ClinVar Miner

List of variants in gene MYO7A reported by PreventionGenetics

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 31
Download table as spreadsheet
NM_000260.3(MYO7A):c.1004-35C>G rs2071151
NM_000260.3(MYO7A):c.1343+50T>A rs77568474
NM_000260.3(MYO7A):c.1343+8G>A rs2276278
NM_000260.3(MYO7A):c.1726G>A (p.Asp576Asn) rs187165412
NM_000260.3(MYO7A):c.1936-23G>A rs2276283
NM_000260.3(MYO7A):c.288G>A (p.Thr96=) rs56023295
NM_000260.3(MYO7A):c.3375+33G>C rs948972
NM_000260.3(MYO7A):c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG rs111033223
NM_000260.3(MYO7A):c.3828G>A (p.Ser1276=) rs78871677
NM_000260.3(MYO7A):c.3924+12C>T rs2276285
NM_000260.3(MYO7A):c.4323+35G>T rs1109977
NM_000260.3(MYO7A):c.448C>A (p.Arg150=) rs121965079
NM_000260.3(MYO7A):c.4589C>T (p.Ser1530Leu) rs111033183
NM_000260.3(MYO7A):c.468C>T (p.Ile156=) rs12420129
NM_000260.3(MYO7A):c.4755C>T (p.Ser1585=) rs7927472
NM_000260.3(MYO7A):c.47T>C (p.Leu16Ser) rs1052030
NM_000260.3(MYO7A):c.4996A>T (p.Ser1666Cys) rs2276288
NM_000260.3(MYO7A):c.5326+13C>T rs114157944
NM_000260.3(MYO7A):c.5715A>G (p.Lys1905=) rs2276293
NM_000260.3(MYO7A):c.5743-12T>C rs2276291
NM_000260.3(MYO7A):c.5856+50G>A rs2276290
NM_000260.3(MYO7A):c.5857-7A>T rs1320703
NM_000260.3(MYO7A):c.5860C>A (p.Leu1954Ile) rs948962
NM_000260.3(MYO7A):c.6051+17T>A rs1320702
NM_000260.3(MYO7A):c.6438+50A>T rs2276289
NM_000260.3(MYO7A):c.6439-31G>A rs883223
NM_000260.3(MYO7A):c.6558+16G>A rs883224
NM_000260.3(MYO7A):c.6559-11C>T rs34517202
NM_000260.3(MYO7A):c.736-47C>A rs3737454
NM_000260.3(MYO7A):c.783T>C (p.Gly261=) rs762667
NM_000260.3(MYO7A):c.93C>T (p.Cys31=) rs35689081

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.