ClinVar Miner

List of variants in gene MYO7A reported by EGL Genetic Diagnostics,Eurofins Clinical Diagnostics

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 116
Download table as spreadsheet
HGVS dbSNP
NM_000260.3(MYO7A):c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG rs111033223
NM_000260.4(MYO7A):c.*8C>T rs370206645
NM_000260.4(MYO7A):c.1007G>A (p.Arg336His) rs45629132
NM_000260.4(MYO7A):c.1056G>A (p.Leu352=) rs886044867
NM_000260.4(MYO7A):c.1091C>A (p.Pro364Gln) rs782441745
NM_000260.4(MYO7A):c.1208A>G (p.Tyr403Cys) rs797044511
NM_000260.4(MYO7A):c.1209C>T (p.Tyr403=) rs782397746
NM_000260.4(MYO7A):c.1288C>T (p.Arg430Cys) rs201839693
NM_000260.4(MYO7A):c.1299C>T (p.Ile433=) rs782163200
NM_000260.4(MYO7A):c.133-7C>T rs111033221
NM_000260.4(MYO7A):c.133G>T (p.Glu45Ter) rs368877140
NM_000260.4(MYO7A):c.1554+7C>T rs150114658
NM_000260.4(MYO7A):c.1554+8G>A rs111033227
NM_000260.4(MYO7A):c.1605C>T (p.Asn535=) rs111033228
NM_000260.4(MYO7A):c.1854G>A (p.Leu618=) rs35429535
NM_000260.4(MYO7A):c.2005C>T (p.Arg669Ter) rs111033201
NM_000260.4(MYO7A):c.2006G>A (p.Arg669Gln) rs201178011
NM_000260.4(MYO7A):c.2025C>T (p.Arg675=) rs797044658
NM_000260.4(MYO7A):c.2035G>A (p.Val679Ile) rs35641839
NM_000260.4(MYO7A):c.2088C>T (p.Tyr696=)
NM_000260.4(MYO7A):c.2097C>T (p.Gly699=) rs373495082
NM_000260.4(MYO7A):c.2208G>A (p.Leu736=) rs373599360
NM_000260.4(MYO7A):c.2236G>A (p.Asp746Asn) rs36090425
NM_000260.4(MYO7A):c.2293C>A (p.Leu765Met) rs201203036
NM_000260.4(MYO7A):c.2340T>G (p.Gly780=) rs782747237
NM_000260.4(MYO7A):c.2348G>A (p.Cys783Tyr) rs376014415
NM_000260.4(MYO7A):c.2427G>T (p.Gln809His) rs782650544
NM_000260.4(MYO7A):c.2447G>A (p.Arg816His) rs148343670
NM_000260.4(MYO7A):c.2527G>A (p.Val843Met) rs140559111
NM_000260.4(MYO7A):c.2558G>A (p.Arg853His) rs111033437
NM_000260.4(MYO7A):c.2572C>T (p.Arg858Cys) rs797044681
NM_000260.4(MYO7A):c.2617C>T (p.Arg873Trp) rs200454015
NM_000260.4(MYO7A):c.2798G>A (p.Arg933His) rs201489714
NM_000260.4(MYO7A):c.2827G>A (p.Val943Met) rs782008236
NM_000260.4(MYO7A):c.2886G>C (p.Gln962His) rs200641606
NM_000260.4(MYO7A):c.3038C>T (p.Thr1013Ile) rs369539923
NM_000260.4(MYO7A):c.3086A>G (p.His1029Arg) rs60103800
NM_000260.4(MYO7A):c.3134T>C (p.Ile1045Thr) rs377326213
NM_000260.4(MYO7A):c.3283G>A (p.Glu1095Lys) rs199810429
NM_000260.4(MYO7A):c.3297C>T (p.Pro1099=) rs367668576
NM_000260.4(MYO7A):c.3404C>A (p.Ser1135Tyr) rs376688581
NM_000260.4(MYO7A):c.3476G>T (p.Gly1159Val) rs199897298
NM_000260.4(MYO7A):c.3503+17G>A rs369969967
NM_000260.4(MYO7A):c.3527G>A (p.Ser1176Asn) rs373147966
NM_000260.4(MYO7A):c.3582C>T (p.Leu1194=) rs886044828
NM_000260.4(MYO7A):c.3595G>A (p.Val1199Met)
NM_000260.4(MYO7A):c.3729G>A (p.Pro1243=) rs727504023
NM_000260.4(MYO7A):c.3750+5G>A rs111033391
NM_000260.4(MYO7A):c.3750+7G>A rs397516305
NM_000260.4(MYO7A):c.3750+9G>A rs111033252
NM_000260.4(MYO7A):c.3927G>T (p.Val1309=) rs181729570
NM_000260.4(MYO7A):c.398A>C (p.His133Pro) rs886044805
NM_000260.4(MYO7A):c.39C>A (p.Asp13Glu) rs199989979
NM_000260.4(MYO7A):c.401T>C (p.Ile134Thr) rs111033181
NM_000260.4(MYO7A):c.4066A>T (p.Ser1356Cys) rs201195495
NM_000260.4(MYO7A):c.4074C>T (p.Ser1358=) rs78996818
NM_000260.4(MYO7A):c.4192G>A (p.Val1398Ile) rs369189548
NM_000260.4(MYO7A):c.4222C>T (p.Arg1408Cys) rs377391891
NM_000260.4(MYO7A):c.4225del (p.Leu1409fs) rs1398609491
NM_000260.4(MYO7A):c.4441+7C>T rs372493678
NM_000260.4(MYO7A):c.4441+8G>A rs766743441
NM_000260.4(MYO7A):c.4461C>T (p.Asn1487=) rs56174006
NM_000260.4(MYO7A):c.4544_4551delinsCA (p.Glu1515_Met1517delinsAla) rs111033259
NM_000260.4(MYO7A):c.4589C>T (p.Ser1530Leu) rs111033183
NM_000260.4(MYO7A):c.468C>T (p.Ile156=) rs12420129
NM_000260.4(MYO7A):c.4697C>T (p.Thr1566Met) rs41298747
NM_000260.4(MYO7A):c.4755C>T (p.Ser1585=) rs7927472
NM_000260.4(MYO7A):c.4757A>G (p.Asn1586Ser) rs201251963
NM_000260.4(MYO7A):c.47T>C (p.Leu16Ser) rs1052030
NM_000260.4(MYO7A):c.4805G>A (p.Arg1602Gln) rs139889944
NM_000260.4(MYO7A):c.4845C>A (p.Pro1615=) rs61900036
NM_000260.4(MYO7A):c.4851C>T (p.Pro1617=) rs372535399
NM_000260.4(MYO7A):c.4973A>G (p.Gln1658Arg) rs1565464627
NM_000260.4(MYO7A):c.4992C>T (p.Thr1664=) rs181573957
NM_000260.4(MYO7A):c.4996A>T (p.Ser1666Cys) rs2276288
NM_000260.4(MYO7A):c.5004C>T (p.Tyr1668=) rs1479835169
NM_000260.4(MYO7A):c.500G>C (p.Ser167Thr) rs886044857
NM_000260.4(MYO7A):c.5033G>A (p.Arg1678Gln) rs371115266
NM_000260.4(MYO7A):c.5108C>T (p.Ala1703Val) rs199561332
NM_000260.4(MYO7A):c.510G>A (p.Leu170=) rs34477144
NM_000260.4(MYO7A):c.5156A>G (p.Tyr1719Cys) rs77625410
NM_000260.4(MYO7A):c.5169-6C>T rs768594224
NM_000260.4(MYO7A):c.5215C>A (p.Arg1739=) rs111033477
NM_000260.4(MYO7A):c.5227C>A (p.Arg1743=) rs111033287
NM_000260.4(MYO7A):c.5227C>T (p.Arg1743Trp) rs111033287
NM_000260.4(MYO7A):c.5253G>T (p.Pro1751=) rs377388669
NM_000260.4(MYO7A):c.5324T>C (p.Ile1775Thr) rs115123584
NM_000260.4(MYO7A):c.5480+10G>A rs768513428
NM_000260.4(MYO7A):c.5494C>T (p.Arg1832Trp) rs748080151
NM_000260.4(MYO7A):c.5589C>G (p.His1863Gln) rs727504024
NM_000260.4(MYO7A):c.5598C>A (p.Leu1866=) rs111033504
NM_000260.4(MYO7A):c.5618G>A (p.Arg1873Gln) rs397516322
NM_000260.4(MYO7A):c.5688G>A (p.Gln1896=) rs570316231
NM_000260.4(MYO7A):c.578C>T (p.Thr193Ile) rs1188616455
NM_000260.4(MYO7A):c.5835C>T (p.Leu1945=) rs111033476
NM_000260.4(MYO7A):c.5857-7A>T rs1320703
NM_000260.4(MYO7A):c.5860C>A (p.Leu1954Ile) rs948962
NM_000260.4(MYO7A):c.5860C>G (p.Leu1954Val) rs948962
NM_000260.4(MYO7A):c.5866G>A (p.Val1956Ile) rs142293185
NM_000260.4(MYO7A):c.5896G>A (p.Val1966Ile) rs371313080
NM_000260.4(MYO7A):c.5944G>A (p.Gly1982Arg) rs761469964
NM_000260.4(MYO7A):c.5968C>T (p.Gln1990Ter) rs773844428
NM_000260.4(MYO7A):c.614T>C (p.Ile205Thr) rs200241993
NM_000260.4(MYO7A):c.6165C>T (p.Ser2055=) rs397516327
NM_000260.4(MYO7A):c.6214G>A (p.Val2072Ile) rs200313391
NM_000260.4(MYO7A):c.6326C>T (p.Thr2109Ile) rs377670513
NM_000260.4(MYO7A):c.640G>A (p.Gly214Arg) rs111033283
NM_000260.4(MYO7A):c.6424G>A (p.Asp2142Asn) rs1132036
NM_000260.4(MYO7A):c.6614_6634dup (p.Met2205_Ser2211dup) rs111033388
NM_000260.4(MYO7A):c.676G>A (p.Ala226Thr) rs201753022
NM_000260.4(MYO7A):c.731G>A (p.Arg244His) rs121965081
NM_000260.4(MYO7A):c.783T>C (p.Gly261=) rs762667
NM_000260.4(MYO7A):c.803A>G (p.Lys268Arg) rs184866544
NM_000260.4(MYO7A):c.849+7C>G rs370740228
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135
NM_000260.4(MYO7A):c.999T>G (p.Tyr333Ter) rs111033285

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.