196
NM_000260.4(MYO7A):c.5342T>C (p.Met1781Thr)
NM_000260.4(MYO7A):c.5345G>C (p.Gly1782Ala) rs751242455
NM_000260.4(MYO7A):c.5355G>A (p.Pro1785=) rs372311564
NM_000260.4(MYO7A):c.5356T>A (p.Ser1786Thr) rs374576916
NM_000260.4(MYO7A):c.5368C>T (p.Arg1790Cys)
NM_000260.4(MYO7A):c.5369G>A (p.Arg1790His)
NM_000260.4(MYO7A):c.5373C>T (p.Ser1791=) rs376301325
NM_000260.4(MYO7A):c.5374G>A (p.Val1792Ile) rs369424114
NM_000260.4(MYO7A):c.5378A>G (p.Asn1793Ser)
NM_000260.4(MYO7A):c.5380G>A (p.Glu1794Lys) rs762836180
NM_000260.4(MYO7A):c.5388C>T (p.Thr1796=) rs372062718
NM_000260.4(MYO7A):c.5392C>T (p.Gln1798Ter) rs397516317
NM_000260.4(MYO7A):c.5397C>A (p.Ile1799=)
NM_000260.4(MYO7A):c.5418C>A (p.Ala1806=) rs368749248
NM_000260.4(MYO7A):c.5418C>T (p.Ala1806=) rs368749248
NM_000260.4(MYO7A):c.5420_5421dup (p.Pro1808fs) rs1591479405
NM_000260.4(MYO7A):c.5422_5436del (p.Pro1808_Glu1812del)
NM_000260.4(MYO7A):c.5434G>A (p.Glu1812Lys) rs377267777
NM_000260.4(MYO7A):c.5445G>A (p.Val1815=) rs910989813
NM_000260.4(MYO7A):c.5458C>G (p.Gln1820Glu)
NM_000260.4(MYO7A):c.5458C>T (p.Gln1820Ter)
NM_000260.4(MYO7A):c.5464A>C (p.Thr1822Pro) rs727504541
NM_000260.4(MYO7A):c.5466C>T (p.Thr1822=) rs548620787
NM_000260.4(MYO7A):c.5472C>T (p.Asn1824=) rs774795238
NM_000260.4(MYO7A):c.5480+10G>A rs768513428
NM_000260.4(MYO7A):c.5480+162C>G rs11237120
NM_000260.4(MYO7A):c.5481-14G>A rs113075052
NM_000260.4(MYO7A):c.5481-15C>T rs727504955
NM_000260.4(MYO7A):c.5481-1G>C rs1555105118
NM_000260.4(MYO7A):c.5481-83A>G rs11237121
NM_000260.4(MYO7A):c.5486_5487delinsTT (p.Ser1829Ile)
NM_000260.4(MYO7A):c.5487C>T (p.Ser1829=) rs397516318
NM_000260.4(MYO7A):c.5488dup (p.Glu1830fs) rs1555105135
NM_000260.4(MYO7A):c.548C>T (p.Ser183Leu)
NM_000260.4(MYO7A):c.5494C>A (p.Arg1832=) rs748080151
NM_000260.4(MYO7A):c.5494C>T (p.Arg1832Trp) rs748080151
NM_000260.4(MYO7A):c.5495G>A (p.Arg1832Gln) rs372768607
NM_000260.4(MYO7A):c.5497G>C (p.Gly1833Arg) rs1367496020
NM_000260.4(MYO7A):c.549G>A (p.Ser183=) rs188198404
NM_000260.4(MYO7A):c.54G>C (p.Gln18His) rs371849195
NM_000260.4(MYO7A):c.5504A>G (p.Glu1835Gly) rs727503331
NM_000260.4(MYO7A):c.5507T>C (p.Leu1836Pro) rs1164918878
NM_000260.4(MYO7A):c.5510T>C (p.Leu1837Pro) rs1385324903
NM_000260.4(MYO7A):c.5522C>G (p.Thr1841Arg) rs746667217
NM_000260.4(MYO7A):c.5528T>G (p.Leu1843Arg) rs397516319
NM_000260.4(MYO7A):c.5536C>G (p.Pro1846Ala) rs763456971
NM_000260.4(MYO7A):c.5543del (p.Asn1848fs) rs1555105202
NM_000260.4(MYO7A):c.5559C>T (p.His1853=) rs373612656
NM_000260.4(MYO7A):c.5560G>A (p.Val1854Met) rs754761542
NM_000260.4(MYO7A):c.5566C>T (p.Arg1856Cys)
NM_000260.4(MYO7A):c.5573T>C (p.Leu1858Pro) rs368657015
NM_000260.4(MYO7A):c.5581C>T (p.Arg1861Ter) rs878864531
NM_000260.4(MYO7A):c.5581dup (p.Arg1861fs) rs397516320
NM_000260.4(MYO7A):c.5589C>G (p.His1863Gln) rs727504024
NM_000260.4(MYO7A):c.5589C>T (p.His1863=)
NM_000260.4(MYO7A):c.5590T>C (p.Cys1864Arg)
NM_000260.4(MYO7A):c.5598C>A (p.Leu1866=) rs111033504
NM_000260.4(MYO7A):c.5598C>T (p.Leu1866=) rs111033504
NM_000260.4(MYO7A):c.5600C>T (p.Ala1867Val) rs876657914
NM_000260.4(MYO7A):c.5604C>T (p.Ile1868=) rs760784637
NM_000260.4(MYO7A):c.5617C>T (p.Arg1873Trp) rs397516321
NM_000260.4(MYO7A):c.5618G>A (p.Arg1873Gln) rs397516322
NM_000260.4(MYO7A):c.5619G>A (p.Arg1873=) rs45450893
NM_000260.4(MYO7A):c.562C>G (p.Gln188Glu) rs572959359
NM_000260.4(MYO7A):c.5632del (p.Ala1877_Leu1878insTer) rs1299898646
NM_000260.4(MYO7A):c.5636+2T>A rs1057518040
NM_000260.4(MYO7A):c.5636+8G>A rs777902873
NM_000260.4(MYO7A):c.5637-173C>T rs207472020
NM_000260.4(MYO7A):c.5637-175A>G rs4945160
NM_000260.4(MYO7A):c.5640C>T (p.Asn1880=) rs140664109
NM_000260.4(MYO7A):c.5641G>A (p.Gly1881Arg) rs373886432
NM_000260.4(MYO7A):c.5648G>A (p.Arg1883Gln) rs111033215
NM_000260.4(MYO7A):c.565_566del (p.Val189fs) rs1060499651
NM_000260.4(MYO7A):c.5660C>T (p.Pro1887Leu) rs199606180
NM_000260.4(MYO7A):c.5661G>A (p.Pro1887=) rs375627342
NM_000260.4(MYO7A):c.5665C>T (p.Leu1889=) rs778051833
NM_000260.4(MYO7A):c.5667G>A (p.Leu1889=) rs747516555
NM_000260.4(MYO7A):c.5667G>C (p.Leu1889=) rs747516555
NM_000260.4(MYO7A):c.5681C>T (p.Ala1894Val)
NM_000260.4(MYO7A):c.5688G>A (p.Gln1896=) rs570316231
NM_000260.4(MYO7A):c.5715A>G (p.Lys1905=) rs2276293
NM_000260.4(MYO7A):c.571G>C (p.Glu191Gln) rs886048672
NM_000260.4(MYO7A):c.5739C>T (p.Asp1913=) rs375992788
NM_000260.4(MYO7A):c.5743-10C>G rs764914158
NM_000260.4(MYO7A):c.5743-12T>C rs2276291
NM_000260.4(MYO7A):c.5743-17C>T rs180929855
NM_000260.4(MYO7A):c.5743-262G>C rs3819171
NM_000260.4(MYO7A):c.5748C>T (p.Phe1916=) rs756514910
NM_000260.4(MYO7A):c.5749G>T (p.Glu1917Ter)
NM_000260.4(MYO7A):c.5752G>A (p.Val1918Met) rs958153438
NM_000260.4(MYO7A):c.5753T>A (p.Val1918Glu) rs1555106562
NM_000260.4(MYO7A):c.5770G>C (p.Ala1924Pro)
NM_000260.4(MYO7A):c.5772C>A (p.Ala1924=) rs749438001
NM_000260.4(MYO7A):c.5778C>T (p.Asp1926=) rs992967931
NM_000260.4(MYO7A):c.5781C>T (p.Phe1927=) rs1167983525
NM_000260.4(MYO7A):c.5785C>T (p.Gln1929Ter)
NM_000260.4(MYO7A):c.578C>T (p.Thr193Ile) rs1188616455
NM_000260.4(MYO7A):c.5796C>T (p.Ala1932=) rs1328423490
NM_000260.4(MYO7A):c.5797del (p.Thr1933fs) rs1555106609
NM_000260.4(MYO7A):c.5804T>C (p.Leu1935Pro) rs397516323
NM_000260.4(MYO7A):c.5820A>G (p.Ser1940=) rs886048682
NM_000260.4(MYO7A):c.5820_5821AG[1] (p.Glu1941fs)
NM_000260.4(MYO7A):c.5824G>A (p.Gly1942Arg) rs111033192
NM_000260.4(MYO7A):c.5824G>T (p.Gly1942Ter) rs111033192
NM_000260.4(MYO7A):c.582del (p.Ile195fs) rs111033238
NM_000260.4(MYO7A):c.5835C>T (p.Leu1945=) rs111033476
NM_000260.4(MYO7A):c.5837_5838del (p.Phe1946fs)
NM_000260.4(MYO7A):c.5845_5855del (p.Ile1949fs) rs876657713
NM_000260.4(MYO7A):c.5851G>C (p.Asp1951His) rs767931313
NM_000260.4(MYO7A):c.5856+50G>A rs2276290
NM_000260.4(MYO7A):c.5856+5G>C rs1386887007
NM_000260.4(MYO7A):c.5856G>A (p.Lys1952=) rs1453053718
NM_000260.4(MYO7A):c.5857-2A>G rs1555107286
NM_000260.4(MYO7A):c.5857-3C>A rs727505114
NM_000260.4(MYO7A):c.5857-7A>C rs1320703
NM_000260.4(MYO7A):c.5857-7A>T rs1320703
NM_000260.4(MYO7A):c.5860C>A (p.Leu1954Ile) rs948962
NM_000260.4(MYO7A):c.5860C>G (p.Leu1954Val) rs948962
NM_000260.4(MYO7A):c.5865C>T (p.Ser1955=) rs1481506095
NM_000260.4(MYO7A):c.5866G>A (p.Val1956Ile) rs142293185
NM_000260.4(MYO7A):c.587T>C (p.Leu196Pro) rs397516324
NM_000260.4(MYO7A):c.5880_5882CTT[2] (p.Phe1963del) rs111033232
NM_000260.4(MYO7A):c.5886_5889del (p.Phe1962fs) rs1397834886
NM_000260.4(MYO7A):c.5887_5889del (p.Phe1963del)
NM_000260.4(MYO7A):c.5892C>G (p.Asp1964Glu)
NM_000260.4(MYO7A):c.5896G>A (p.Val1966Ile) rs371313080
NM_000260.4(MYO7A):c.5899C>T (p.Arg1967Ter) rs376764423
NM_000260.4(MYO7A):c.5900G>A (p.Arg1967Gln) rs752881271
NM_000260.4(MYO7A):c.5904C>T (p.His1968=) rs41298753
NM_000260.4(MYO7A):c.5929C>T (p.Arg1977Trp) rs781586223
NM_000260.4(MYO7A):c.593-4G>A rs876657534
NM_000260.4(MYO7A):c.593-5C>T rs762666
NM_000260.4(MYO7A):c.5930G>A (p.Arg1977Gln) rs762420918
NM_000260.4(MYO7A):c.5943C>T (p.Asp1981=)
NM_000260.4(MYO7A):c.5944+57G>A rs948961
NM_000260.4(MYO7A):c.5944+67C>T rs948960
NM_000260.4(MYO7A):c.5944G>A (p.Gly1982Arg) rs761469964
NM_000260.4(MYO7A):c.5945-1G>A rs1268984037
NM_000260.4(MYO7A):c.5945-4G>A rs372510327
NM_000260.4(MYO7A):c.5945-9G>A rs1233077552
NM_000260.4(MYO7A):c.5945-9G>C
NM_000260.4(MYO7A):c.5945G>A (p.Gly1982Glu) rs111033250
NM_000260.4(MYO7A):c.5950G>A (p.Val1984Met) rs377517717
NM_000260.4(MYO7A):c.5950G>T (p.Val1984Leu)
NM_000260.4(MYO7A):c.5956_5959TCAC[3] (p.Tyr1989fs) rs1555107555
NM_000260.4(MYO7A):c.5963C>T (p.Thr1988Ile)
NM_000260.4(MYO7A):c.5968C>T (p.Gln1990Ter) rs773844428
NM_000260.4(MYO7A):c.5969A>G (p.Gln1990Arg) rs560293591
NM_000260.4(MYO7A):c.5982G>A (p.Met1994Ile)
NM_000260.4(MYO7A):c.6002C>T (p.Thr2001Met) rs532542968
NM_000260.4(MYO7A):c.6013A>G (p.Lys2005Glu) rs186644871
NM_000260.4(MYO7A):c.6025G>A (p.Ala2009Thr) rs397516325
NM_000260.4(MYO7A):c.6025del (p.Ala2009fs) rs397516326
NM_000260.4(MYO7A):c.6026C>A (p.Ala2009Asp) rs1173853484
NM_000260.4(MYO7A):c.6027C>T (p.Ala2009=) rs140575390
NM_000260.4(MYO7A):c.6028G>A (p.Asp2010Asn) rs755934966
NM_000260.4(MYO7A):c.6029A>G (p.Asp2010Gly) rs111033175
NM_000260.4(MYO7A):c.6044_6047dup (p.Tyr2016Ter) rs1591496649
NM_000260.4(MYO7A):c.6051+155T>C rs11237122
NM_000260.4(MYO7A):c.6051+17T>A rs1320702
NM_000260.4(MYO7A):c.6051+190T>G rs885442
NM_000260.4(MYO7A):c.6051+1G>A rs1403288739
NM_000260.4(MYO7A):c.6051+234C>G rs885441
NM_000260.4(MYO7A):c.6051+263G>A rs885440
NM_000260.4(MYO7A):c.6052-11G>C rs112564978
NM_000260.4(MYO7A):c.6052-3C>T
NM_000260.4(MYO7A):c.6054G>A (p.Glu2018=) rs1239820996
NM_000260.4(MYO7A):c.6062A>G (p.Lys2021Arg) rs876657655
NM_000260.4(MYO7A):c.6063G>A (p.Lys2021=) rs111033209
NM_000260.4(MYO7A):c.6070C>T (p.Arg2024Ter) rs111033198
NM_000260.4(MYO7A):c.6090G>A (p.Thr2030=) rs1381141633
NM_000260.4(MYO7A):c.6092G>A (p.Arg2031Gln) rs762258869
NM_000260.4(MYO7A):c.6111G>A (p.Leu2037=)
NM_000260.4(MYO7A):c.612C>A (p.Thr204=) rs1555062863
NM_000260.4(MYO7A):c.6135G>C (p.Lys2045Asn)
NM_000260.4(MYO7A):c.613A>G (p.Ile205Val)
NM_000260.4(MYO7A):c.614T>C (p.Ile205Thr) rs200241993
NM_000260.4(MYO7A):c.6165C>T (p.Ser2055=) rs397516327
NM_000260.4(MYO7A):c.616C>T (p.Arg206Cys) rs782361954
NM_000260.4(MYO7A):c.6173A>G (p.Lys2058Arg) rs111033336
NM_000260.4(MYO7A):c.617G>A (p.Arg206His) rs781998354
NM_000260.4(MYO7A):c.6181C>T (p.Arg2061Trp)
NM_000260.4(MYO7A):c.618C>T (p.Arg206=) rs375851346
NM_000260.4(MYO7A):c.6193C>A (p.Pro2065Thr)
NM_000260.4(MYO7A):c.6196C>T (p.Gln2066Ter) rs1060499801
NM_000260.4(MYO7A):c.6196del (p.Gln2066fs) rs1472611150
NM_000260.4(MYO7A):c.61G>A (p.Asp21Asn)
NM_000260.4(MYO7A):c.6203T>G (p.Leu2068Arg) rs779090765
NM_000260.4(MYO7A):c.6205A>T (p.Ile2069Phe)
NM_000260.4(MYO7A):c.6209G>A (p.Arg2070Gln) rs397516328
NM_000260.4(MYO7A):c.620A>G (p.Asn207Ser) rs878853235
NM_000260.4(MYO7A):c.6211C>T (p.Gln2071Ter) rs1060499802
NM_000260.4(MYO7A):c.6214G>A (p.Val2072Ile) rs200313391
NM_000260.4(MYO7A):c.6220C>T (p.Pro2074Ser) rs747131589
NM_000260.4(MYO7A):c.6230G>A (p.Trp2077Ter) rs776930594
NM_000260.4(MYO7A):c.6231dup (p.Lys2078fs) rs730880367
NM_000260.4(MYO7A):c.6235C>T (p.Arg2079Trp) rs759614902
NM_000260.4(MYO7A):c.6236G>A (p.Arg2079Gln) rs765083332
NM_000260.4(MYO7A):c.6237+1G>A rs1338605788
NM_000260.4(MYO7A):c.6238-10G>A rs372074621
NM_000260.4(MYO7A):c.6238-1G>A
NM_000260.4(MYO7A):c.6238-2A>C rs1555109612
NM_000260.4(MYO7A):c.6238-2A>G
NM_000260.4(MYO7A):c.6238-7C>T rs1383845844
NM_000260.4(MYO7A):c.6240C>T (p.Ser2080=) rs41298757
NM_000260.4(MYO7A):c.6243C>A (p.Ile2081=) rs727504834
NM_000260.4(MYO7A):c.6247G>A (p.Ala2083Thr) rs41298759
NM_000260.4(MYO7A):c.6264C>T (p.His2088=) rs188278264
NM_000260.4(MYO7A):c.6267A>G (p.Ala2089=) rs564910239
NM_000260.4(MYO7A):c.6272A>G (p.Lys2091Arg) rs781713344
NM_000260.4(MYO7A):c.6309C>T (p.Leu2103=) rs371789765
NM_000260.4(MYO7A):c.6318G>A (p.Lys2106=) rs11237123
NM_000260.4(MYO7A):c.631A>G (p.Ser211Gly) rs111033486
NM_000260.4(MYO7A):c.6321G>A (p.Trp2107Ter) rs773945008
NM_000260.4(MYO7A):c.6326C>T (p.Thr2109Ile) rs377670513
NM_000260.4(MYO7A):c.6339C>A (p.Ala2113=) rs764862807
NM_000260.4(MYO7A):c.6345C>T (p.Phe2115=) rs397516329
NM_000260.4(MYO7A):c.6346G>A (p.Glu2116Lys)
NM_000260.4(MYO7A):c.6349G>T (p.Val2117Leu) rs1555109788
NM_000260.4(MYO7A):c.634C>T (p.Arg212Cys) rs121965080
NM_000260.4(MYO7A):c.6350T>C (p.Val2117Ala) rs1555109806
NM_000260.4(MYO7A):c.6355-2A>G
NM_000260.4(MYO7A):c.6355-8T>C rs1390096432
NM_000260.4(MYO7A):c.6356A>C (p.Gln2119Pro) rs1029122324
NM_000260.4(MYO7A):c.635G>A (p.Arg212His) rs28934610
NM_000260.4(MYO7A):c.6362C>T (p.Thr2121Met)
NM_000260.4(MYO7A):c.6363G>A (p.Thr2121=) rs367738288
NM_000260.4(MYO7A):c.6378T>G (p.Pro2126=) rs1016464733
NM_000260.4(MYO7A):c.6384C>T (p.Ile2128=) rs748743374
NM_000260.4(MYO7A):c.638T>A (p.Phe213Tyr)
NM_000260.4(MYO7A):c.6392T>C (p.Ile2131Thr)
NM_000260.4(MYO7A):c.639C>T (p.Phe213=) rs540197003
NM_000260.4(MYO7A):c.6409G>A (p.Gly2137Arg)
NM_000260.4(MYO7A):c.640G>A (p.Gly214Arg) rs111033283
NM_000260.4(MYO7A):c.6412G>A (p.Val2138Ile)
NM_000260.4(MYO7A):c.6424G>A (p.Asp2142Asn) rs1132036
NM_000260.4(MYO7A):c.6426T>A (p.Asp2142Glu)
NM_000260.4(MYO7A):c.6433del (p.Thr2145fs) rs1555110680
NM_000260.4(MYO7A):c.6438+10G>A rs764414261
NM_000260.4(MYO7A):c.6438+50A>T rs2276289
NM_000260.4(MYO7A):c.6439-1G>A rs1591514873
NM_000260.4(MYO7A):c.6439-2A>G rs397516330
NM_000260.4(MYO7A):c.6439-31G>A rs883223
NM_000260.4(MYO7A):c.6459del (p.Phe2154fs) rs1555111077
NM_000260.4(MYO7A):c.6470T>G (p.Ile2157Ser)
NM_000260.4(MYO7A):c.6474C>T (p.Ser2158=) rs780081786
NM_000260.4(MYO7A):c.6475A>G (p.Asn2159Asp) rs1555111106
NM_000260.4(MYO7A):c.6478T>G (p.Trp2160Gly) rs1003695470
NM_000260.4(MYO7A):c.6486C>T (p.Ser2162=) rs778498696
NM_000260.4(MYO7A):c.6487G>A (p.Gly2163Ser) rs747656448
NM_000260.4(MYO7A):c.6495C>T (p.Thr2165=) rs1591515014
NM_000260.4(MYO7A):c.6498C>A (p.Tyr2166Ter) rs397516331
NM_000260.4(MYO7A):c.6504C>T (p.His2168=) rs1591515038
NM_000260.4(MYO7A):c.6509C>T (p.Thr2170Ile) rs544709413
NM_000260.4(MYO7A):c.6512T>C (p.Ile2171Thr)
NM_000260.4(MYO7A):c.6519C>T (p.Asn2173=) rs111033230
NM_000260.4(MYO7A):c.6520T>C (p.Leu2174=) rs377251326
NM_000260.4(MYO7A):c.6527G>A (p.Arg2176His)
NM_000260.4(MYO7A):c.652G>A (p.Asp218Asn) rs201539845
NM_000260.4(MYO7A):c.652_657del (p.Asp218_Ile219del) rs1555062984
NM_000260.4(MYO7A):c.6546C>T (p.Cys2182=) rs185748200
NM_000260.4(MYO7A):c.6551C>T (p.Thr2184Met) rs1383147250
NM_000260.4(MYO7A):c.6552G>A (p.Thr2184=) rs370866578
NM_000260.4(MYO7A):c.6557T>C (p.Leu2186Pro) rs876657417
NM_000260.4(MYO7A):c.6558+16G>A rs883224
NM_000260.4(MYO7A):c.6558+51G>T rs948959
NM_000260.4(MYO7A):c.6558+9G>A rs111033184
NM_000260.4(MYO7A):c.6559-11C>T rs34517202
NM_000260.4(MYO7A):c.6559-257T>C rs869707
NM_000260.4(MYO7A):c.655_660del (p.Ile219_His220del)
NM_000260.4(MYO7A):c.6560G>A (p.Gly2187Asp) rs397516332
NM_000260.4(MYO7A):c.6570G>A (p.Met2190Ile) rs376900309
NM_000260.4(MYO7A):c.6577C>T (p.Leu2193Phe) rs397516333
NM_000260.4(MYO7A):c.658C>T (p.His220Tyr)
NM_000260.4(MYO7A):c.6600G>C (p.Gln2200His) rs779431269
NM_000260.4(MYO7A):c.6614_6634dup (p.Met2205_Ser2211dup) rs111033388
NM_000260.4(MYO7A):c.6615G>A (p.Met2205Ile) rs200359303
NM_000260.4(MYO7A):c.6622C>T (p.Gln2208Ter) rs747095250
NM_000260.4(MYO7A):c.6626G>A (p.Arg2209Gln)
NM_000260.4(MYO7A):c.6628_6643del (p.Gly2210fs) rs1555111501
NM_000260.4(MYO7A):c.6632C>T (p.Ser2211Phe)
NM_000260.4(MYO7A):c.6639C>T (p.Ser2213=) rs1172478438
NM_000260.4(MYO7A):c.6640G>A (p.Gly2214Ser) rs111033231
NM_000260.4(MYO7A):c.676G>A (p.Ala226Thr) rs201753022
NM_000260.4(MYO7A):c.687C>T (p.Gly229=) rs371142158
NM_000260.4(MYO7A):c.689C>T (p.Ala230Val) rs797044512
NM_000260.4(MYO7A):c.700C>T (p.Gln234Ter) rs41298133
NM_000260.4(MYO7A):c.721C>T (p.Arg241Cys) rs782166819
NM_000260.4(MYO7A):c.722G>A (p.Arg241His) rs111033284
NM_000260.4(MYO7A):c.724G>T (p.Val242Phe) rs1591270852
NM_000260.4(MYO7A):c.72C>T (p.Ile24=) rs397516334
NM_000260.4(MYO7A):c.731G>A (p.Arg244His) rs121965081
NM_000260.4(MYO7A):c.731G>C (p.Arg244Pro) rs121965081
NM_000260.4(MYO7A):c.735+3G>A
NM_000260.4(MYO7A):c.736-15_736-4dup rs111033503
NM_000260.4(MYO7A):c.736-3C>T rs1555063792
NM_000260.4(MYO7A):c.736-47C>A rs3737454
NM_000260.4(MYO7A):c.73G>A (p.Gly25Arg) rs782252317
NM_000260.4(MYO7A):c.741G>A (p.Leu247=)
NM_000260.4(MYO7A):c.758A>G (p.His253Arg) rs375200566
NM_000260.4(MYO7A):c.759C>T (p.His253=) rs182220009
NM_000260.4(MYO7A):c.75G>C (p.Gly25=) rs782517795
NM_000260.4(MYO7A):c.765C>T (p.Phe255=) rs782702948
NM_000260.4(MYO7A):c.779A>C (p.Glu260Ala) rs782636303
NM_000260.4(MYO7A):c.77C>A (p.Ala26Glu) rs369125667
NM_000260.4(MYO7A):c.783T>C (p.Gly261=) rs762667
NM_000260.4(MYO7A):c.78G>A (p.Ala26=) rs373517098
NM_000260.4(MYO7A):c.801G>A (p.Lys267=) rs1591272959
NM_000260.4(MYO7A):c.803A>G (p.Lys268Arg) rs184866544
NM_000260.4(MYO7A):c.813C>T (p.Gly271=)
NM_000260.4(MYO7A):c.846C>T (p.Ala282=) rs1591273299
NM_000260.4(MYO7A):c.849+5G>A rs1060499716
NM_000260.4(MYO7A):c.849+7C>G rs370740228
NM_000260.4(MYO7A):c.850-3C>G
NM_000260.4(MYO7A):c.874C>T (p.Arg292Trp) rs782505601
NM_000260.4(MYO7A):c.875G>A (p.Arg292Gln) rs535205981
NM_000260.4(MYO7A):c.879G>A (p.Val293=) rs185844002
NM_000260.4(MYO7A):c.882_886dup (p.Gln296fs) rs1591277785
NM_000260.4(MYO7A):c.894C>T (p.Tyr298=) rs554789699
NM_000260.4(MYO7A):c.895G>A (p.Ala299Thr) rs372344870
NM_000260.4(MYO7A):c.904C>T (p.Arg302Cys) rs781922871
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135
NM_000260.4(MYO7A):c.910G>A (p.Ala304Thr) rs782124327
NM_000260.4(MYO7A):c.937A>G (p.Thr313Ala)
NM_000260.4(MYO7A):c.93C>A (p.Cys31Ter) rs35689081
NM_000260.4(MYO7A):c.93C>T (p.Cys31=) rs35689081
NM_000260.4(MYO7A):c.940G>A (p.Glu314Lys) rs782685774
NM_000260.4(MYO7A):c.970G>T (p.Ala324Ser)
NM_000260.4(MYO7A):c.973_976del (p.Ile325fs) rs797044490
NM_000260.4(MYO7A):c.977T>A (p.Leu326Gln) rs797044491
NM_000260.4(MYO7A):c.982C>T (p.Leu328=) rs1591278378
NM_000260.4(MYO7A):c.999T>A (p.Tyr333Ter)
NM_000260.4(MYO7A):c.999T>G (p.Tyr333Ter) rs111033285
NM_000260.4(MYO7A):c.99_100del (p.Gly34fs)
NP_000251.3(MYO7A):p.Tyr1302fsTer97

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.