ClinVar Miner

List of variants in gene MYO7A reported as benign by EGL Genetic Diagnostics,Eurofins Clinical Diagnostics

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 22
Download table as spreadsheet
HGVS dbSNP
NM_000260.3(MYO7A):c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG rs111033223
NM_000260.4(MYO7A):c.133-7C>T rs111033221
NM_000260.4(MYO7A):c.1605C>T (p.Asn535=) rs111033228
NM_000260.4(MYO7A):c.2035G>A (p.Val679Ile) rs35641839
NM_000260.4(MYO7A):c.2236G>A (p.Asp746Asn) rs36090425
NM_000260.4(MYO7A):c.4074C>T (p.Ser1358=) rs78996818
NM_000260.4(MYO7A):c.4461C>T (p.Asn1487=) rs56174006
NM_000260.4(MYO7A):c.4589C>T (p.Ser1530Leu) rs111033183
NM_000260.4(MYO7A):c.468C>T (p.Ile156=) rs12420129
NM_000260.4(MYO7A):c.4697C>T (p.Thr1566Met) rs41298747
NM_000260.4(MYO7A):c.4755C>T (p.Ser1585=) rs7927472
NM_000260.4(MYO7A):c.47T>C (p.Leu16Ser) rs1052030
NM_000260.4(MYO7A):c.4992C>T (p.Thr1664=) rs181573957
NM_000260.4(MYO7A):c.4996A>T (p.Ser1666Cys) rs2276288
NM_000260.4(MYO7A):c.5156A>G (p.Tyr1719Cys) rs77625410
NM_000260.4(MYO7A):c.5215C>A (p.Arg1739=) rs111033477
NM_000260.4(MYO7A):c.5835C>T (p.Leu1945=) rs111033476
NM_000260.4(MYO7A):c.5857-7A>T rs1320703
NM_000260.4(MYO7A):c.5860C>A (p.Leu1954Ile) rs948962
NM_000260.4(MYO7A):c.5866G>A (p.Val1956Ile) rs142293185
NM_000260.4(MYO7A):c.6424G>A (p.Asp2142Asn) rs1132036
NM_000260.4(MYO7A):c.783T>C (p.Gly261=) rs762667

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.