ClinVar Miner

List of variants in gene MYO7A reported by ClinGen Hearing Loss Variant Curation Expert Panel

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 22
Download table as spreadsheet
HGVS dbSNP
NM_000260.3(MYO7A):c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG rs111033223
NM_000260.4(MYO7A):c.1007G>A (p.Arg336His) rs45629132
NM_000260.4(MYO7A):c.1208A>G (p.Tyr403Cys) rs797044511
NM_000260.4(MYO7A):c.1817G>A (p.Arg606His) rs782311929
NM_000260.4(MYO7A):c.1849T>C (p.Ser617Pro) rs782063761
NM_000260.4(MYO7A):c.1997G>A (p.Arg666Gln) rs782396605
NM_000260.4(MYO7A):c.2476G>A (p.Ala826Thr) rs368341987
NM_000260.4(MYO7A):c.2527G>A (p.Val843Met) rs140559111
NM_000260.4(MYO7A):c.2558G>A (p.Arg853His) rs111033437
NM_000260.4(MYO7A):c.324C>T (p.Tyr108=) rs116892396
NM_000260.4(MYO7A):c.3491G>A (p.Arg1164Gln) rs782350886
NM_000260.4(MYO7A):c.3503G>A (p.Arg1168Gln) rs797044516
NM_000260.4(MYO7A):c.3527G>A (p.Ser1176Asn) rs373147966
NM_000260.4(MYO7A):c.3546C>A (p.Asn1182Lys) rs1555090294
NM_000260.4(MYO7A):c.3827C>T (p.Ser1276Leu) rs369458838
NM_000260.4(MYO7A):c.4115T>G (p.Val1372Gly) rs869312181
NM_000260.4(MYO7A):c.5618G>A (p.Arg1873Gln) rs397516322
NM_000260.4(MYO7A):c.6062A>G (p.Lys2021Arg) rs876657655
NM_000260.4(MYO7A):c.631A>G (p.Ser211Gly) rs111033486
NM_000260.4(MYO7A):c.6326C>T (p.Thr2109Ile) rs377670513
NM_000260.4(MYO7A):c.6560G>A (p.Gly2187Asp) rs397516332
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.