ClinVar Miner

List of variants in gene MYOM1

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 288
Download table as spreadsheet
HGVS dbSNP
NC_000018.10:g.(?_3168817)_(3168981_?)dup
NM_003803.3(MYOM1):c.*10C>T rs876657915
NM_003803.3(MYOM1):c.-9G>A rs1662315
NM_003803.3(MYOM1):c.1022G>C (p.Gly341Ala) rs8099021
NM_003803.3(MYOM1):c.1022_1022+1delGGinsCA rs1555627004
NM_003803.3(MYOM1):c.1023-14G>A rs372359086
NM_003803.3(MYOM1):c.1051C>T (p.Arg351Trp) rs375848036
NM_003803.3(MYOM1):c.1058C>T (p.Ser353Leu)
NM_003803.3(MYOM1):c.1062G>A (p.Ala354=) rs763462534
NM_003803.3(MYOM1):c.1067A>G (p.Asn356Ser) rs773694035
NM_003803.3(MYOM1):c.1086G>C (p.Ser362=) rs371620091
NM_003803.3(MYOM1):c.110C>T (p.Ala37Val) rs375155656
NM_003803.3(MYOM1):c.1112-11T>C rs59555146
NM_003803.3(MYOM1):c.1112-4C>T rs138604278
NM_003803.3(MYOM1):c.1125G>A (p.Glu375=) rs1060504723
NM_003803.3(MYOM1):c.1139G>A (p.Arg380His)
NM_003803.3(MYOM1):c.1146C>T (p.His382=) rs2230163
NM_003803.3(MYOM1):c.1160C>T (p.Thr387Ile) rs189973743
NM_003803.3(MYOM1):c.1168C>T (p.Leu390Phe)
NM_003803.3(MYOM1):c.1175-4C>A rs1437226766
NM_003803.3(MYOM1):c.1175_1339[3] (p.Asn446_Gly447insValGlyValThrProTyrGlyTyrAlaSerArgPheGluIleHisPheAspAspLysPheAspValSerPheGlyArgGluGlyGluThrMetSerLeuGlyCysArgValValIleThrProGluIleLysHisPheGlnProGluIleGlnTrpTyrArgAsnValGlyValThrProTyrGlyTyrAlaSerArgPheGluIleHisPheAspAspL...(Total 360))
NM_003803.3(MYOM1):c.117C>T (p.Tyr39=) rs375113650
NM_003803.3(MYOM1):c.1204C>T (p.Arg402Trp)
NM_003803.3(MYOM1):c.120C>G (p.Thr40=) rs876657535
NM_003803.3(MYOM1):c.1222G>A (p.Asp408Asn)
NM_003803.3(MYOM1):c.1235A>G (p.Asp412Gly) rs767444514
NM_003803.3(MYOM1):c.1235A>T (p.Asp412Val)
NM_003803.3(MYOM1):c.1279C>T (p.Arg427Cys) rs376648139
NM_003803.3(MYOM1):c.1288A>G (p.Ile430Val) rs764996297
NM_003803.3(MYOM1):c.1338C>T (p.Asn446=) rs2230167
NM_003803.3(MYOM1):c.1340-14delT rs554705715
NM_003803.3(MYOM1):c.1340-4C>A rs534659625
NM_003803.3(MYOM1):c.1358C>T (p.Ser453Leu) rs368424215
NM_003803.3(MYOM1):c.1362A>G (p.Lys454=) rs778965112
NM_003803.3(MYOM1):c.136T>C (p.Tyr46His) rs201544310
NM_003803.3(MYOM1):c.1370A>G (p.Gln457Arg) rs757169901
NM_003803.3(MYOM1):c.1392G>A (p.Arg464=) rs11659820
NM_003803.3(MYOM1):c.1397C>T (p.Thr466Met) rs561012778
NM_003803.3(MYOM1):c.139A>G (p.Ser47Gly) rs202145133
NM_003803.3(MYOM1):c.1424A>C (p.Glu475Ala)
NM_003803.3(MYOM1):c.142A>T (p.Ser48Cys) rs1234403854
NM_003803.3(MYOM1):c.1438T>C (p.Tyr480His) rs763945524
NM_003803.3(MYOM1):c.1442C>G (p.Thr481Arg) rs370177143
NM_003803.3(MYOM1):c.1453C>T (p.Arg485Trp)
NM_003803.3(MYOM1):c.1455G>C (p.Arg485=) rs193006519
NM_003803.3(MYOM1):c.1466A>G (p.Tyr489Cys) rs369422118
NM_003803.3(MYOM1):c.158C>T (p.Ala53Val) rs747035411
NM_003803.3(MYOM1):c.1606G>A (p.Asp536Asn) rs367903122
NM_003803.3(MYOM1):c.1612G>A (p.Gly538Arg) rs374025340
NM_003803.3(MYOM1):c.1668delG (p.Trp556Cysfs) rs876657916
NM_003803.3(MYOM1):c.1725C>A (p.Ile575=) rs780564541
NM_003803.3(MYOM1):c.1733G>A (p.Arg578His) rs200374196
NM_003803.3(MYOM1):c.1733G>T (p.Arg578Leu) rs200374196
NM_003803.3(MYOM1):c.1736C>T (p.Ser579Phe) rs185573271
NM_003803.3(MYOM1):c.1747C>T (p.Arg583Ter) rs765191680
NM_003803.3(MYOM1):c.175G>A (p.Glu59Lys) rs878854614
NM_003803.3(MYOM1):c.1797C>T (p.Ser599=) rs370022510
NM_003803.3(MYOM1):c.1799A>T (p.Glu600Val) rs9807556
NM_003803.3(MYOM1):c.1803C>T (p.Pro601=) rs371861150
NM_003803.3(MYOM1):c.1813C>G (p.Leu605Val) rs200153557
NM_003803.3(MYOM1):c.1843+10T>G rs116743447
NM_003803.3(MYOM1):c.184C>T (p.Arg62Cys) rs766972653
NM_003803.3(MYOM1):c.1878T>C (p.Ile626=) rs180916932
NM_003803.3(MYOM1):c.1890G>A (p.Glu630=) rs36098676
NM_003803.3(MYOM1):c.1900+3A>C rs77613865
NM_003803.3(MYOM1):c.1900+6_1900+8delAAG rs754148244
NM_003803.3(MYOM1):c.1901-14T>C rs200115559
NM_003803.3(MYOM1):c.1901-4T>G rs1054418598
NM_003803.3(MYOM1):c.1911G>A (p.Val637=) rs1166836325
NM_003803.3(MYOM1):c.1917C>T (p.Gly639=) rs761762328
NM_003803.3(MYOM1):c.192G>T (p.Ala64=) rs9964300
NM_003803.3(MYOM1):c.1952G>A (p.Arg651Gln) rs184721031
NM_003803.3(MYOM1):c.1965G>A (p.Val655=) rs998287871
NM_003803.3(MYOM1):c.1978C>G (p.Pro660Ala) rs201104206
NM_003803.3(MYOM1):c.1991G>A (p.Arg664His) rs373489373
NM_003803.3(MYOM1):c.2023A>G (p.Lys675Glu) rs200179081
NM_003803.3(MYOM1):c.2025+10T>G rs972434580
NM_003803.3(MYOM1):c.2062A>T (p.Thr688Ser) rs188677538
NM_003803.3(MYOM1):c.2064G>A (p.Thr688=) rs374462999
NM_003803.3(MYOM1):c.2079G>A (p.Lys693=) rs1014448013
NM_003803.3(MYOM1):c.2086C>T (p.Arg696Cys) rs757565820
NM_003803.3(MYOM1):c.2087G>A (p.Arg696His) rs767192545
NM_003803.3(MYOM1):c.2110G>A (p.Glu704Lys) rs149528866
NM_003803.3(MYOM1):c.2132G>A (p.Arg711His)
NM_003803.3(MYOM1):c.2137C>T (p.Arg713Cys) rs375858580
NM_003803.3(MYOM1):c.2138G>A (p.Arg713His) rs183881662
NM_003803.3(MYOM1):c.2179A>G (p.Thr727Ala) rs115382168
NM_003803.3(MYOM1):c.2181G>A (p.Thr727=) rs180910875
NM_003803.3(MYOM1):c.2209+4A>G
NM_003803.3(MYOM1):c.2210-4T>G rs143030509
NM_003803.3(MYOM1):c.2221G>C (p.Ala741Pro) rs546357155
NM_003803.3(MYOM1):c.2295C>T (p.Ala765=) rs927104464
NM_003803.3(MYOM1):c.2311_2324delTACTACATAGAGGCinsCACT (p.Tyr771Hisfs) rs1555621545
NM_003803.3(MYOM1):c.2324C>A (p.Ala775Glu) rs765961982
NM_003803.3(MYOM1):c.2350G>A (p.Glu784Lys) rs368949465
NM_003803.3(MYOM1):c.2367C>G (p.Asn789Lys) rs773582739
NM_003803.3(MYOM1):c.2383C>G (p.Arg795Gly) rs201618512
NM_003803.3(MYOM1):c.2384+4A>T rs73373171
NM_003803.3(MYOM1):c.2385-13G>A rs116126674
NM_003803.3(MYOM1):c.2385-9T>C rs199829674
NM_003803.3(MYOM1):c.2469C>G (p.Ser823=) rs370860519
NM_003803.3(MYOM1):c.2506+15C>G rs1272570164
NM_003803.3(MYOM1):c.2507-16_2507-14delTGT rs147985558
NM_003803.3(MYOM1):c.251G>C (p.Arg84Pro) rs756788476
NM_003803.3(MYOM1):c.2574G>C (p.Arg858Ser) rs1422382078
NM_003803.3(MYOM1):c.2581G>A (p.Val861Met)
NM_003803.3(MYOM1):c.2582T>G (p.Val861Gly)
NM_003803.3(MYOM1):c.2598G>A (p.Pro866=) rs778413922
NM_003803.3(MYOM1):c.2607C>G (p.Phe869Leu) rs1555620828
NM_003803.3(MYOM1):c.2625T>C (p.Leu875=) rs79149418
NM_003803.3(MYOM1):c.263C>T (p.Ser88Leu) rs758070531
NM_003803.3(MYOM1):c.2653C>G (p.Pro885Ala) rs764303814
NM_003803.3(MYOM1):c.2656A>G (p.Ser886Gly) rs199900004
NM_003803.3(MYOM1):c.2673G>C (p.Leu891=) rs115240600
NM_003803.3(MYOM1):c.2697A>C (p.Val899=) rs771666952
NM_003803.3(MYOM1):c.2715A>G (p.Glu905=) rs200170795
NM_003803.3(MYOM1):c.2717A>C (p.Glu906Ala) rs760763098
NM_003803.3(MYOM1):c.2727G>A (p.Pro909=) rs72860212
NM_003803.3(MYOM1):c.2750_2751delAG (p.Gln917Argfs) rs1555620787
NM_003803.3(MYOM1):c.2802A>G (p.Pro934=) rs79397275
NM_003803.3(MYOM1):c.281C>G (p.Ser94Cys) rs761148558
NM_003803.3(MYOM1):c.2848A>G (p.Met950Val) rs184774935
NM_003803.3(MYOM1):c.2851G>T (p.Val951Phe) rs573023709
NM_003803.3(MYOM1):c.2875A>G (p.Lys959Glu) rs192365952
NM_003803.3(MYOM1):c.2877G>A (p.Lys959=) rs755157204
NM_003803.3(MYOM1):c.2879T>C (p.Ile960Thr) rs1071600
NM_003803.3(MYOM1):c.2895T>C (p.Ile965=) rs1453527364
NM_003803.3(MYOM1):c.290+14C>G rs7232679
NM_003803.3(MYOM1):c.290G>T (p.Gly97Val) rs568600892
NM_003803.3(MYOM1):c.2920G>A (p.Glu974Lys) rs774931774
NM_003803.3(MYOM1):c.2975G>T (p.Ser992Ile)
NM_003803.3(MYOM1):c.297A>G (p.Thr99=) rs369402806
NM_003803.3(MYOM1):c.2991+8C>A rs138916150
NM_003803.3(MYOM1):c.3003G>A (p.Leu1001=) rs754487227
NM_003803.3(MYOM1):c.3010A>G (p.Asn1004Asp) rs543434883
NM_003803.3(MYOM1):c.3038C>T (p.Ala1013Val) rs557671408
NM_003803.3(MYOM1):c.3063G>A (p.Ala1021=) rs373744359
NM_003803.3(MYOM1):c.3084C>T (p.Cys1028=) rs750152279
NM_003803.3(MYOM1):c.3097G>A (p.Glu1033Lys) rs377512048
NM_003803.3(MYOM1):c.3097G>T (p.Glu1033Ter) rs377512048
NM_003803.3(MYOM1):c.3109G>A (p.Ala1037Thr) rs199817096
NM_003803.3(MYOM1):c.3125C>T (p.Pro1042Leu) rs761951856
NM_003803.3(MYOM1):c.3129C>T (p.His1043=) rs372294428
NM_003803.3(MYOM1):c.315A>C (p.Leu105Phe) rs991834729
NM_003803.3(MYOM1):c.3183G>A (p.Pro1061=) rs374873325
NM_003803.3(MYOM1):c.3189C>G (p.Val1063=) rs1060504727
NM_003803.3(MYOM1):c.3190C>T (p.His1064Tyr) rs755409090
NM_003803.3(MYOM1):c.3195C>G (p.Ser1065=) rs185366609
NM_003803.3(MYOM1):c.3207G>A (p.Pro1069=) rs367633441
NM_003803.3(MYOM1):c.3223G>A (p.Val1075Met) rs371066861
NM_003803.3(MYOM1):c.3231G>A (p.Leu1077=) rs1060504724
NM_003803.3(MYOM1):c.3243G>A (p.Lys1081=) rs1060504726
NM_003803.3(MYOM1):c.3244G>A (p.Ala1082Thr) rs968079688
NM_003803.3(MYOM1):c.3245C>G (p.Ala1082Gly)
NM_003803.3(MYOM1):c.3278C>T (p.Ala1093Val) rs749676865
NM_003803.3(MYOM1):c.3291C>T (p.Asn1097=) rs201092091
NM_003803.3(MYOM1):c.329C>T (p.Ser110Phe)
NM_003803.3(MYOM1):c.3300G>A (p.Leu1100=) rs373624207
NM_003803.3(MYOM1):c.3308G>A (p.Arg1103Gln) rs186972208
NM_003803.3(MYOM1):c.3325G>A (p.Val1109Ile) rs377448983
NM_003803.3(MYOM1):c.335T>G (p.Leu112Trp) rs868781965
NM_003803.3(MYOM1):c.3388G>T (p.Ala1130Ser) rs375291963
NM_003803.3(MYOM1):c.3412C>T (p.Arg1138Cys) rs200710899
NM_003803.3(MYOM1):c.3413G>A (p.Arg1138His) rs148782330
NM_003803.3(MYOM1):c.3419G>A (p.Gly1140Glu) rs375843420
NM_003803.3(MYOM1):c.3453T>A (p.Asp1151Glu) rs143879853
NM_003803.3(MYOM1):c.3475G>A (p.Glu1159Lys) rs764808541
NM_003803.3(MYOM1):c.3501C>T (p.Ser1167=) rs374054654
NM_003803.3(MYOM1):c.3523T>G (p.Tyr1175Asp)
NM_003803.3(MYOM1):c.3539A>G (p.Asp1180Gly) rs188319622
NM_003803.3(MYOM1):c.3543T>C (p.Ser1181=) rs1252354401
NM_003803.3(MYOM1):c.3548G>A (p.Arg1183Gln) rs147050513
NM_003803.3(MYOM1):c.3572A>G (p.Asn1191Ser) rs200480164
NM_003803.3(MYOM1):c.3576-5C>T rs7232329
NM_003803.3(MYOM1):c.3579G>A (p.Thr1193=) rs575759850
NM_003803.3(MYOM1):c.3618T>C (p.Gly1206=) rs1555617218
NM_003803.3(MYOM1):c.3639A>G (p.Thr1213=) rs558779097
NM_003803.3(MYOM1):c.3665A>G (p.Tyr1222Cys) rs748819463
NM_003803.3(MYOM1):c.3683-9C>T rs1060504725
NM_003803.3(MYOM1):c.3691C>T (p.Arg1231Cys) rs730880166
NM_003803.3(MYOM1):c.3708C>A (p.Ser1236Arg) rs869025489
NM_003803.3(MYOM1):c.3781C>T (p.Arg1261Trp)
NM_003803.3(MYOM1):c.3782G>A (p.Arg1261Gln) rs374656485
NM_003803.3(MYOM1):c.3796G>A (p.Ala1266Thr) rs554969785
NM_003803.3(MYOM1):c.3813C>T (p.Gly1271=) rs771659817
NM_003803.3(MYOM1):c.3819C>T (p.Ala1273=) rs187236790
NM_003803.3(MYOM1):c.3863C>T (p.Pro1288Leu) rs200808890
NM_003803.3(MYOM1):c.387A>G (p.Lys129=) rs370293379
NM_003803.3(MYOM1):c.3886C>T (p.Arg1296Ter)
NM_003803.3(MYOM1):c.3904G>A (p.Glu1302Lys) rs370699565
NM_003803.3(MYOM1):c.3914T>C (p.Met1305Thr)
NM_003803.3(MYOM1):c.3945G>A (p.Thr1315=) rs75748615
NM_003803.3(MYOM1):c.395T>G (p.Leu132Trp) rs1555629260
NM_003803.3(MYOM1):c.3992T>C (p.Val1331Ala)
NM_003803.3(MYOM1):c.4007A>T (p.Asp1336Val) rs575609095
NM_003803.3(MYOM1):c.400A>G (p.Ser134Gly)
NM_003803.3(MYOM1):c.4045C>T (p.Arg1349Trp) rs762476268
NM_003803.3(MYOM1):c.4069+13C>A rs948298
NM_003803.3(MYOM1):c.4069+4A>C rs80328493
NM_003803.3(MYOM1):c.409A>C (p.Met137Leu) rs765511668
NM_003803.3(MYOM1):c.4148T>A (p.Ile1383Asn) rs374491316
NM_003803.3(MYOM1):c.4148T>C (p.Ile1383Thr) rs374491316
NM_003803.3(MYOM1):c.4177A>G (p.Lys1393Glu) rs371239754
NM_003803.3(MYOM1):c.4181A>G (p.Asp1394Gly) rs374142554
NM_003803.3(MYOM1):c.4207A>C (p.Lys1403Gln) rs779356078
NM_003803.3(MYOM1):c.4222G>A (p.Asp1408Asn) rs3765623
NM_003803.3(MYOM1):c.4243A>G (p.Ile1415Val)
NM_003803.3(MYOM1):c.4251+7G>A rs377515296
NM_003803.3(MYOM1):c.4301G>A (p.Arg1434Gln) rs776173695
NM_003803.3(MYOM1):c.431+5G>C rs772009177
NM_003803.3(MYOM1):c.432-10_432-8delTGT rs770159154
NM_003803.3(MYOM1):c.4351C>G (p.Leu1451Val) rs876657917
NM_003803.3(MYOM1):c.4357A>T (p.Met1453Leu) rs181642354
NM_003803.3(MYOM1):c.4358T>C (p.Met1453Thr) rs16944397
NM_003803.3(MYOM1):c.4376T>A (p.Ile1459Lys) rs730880167
NM_003803.3(MYOM1):c.4379-4T>G rs755014620
NM_003803.3(MYOM1):c.4446T>G (p.Thr1482=) rs367695432
NM_003803.3(MYOM1):c.4496T>C (p.Ile1499Thr) rs1060502820
NM_003803.3(MYOM1):c.4568C>T (p.Pro1523Leu) rs761317710
NM_003803.3(MYOM1):c.4580G>T (p.Gly1527Val) rs1411286868
NM_003803.3(MYOM1):c.4586A>G (p.Tyr1529Cys) rs876657918
NM_003803.3(MYOM1):c.45C>T (p.Leu15=) rs150321474
NM_003803.3(MYOM1):c.461C>T (p.Thr154Met) rs140845661
NM_003803.3(MYOM1):c.4648+7A>G rs555598943
NM_003803.3(MYOM1):c.4648+9A>T rs758050936
NM_003803.3(MYOM1):c.4662C>T (p.Ala1554=) rs1143657
NM_003803.3(MYOM1):c.4672T>C (p.Phe1558Leu) rs187108957
NM_003803.3(MYOM1):c.4685+11G>T rs2298539
NM_003803.3(MYOM1):c.4685+3_4685+6delAAGT
NM_003803.3(MYOM1):c.4711C>T (p.Arg1571Cys) rs373419422
NM_003803.3(MYOM1):c.4718G>A (p.Arg1573Gln) rs117342470
NM_003803.3(MYOM1):c.4740C>T (p.Asp1580=) rs201979586
NM_003803.3(MYOM1):c.4752C>G (p.Ile1584Met)
NM_003803.3(MYOM1):c.4764+10A>G rs79745437
NM_003803.3(MYOM1):c.476_479delTTAA (p.Ile159Lysfs) rs876657920
NM_003803.3(MYOM1):c.4776C>G (p.Leu1592=) rs1143658
NM_003803.3(MYOM1):c.4792G>A (p.Gly1598Arg) rs764839969
NM_003803.3(MYOM1):c.4799C>T (p.Pro1600Leu) rs372260768
NM_003803.3(MYOM1):c.4800G>A (p.Pro1600=) rs368423483
NM_003803.3(MYOM1):c.4806G>A (p.Pro1602=) rs376121702
NM_003803.3(MYOM1):c.4815G>A (p.Ser1605=) rs763565843
NM_003803.3(MYOM1):c.4827C>T (p.Asn1609=) rs745895344
NM_003803.3(MYOM1):c.4830G>A (p.Glu1610=) rs1555613121
NM_003803.3(MYOM1):c.4903G>A (p.Gly1635Ser) rs200773357
NM_003803.3(MYOM1):c.4908G>A (p.Val1636=) rs531803971
NM_003803.3(MYOM1):c.4914C>T (p.Thr1638=) rs368172542
NM_003803.3(MYOM1):c.4961C>T (p.Ser1654Leu) rs199531701
NM_003803.3(MYOM1):c.4962G>A (p.Ser1654=) rs774192177
NM_003803.3(MYOM1):c.4967C>T (p.Thr1656Ile) rs749267113
NM_003803.3(MYOM1):c.4987G>A (p.Val1663Met) rs751200138
NM_003803.3(MYOM1):c.5001G>A (p.Glu1667=) rs376007739
NM_003803.3(MYOM1):c.500C>T (p.Ala167Val)
NM_003803.3(MYOM1):c.5019C>T (p.Ala1673=) rs199980922
NM_003803.3(MYOM1):c.5040T>C (p.Gly1680=) rs2230164
NM_003803.3(MYOM1):c.5045_5046insA (p.Lys1683Glufs) rs573184538
NM_003803.3(MYOM1):c.539C>T (p.Thr180Ile) rs61735396
NM_003803.3(MYOM1):c.541T>C (p.Ser181Pro) rs1962519
NM_003803.3(MYOM1):c.544A>C (p.Lys182Gln)
NM_003803.3(MYOM1):c.554C>T (p.Thr185Met) rs761722591
NM_003803.3(MYOM1):c.568_603delACCACGGCATCTAAGCAGTCCACGGCATCCAAGCAG (p.Thr190_Gln201del) rs745347160
NM_003803.3(MYOM1):c.572C>T (p.Thr191Met) rs191505313
NM_003803.3(MYOM1):c.590C>T (p.Thr197Met) rs142735495
NM_003803.3(MYOM1):c.609A>G (p.Thr203=) rs562448650
NM_003803.3(MYOM1):c.617A>G (p.Lys206Arg) rs548278691
NM_003803.3(MYOM1):c.617_634dup (p.Ser211_Arg212insLysGlnSerThrAlaSer) rs755975362
NM_003803.3(MYOM1):c.626C>T (p.Thr209Met)
NM_003803.3(MYOM1):c.644C>T (p.Thr215Met) rs2230165
NM_003803.3(MYOM1):c.645G>A (p.Thr215=) rs764706590
NM_003803.3(MYOM1):c.648A>G (p.Ala216=) rs1060504728
NM_003803.3(MYOM1):c.64G>C (p.Val22Leu) rs1791085
NM_003803.3(MYOM1):c.65T>G (p.Val22Gly) rs113162857
NM_003803.3(MYOM1):c.660T>C (p.Ser220=) rs2230166
NM_003803.3(MYOM1):c.66G>C (p.Val22=) rs1662316
NM_003803.3(MYOM1):c.684C>T (p.Ser228=) rs188155898
NM_003803.3(MYOM1):c.739G>A (p.Glu247Lys) rs139422575
NM_003803.3(MYOM1):c.814C>T (p.His272Tyr) rs1555628272
NM_003803.3(MYOM1):c.822C>T (p.Leu274=) rs201409582
NM_003803.3(MYOM1):c.919C>T (p.Arg307Cys)
NM_003803.3(MYOM1):c.91C>A (p.Arg31=) rs76382984
NM_003803.3(MYOM1):c.920G>C (p.Arg307Pro) rs199520642
NM_003803.3(MYOM1):c.924C>A (p.Val308=) rs536739408
NM_003803.3(MYOM1):c.928T>A (p.Trp310Arg)
NM_003803.3(MYOM1):c.93G>A (p.Arg31=) rs876657536
NM_003803.3(MYOM1):c.977A>G (p.Tyr326Cys) rs773366188
NM_003803.3(MYOM1):c.982_984delATT (p.Ile328del) rs765548922
NM_003803.3(MYOM1):c.992G>A (p.Arg331Gln) rs199610460
NM_003803.3(MYOM1):c.999G>A (p.Gly333=) rs2230162
NM_003803.3(MYOM1):c.[64_66delGTGinsCTC;65T>G]

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.