ClinVar Miner

List of variants in gene MYO7A reported by GeneDx

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 176
Download table as spreadsheet
HGVS dbSNP
NC_000011.10:g.77157232C>A
NC_000011.10:g.77159412C>G
NC_000011.10:g.77174733G>A
NC_000011.10:g.77183190G>C
NC_000011.10:g.77194559G>T
NC_000011.10:g.77207452G>A
NC_000011.10:g.77213085A>T
NM_000260.3(MYO7A):c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG rs111033223
NM_000260.4(MYO7A):c.1003+298C>G
NM_000260.4(MYO7A):c.1004-32T>C
NM_000260.4(MYO7A):c.1080+65T>C
NM_000260.4(MYO7A):c.1239G>A (p.Lys413=) rs782729773
NM_000260.4(MYO7A):c.1284C>T (p.Asn428=) rs573454806
NM_000260.4(MYO7A):c.133-6C>T rs376963984
NM_000260.4(MYO7A):c.133-7C>T rs111033221
NM_000260.4(MYO7A):c.1343+253C>G
NM_000260.4(MYO7A):c.1343+8G>A rs2276278
NM_000260.4(MYO7A):c.1353_1360del (p.Gln451fs) rs1555069242
NM_000260.4(MYO7A):c.1422G>A (p.Gln474=) rs201332147
NM_000260.4(MYO7A):c.1554+244T>C
NM_000260.4(MYO7A):c.1554+8G>A rs111033227
NM_000260.4(MYO7A):c.1555-5C>T rs569844918
NM_000260.4(MYO7A):c.1555-8C>G rs1057517774
NM_000260.4(MYO7A):c.1563del (p.Asp521fs) rs1064794012
NM_000260.4(MYO7A):c.1605C>T (p.Asn535=) rs111033228
NM_000260.4(MYO7A):c.1652T>C (p.Ile551Thr) rs1131691833
NM_000260.4(MYO7A):c.1690+262A>G
NM_000260.4(MYO7A):c.1690+80C>T
NM_000260.4(MYO7A):c.1691-126_1691-125insT
NM_000260.4(MYO7A):c.1797+283T>C
NM_000260.4(MYO7A):c.1820C>A (p.Ser607Ter) rs782598897
NM_000260.4(MYO7A):c.1854G>A (p.Leu618=) rs35429535
NM_000260.4(MYO7A):c.1871C>A (p.Thr624Lys) rs953533173
NM_000260.4(MYO7A):c.19-34G>A
NM_000260.4(MYO7A):c.1935+191A>T
NM_000260.4(MYO7A):c.1935+302C>T
NM_000260.4(MYO7A):c.1960C>T (p.Arg654Cys) rs201928014
NM_000260.4(MYO7A):c.2002C>T (p.Arg668Cys) rs397516292
NM_000260.4(MYO7A):c.2005C>T (p.Arg669Ter) rs111033201
NM_000260.4(MYO7A):c.2035G>A (p.Val679Ile) rs35641839
NM_000260.4(MYO7A):c.2187+1G>A rs111033290
NM_000260.4(MYO7A):c.2187+208G>A
NM_000260.4(MYO7A):c.2219G>C (p.Arg740Pro) rs782276748
NM_000260.4(MYO7A):c.2236G>A (p.Asp746Asn) rs36090425
NM_000260.4(MYO7A):c.2316A>G (p.Thr772=)
NM_000260.4(MYO7A):c.2367+225T>C
NM_000260.4(MYO7A):c.2367+269A>G
NM_000260.4(MYO7A):c.2367+67T>C
NM_000260.4(MYO7A):c.2447G>A (p.Arg816His) rs148343670
NM_000260.4(MYO7A):c.2527G>A (p.Val843Met) rs140559111
NM_000260.4(MYO7A):c.2558G>T (p.Arg853Leu) rs111033437
NM_000260.4(MYO7A):c.2694+134A>G
NM_000260.4(MYO7A):c.2694+58G>A
NM_000260.4(MYO7A):c.2695-58C>G
NM_000260.4(MYO7A):c.2697G>A (p.Glu899=) rs782531164
NM_000260.4(MYO7A):c.2754C>T (p.Ala918=) rs78072361
NM_000260.4(MYO7A):c.285+1G>C rs782661097
NM_000260.4(MYO7A):c.285+2T>C rs782292032
NM_000260.4(MYO7A):c.286-5C>T rs111033471
NM_000260.4(MYO7A):c.288G>A (p.Thr96=) rs56023295
NM_000260.4(MYO7A):c.2904G>T (p.Glu968Asp) rs111033233
NM_000260.4(MYO7A):c.2905-54A>G
NM_000260.4(MYO7A):c.3042G>T (p.Thr1014=) rs111033507
NM_000260.4(MYO7A):c.3064_3067del (p.Leu1022fs) rs1064796130
NM_000260.4(MYO7A):c.3109-68G>A
NM_000260.4(MYO7A):c.3246G>A (p.Thr1082=) rs35963362
NM_000260.4(MYO7A):c.324C>T (p.Tyr108=) rs116892396
NM_000260.4(MYO7A):c.338_348dup (p.Glu117fs) rs1064793208
NM_000260.4(MYO7A):c.3476G>T (p.Gly1159Val) rs199897298
NM_000260.4(MYO7A):c.3504-122G>A
NM_000260.4(MYO7A):c.3504-311G>A
NM_000260.4(MYO7A):c.3527G>A (p.Ser1176Asn) rs373147966
NM_000260.4(MYO7A):c.3570G>T (p.Arg1190=)
NM_000260.4(MYO7A):c.3719G>A (p.Arg1240Gln) rs111033178
NM_000260.4(MYO7A):c.3724C>T (p.Gln1242Ter) rs1057517857
NM_000260.4(MYO7A):c.3728C>T (p.Pro1243Leu) rs750358148
NM_000260.4(MYO7A):c.3750+5G>A rs111033391
NM_000260.4(MYO7A):c.3750+89C>T
NM_000260.4(MYO7A):c.3751-119_3751-118insGCTGGGGCCTGGAGC
NM_000260.4(MYO7A):c.3751-94C>G
NM_000260.4(MYO7A):c.3828G>A (p.Ser1276=) rs78871677
NM_000260.4(MYO7A):c.3864C>T (p.Ala1288=) rs144657938
NM_000260.4(MYO7A):c.388A>G (p.Met130Val) rs782473441
NM_000260.4(MYO7A):c.3924+109G>A
NM_000260.4(MYO7A):c.3925-169C>T
NM_000260.4(MYO7A):c.3925-243A>G
NM_000260.4(MYO7A):c.3925-8G>A rs367645097
NM_000260.4(MYO7A):c.3925-93C>G
NM_000260.4(MYO7A):c.4018G>A (p.Ala1340Thr) rs376291076
NM_000260.4(MYO7A):c.4023C>T (p.Pro1341=) rs73495790
NM_000260.4(MYO7A):c.4074C>T (p.Ser1358=) rs78996818
NM_000260.4(MYO7A):c.4074del (p.Glu1359fs) rs754104546
NM_000260.4(MYO7A):c.4153-7C>A rs369489756
NM_000260.4(MYO7A):c.4194A>G (p.Val1398=)
NM_000260.4(MYO7A):c.4323+156C>T
NM_000260.4(MYO7A):c.4324-202A>G
NM_000260.4(MYO7A):c.4324-207C>G
NM_000260.4(MYO7A):c.4441+19T>C rs11237114
NM_000260.4(MYO7A):c.4441+333C>A
NM_000260.4(MYO7A):c.4441+7C>T rs372493678
NM_000260.4(MYO7A):c.4442-113A>G
NM_000260.4(MYO7A):c.4442-7G>A
NM_000260.4(MYO7A):c.4461C>T (p.Asn1487=) rs56174006
NM_000260.4(MYO7A):c.448C>A (p.Arg150=) rs121965079
NM_000260.4(MYO7A):c.4569-261C>T
NM_000260.4(MYO7A):c.4589C>T (p.Ser1530Leu) rs111033183
NM_000260.4(MYO7A):c.468C>T (p.Ile156=) rs12420129
NM_000260.4(MYO7A):c.4697C>T (p.Thr1566Met) rs41298747
NM_000260.4(MYO7A):c.4698G>A (p.Thr1566=) rs200207753
NM_000260.4(MYO7A):c.470+6C>A rs370905994
NM_000260.4(MYO7A):c.470+96C>T
NM_000260.4(MYO7A):c.4757A>G (p.Asn1586Ser) rs201251963
NM_000260.4(MYO7A):c.4805G>A (p.Arg1602Gln) rs139889944
NM_000260.4(MYO7A):c.486C>T (p.Ala162=) rs367687624
NM_000260.4(MYO7A):c.4916C>T (p.Thr1639Met) rs200848641
NM_000260.4(MYO7A):c.494C>T (p.Thr165Met) rs111033174
NM_000260.4(MYO7A):c.4950C>T (p.Asn1650=) rs80033599
NM_000260.4(MYO7A):c.4992C>T (p.Thr1664=) rs181573957
NM_000260.4(MYO7A):c.5043+20C>T rs112969118
NM_000260.4(MYO7A):c.5044-247T>C
NM_000260.4(MYO7A):c.5095C>T (p.Gln1699Ter) rs530520654
NM_000260.4(MYO7A):c.510G>A (p.Leu170=) rs34477144
NM_000260.4(MYO7A):c.5156A>G (p.Tyr1719Cys) rs77625410
NM_000260.4(MYO7A):c.5166C>T (p.Phe1722=) rs566614598
NM_000260.4(MYO7A):c.5197G>A (p.Val1733Ile) rs1555103433
NM_000260.4(MYO7A):c.5253G>T (p.Pro1751=) rs377388669
NM_000260.4(MYO7A):c.5259G>A (p.Lys1753=) rs370062187
NM_000260.4(MYO7A):c.5324T>C (p.Ile1775Thr) rs115123584
NM_000260.4(MYO7A):c.5388C>T (p.Thr1796=)
NM_000260.4(MYO7A):c.5392C>T (p.Gln1798Ter) rs397516317
NM_000260.4(MYO7A):c.5480+162C>G
NM_000260.4(MYO7A):c.5481-83A>G
NM_000260.4(MYO7A):c.54G>C (p.Gln18His) rs371849195
NM_000260.4(MYO7A):c.5536C>G (p.Pro1846Ala) rs763456971
NM_000260.4(MYO7A):c.5598C>A (p.Leu1866=) rs111033504
NM_000260.4(MYO7A):c.5598C>T (p.Leu1866=) rs111033504
NM_000260.4(MYO7A):c.5619G>A (p.Arg1873=) rs45450893
NM_000260.4(MYO7A):c.5636+2T>A rs1057518040
NM_000260.4(MYO7A):c.5637-175A>G
NM_000260.4(MYO7A):c.5648G>A (p.Arg1883Gln) rs111033215
NM_000260.4(MYO7A):c.5688G>A (p.Gln1896=) rs570316231
NM_000260.4(MYO7A):c.5743-17C>T rs180929855
NM_000260.4(MYO7A):c.5743-262G>C
NM_000260.4(MYO7A):c.5857-7A>C rs1320703
NM_000260.4(MYO7A):c.5866G>A (p.Val1956Ile) rs142293185
NM_000260.4(MYO7A):c.5944+57G>A
NM_000260.4(MYO7A):c.5944+67C>T
NM_000260.4(MYO7A):c.5945-4G>A rs372510327
NM_000260.4(MYO7A):c.6002C>T (p.Thr2001Met) rs532542968
NM_000260.4(MYO7A):c.6027C>T (p.Ala2009=) rs140575390
NM_000260.4(MYO7A):c.6051+155T>C
NM_000260.4(MYO7A):c.6051+190T>G
NM_000260.4(MYO7A):c.6051+234C>G
NM_000260.4(MYO7A):c.6051+263G>A
NM_000260.4(MYO7A):c.6063G>A (p.Lys2021=) rs111033209
NM_000260.4(MYO7A):c.6165C>T (p.Ser2055=) rs397516327
NM_000260.4(MYO7A):c.618C>T (p.Arg206=) rs375851346
NM_000260.4(MYO7A):c.6230G>A (p.Trp2077Ter) rs776930594
NM_000260.4(MYO7A):c.6236G>A (p.Arg2079Gln) rs765083332
NM_000260.4(MYO7A):c.6240C>T (p.Ser2080=) rs41298757
NM_000260.4(MYO7A):c.6363G>A (p.Thr2121=) rs367738288
NM_000260.4(MYO7A):c.6424G>A (p.Asp2142Asn) rs1132036
NM_000260.4(MYO7A):c.6487G>A (p.Gly2163Ser) rs747656448
NM_000260.4(MYO7A):c.6509C>T (p.Thr2170Ile) rs544709413
NM_000260.4(MYO7A):c.6519C>T (p.Asn2173=) rs111033230
NM_000260.4(MYO7A):c.6558+51G>T
NM_000260.4(MYO7A):c.6559-11C>T rs34517202
NM_000260.4(MYO7A):c.6559-257T>C
NM_000260.4(MYO7A):c.6614_6634dup (p.Met2205_Ser2211dup) rs111033388
NM_000260.4(MYO7A):c.6640G>A (p.Gly2214Ser) rs111033231
NM_000260.4(MYO7A):c.676G>A (p.Ala226Thr) rs201753022
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135
NM_000260.4(MYO7A):c.910G>A (p.Ala304Thr) rs782124327
NM_000260.4(MYO7A):c.93C>T (p.Cys31=) rs35689081
NM_000260.4(MYO7A):c.977T>A (p.Leu326Gln) rs797044491
NM_000260.4(MYO7A):c.999T>G (p.Tyr333Ter) rs111033285

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.