ClinVar Miner

List of variants in gene MYO7A reported as benign

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 86
Download table as spreadsheet
HGVS dbSNP
GRCh37/hg19 11q13.5(chr11:76895772-76906312)x1
NM_000260.3(MYO7A):c.1004-35C>G rs2071151
NM_000260.3(MYO7A):c.133-14C>T rs116228809
NM_000260.3(MYO7A):c.133-7C>T rs111033221
NM_000260.3(MYO7A):c.1343+8G>A rs2276278
NM_000260.3(MYO7A):c.1554+8G>A rs111033227
NM_000260.3(MYO7A):c.1605C>T (p.Asn535=) rs111033228
NM_000260.3(MYO7A):c.1726G>A (p.Asp576Asn) rs187165412
NM_000260.3(MYO7A):c.1798-15C>T rs115708180
NM_000260.3(MYO7A):c.1854G>A (p.Leu618=) rs35429535
NM_000260.3(MYO7A):c.1936-23G>A rs2276283
NM_000260.3(MYO7A):c.2035G>A (p.Val679Ile) rs35641839
NM_000260.3(MYO7A):c.2236G>A (p.Asp746Asn) rs36090425
NM_000260.3(MYO7A):c.2447G>A (p.Arg816His) rs148343670
NM_000260.3(MYO7A):c.2587-14C>T rs180774455
NM_000260.3(MYO7A):c.2754C>T (p.Ala918=) rs78072361
NM_000260.3(MYO7A):c.286-5C>T rs111033471
NM_000260.3(MYO7A):c.288G>A (p.Thr96=) rs56023295
NM_000260.3(MYO7A):c.3042G>T (p.Thr1014=) rs111033507
NM_000260.3(MYO7A):c.3086A>G (p.His1029Arg) rs60103800
NM_000260.3(MYO7A):c.3246G>A (p.Thr1082=) rs35963362
NM_000260.3(MYO7A):c.3375+33G>C rs948972
NM_000260.3(MYO7A):c.3469A>G (p.Ile1157Val) rs397516300
NM_000260.3(MYO7A):c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG rs111033223
NM_000260.3(MYO7A):c.3750+9G>A rs111033252
NM_000260.3(MYO7A):c.3828G>A (p.Ser1276=) rs78871677
NM_000260.3(MYO7A):c.3924+12C>T rs2276285
NM_000260.3(MYO7A):c.4023C>T (p.Pro1341=) rs73495790
NM_000260.3(MYO7A):c.4074C>T (p.Ser1358=) rs78996818
NM_000260.3(MYO7A):c.4323+35G>T rs1109977
NM_000260.3(MYO7A):c.4441+19T>C rs11237114
NM_000260.3(MYO7A):c.4461C>T (p.Asn1487=) rs56174006
NM_000260.3(MYO7A):c.4568+12C>G rs72933642
NM_000260.3(MYO7A):c.4589C>T (p.Ser1530Leu) rs111033183
NM_000260.3(MYO7A):c.4620G>A (p.Ala1540=) rs41298745
NM_000260.3(MYO7A):c.468C>T (p.Ile156=) rs12420129
NM_000260.3(MYO7A):c.4697C>T (p.Thr1566Met) rs41298747
NM_000260.3(MYO7A):c.4698G>A (p.Thr1566=) rs200207753
NM_000260.3(MYO7A):c.4755C>T (p.Ser1585=) rs7927472
NM_000260.3(MYO7A):c.47T>C (p.Leu16Ser) rs1052030
NM_000260.3(MYO7A):c.4845C>A (p.Pro1615=) rs61900036
NM_000260.3(MYO7A):c.4950C>T (p.Asn1650=) rs80033599
NM_000260.3(MYO7A):c.4992C>T (p.Thr1664=) rs181573957
NM_000260.3(MYO7A):c.4996A>T (p.Ser1666Cys) rs2276288
NM_000260.3(MYO7A):c.5043+20C>T rs112969118
NM_000260.3(MYO7A):c.510G>A (p.Leu170=) rs34477144
NM_000260.3(MYO7A):c.5156A>G (p.Tyr1719Cys) rs77625410
NM_000260.3(MYO7A):c.5215C>A (p.Arg1739=) rs111033477
NM_000260.3(MYO7A):c.5227C>T (p.Arg1743Trp) rs111033287
NM_000260.3(MYO7A):c.5324T>C (p.Ile1775Thr) rs115123584
NM_000260.3(MYO7A):c.5326+13C>T rs114157944
NM_000260.3(MYO7A):c.5481-14G>A rs113075052
NM_000260.3(MYO7A):c.5598C>A (p.Leu1866=) rs111033504
NM_000260.3(MYO7A):c.5598C>T (p.Leu1866=) rs111033504
NM_000260.3(MYO7A):c.5619G>A (p.Arg1873=) rs45450893
NM_000260.3(MYO7A):c.5715A>G (p.Lys1905=) rs2276293
NM_000260.3(MYO7A):c.5743-12T>C rs2276291
NM_000260.3(MYO7A):c.5743-17C>T rs180929855
NM_000260.3(MYO7A):c.5835C>T (p.Leu1945=) rs111033476
NM_000260.3(MYO7A):c.5856+50G>A rs2276290
NM_000260.3(MYO7A):c.5857-7A>T rs1320703
NM_000260.3(MYO7A):c.5860C>A (p.Leu1954Ile) rs948962
NM_000260.3(MYO7A):c.5866G>A (p.Val1956Ile) rs142293185
NM_000260.3(MYO7A):c.593-5C>T rs762666
NM_000260.3(MYO7A):c.6051+17T>A rs1320702
NM_000260.3(MYO7A):c.6052-11G>C rs112564978
NM_000260.3(MYO7A):c.6063G>A (p.Lys2021=) rs111033209
NM_000260.3(MYO7A):c.6214G>A (p.Val2072Ile) rs200313391
NM_000260.3(MYO7A):c.6240C>T (p.Ser2080=) rs41298757
NM_000260.3(MYO7A):c.6318G>A (p.Lys2106=) rs11237123
NM_000260.3(MYO7A):c.639C>T (p.Phe213=) rs540197003
NM_000260.3(MYO7A):c.6424G>A (p.Asp2142Asn) rs1132036
NM_000260.3(MYO7A):c.6438+50A>T rs2276289
NM_000260.3(MYO7A):c.6439-31G>A rs883223
NM_000260.3(MYO7A):c.6519C>T (p.Asn2173=) rs111033230
NM_000260.3(MYO7A):c.6558+16G>A rs883224
NM_000260.3(MYO7A):c.6559-11C>T rs34517202
NM_000260.3(MYO7A):c.6614_6634dup21 (p.Ser2211_Arg2212insMetSerLysGlnArgGlySer) rs111033388
NM_000260.3(MYO7A):c.6640G>A (p.Gly2214Ser) rs111033231
NM_000260.3(MYO7A):c.736-15_736-4dup rs111033503
NM_000260.3(MYO7A):c.736-47C>A rs3737454
NM_000260.3(MYO7A):c.783T>C (p.Gly261=) rs762667
NM_000260.3(MYO7A):c.93C>T (p.Cys31=) rs35689081
NM_000260.4(MYO7A):c.2476G>A (p.Ala826Thr) rs368341987
NM_000260.4(MYO7A):c.324C>T (p.Tyr108=) rs116892396
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.