ClinVar Miner

List of variants in gene MYO7A reported as benign by GeneDx

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 82
Download table as spreadsheet
HGVS dbSNP
NM_000260.3(MYO7A):c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG rs111033223
NM_000260.4(MYO7A):c.1003+298C>G
NM_000260.4(MYO7A):c.1004-32T>C
NM_000260.4(MYO7A):c.1004-35C>G rs2071151
NM_000260.4(MYO7A):c.1080+65T>C
NM_000260.4(MYO7A):c.133-7C>T rs111033221
NM_000260.4(MYO7A):c.1343+253C>G
NM_000260.4(MYO7A):c.1343+8G>A rs2276278
NM_000260.4(MYO7A):c.1554+244T>C
NM_000260.4(MYO7A):c.1605C>T (p.Asn535=) rs111033228
NM_000260.4(MYO7A):c.1690+262A>G
NM_000260.4(MYO7A):c.1691-126_1691-125insT
NM_000260.4(MYO7A):c.1797+283T>C
NM_000260.4(MYO7A):c.1935+191A>T
NM_000260.4(MYO7A):c.1936-23G>A rs2276283
NM_000260.4(MYO7A):c.2035G>A (p.Val679Ile) rs35641839
NM_000260.4(MYO7A):c.2187+208G>A
NM_000260.4(MYO7A):c.2367+225T>C
NM_000260.4(MYO7A):c.2367+269A>G
NM_000260.4(MYO7A):c.2367+67T>C
NM_000260.4(MYO7A):c.2694+134A>G
NM_000260.4(MYO7A):c.2694+58G>A
NM_000260.4(MYO7A):c.2695-58C>G
NM_000260.4(MYO7A):c.2754C>T (p.Ala918=) rs78072361
NM_000260.4(MYO7A):c.286-5C>T rs111033471
NM_000260.4(MYO7A):c.288G>A (p.Thr96=) rs56023295
NM_000260.4(MYO7A):c.2905-54A>G
NM_000260.4(MYO7A):c.3109-68G>A
NM_000260.4(MYO7A):c.3375+33G>C rs948972
NM_000260.4(MYO7A):c.3504-122G>A
NM_000260.4(MYO7A):c.3504-311G>A
NM_000260.4(MYO7A):c.3750+89C>T
NM_000260.4(MYO7A):c.3751-119_3751-118insGCTGGGGCCTGGAGC
NM_000260.4(MYO7A):c.3751-94C>G
NM_000260.4(MYO7A):c.3828G>A (p.Ser1276=) rs78871677
NM_000260.4(MYO7A):c.3924+109G>A
NM_000260.4(MYO7A):c.3925-169C>T
NM_000260.4(MYO7A):c.3925-243A>G
NM_000260.4(MYO7A):c.3925-93C>G
NM_000260.4(MYO7A):c.4023C>T (p.Pro1341=) rs73495790
NM_000260.4(MYO7A):c.4074C>T (p.Ser1358=) rs78996818
NM_000260.4(MYO7A):c.4323+156C>T
NM_000260.4(MYO7A):c.4323+35G>T rs1109977
NM_000260.4(MYO7A):c.4324-202A>G
NM_000260.4(MYO7A):c.4324-207C>G
NM_000260.4(MYO7A):c.4441+19T>C rs11237114
NM_000260.4(MYO7A):c.4441+333C>A
NM_000260.4(MYO7A):c.4442-113A>G
NM_000260.4(MYO7A):c.4461C>T (p.Asn1487=) rs56174006
NM_000260.4(MYO7A):c.4569-261C>T
NM_000260.4(MYO7A):c.4589C>T (p.Ser1530Leu) rs111033183
NM_000260.4(MYO7A):c.468C>T (p.Ile156=) rs12420129
NM_000260.4(MYO7A):c.470+96C>T
NM_000260.4(MYO7A):c.4805G>A (p.Arg1602Gln) rs139889944
NM_000260.4(MYO7A):c.4950C>T (p.Asn1650=) rs80033599
NM_000260.4(MYO7A):c.5043+20C>T rs112969118
NM_000260.4(MYO7A):c.5044-247T>C
NM_000260.4(MYO7A):c.5156A>G (p.Tyr1719Cys) rs77625410
NM_000260.4(MYO7A):c.5480+162C>G
NM_000260.4(MYO7A):c.5481-83A>G
NM_000260.4(MYO7A):c.5619G>A (p.Arg1873=) rs45450893
NM_000260.4(MYO7A):c.5637-175A>G
NM_000260.4(MYO7A):c.5743-17C>T rs180929855
NM_000260.4(MYO7A):c.5743-262G>C
NM_000260.4(MYO7A):c.5856+50G>A rs2276290
NM_000260.4(MYO7A):c.5944+57G>A
NM_000260.4(MYO7A):c.5944+67C>T
NM_000260.4(MYO7A):c.6051+155T>C
NM_000260.4(MYO7A):c.6051+190T>G
NM_000260.4(MYO7A):c.6051+234C>G
NM_000260.4(MYO7A):c.6051+263G>A
NM_000260.4(MYO7A):c.6063G>A (p.Lys2021=) rs111033209
NM_000260.4(MYO7A):c.6240C>T (p.Ser2080=) rs41298757
NM_000260.4(MYO7A):c.6424G>A (p.Asp2142Asn) rs1132036
NM_000260.4(MYO7A):c.6438+50A>T rs2276289
NM_000260.4(MYO7A):c.6519C>T (p.Asn2173=) rs111033230
NM_000260.4(MYO7A):c.6558+51G>T
NM_000260.4(MYO7A):c.6559-11C>T rs34517202
NM_000260.4(MYO7A):c.6559-257T>C
NM_000260.4(MYO7A):c.6640G>A (p.Gly2214Ser) rs111033231
NM_000260.4(MYO7A):c.736-47C>A rs3737454
NM_000260.4(MYO7A):c.93C>T (p.Cys31=) rs35689081

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.