ClinVar Miner

List of variants in gene MYOM1 reported as likely benign

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 90
Download table as spreadsheet
NM_003803.3(MYOM1):c.1023-14G>A rs372359086
NM_003803.3(MYOM1):c.1062G>A (p.Ala354=) rs763462534
NM_003803.3(MYOM1):c.1086G>C (p.Ser362=) rs371620091
NM_003803.3(MYOM1):c.1112-4C>T rs138604278
NM_003803.3(MYOM1):c.1125G>A (p.Glu375=) rs1060504723
NM_003803.3(MYOM1):c.1175-4C>A rs1437226766
NM_003803.3(MYOM1):c.117C>T (p.Tyr39=) rs375113650
NM_003803.3(MYOM1):c.120C>G (p.Thr40=) rs876657535
NM_003803.3(MYOM1):c.1340-14delT rs554705715
NM_003803.3(MYOM1):c.1340-4C>A rs534659625
NM_003803.3(MYOM1):c.1397C>T (p.Thr466Met) rs561012778
NM_003803.3(MYOM1):c.1606G>A (p.Asp536Asn) rs367903122
NM_003803.3(MYOM1):c.1733G>T (p.Arg578Leu) rs200374196
NM_003803.3(MYOM1):c.1797C>T (p.Ser599=) rs370022510
NM_003803.3(MYOM1):c.1813C>G (p.Leu605Val) rs200153557
NM_003803.3(MYOM1):c.1900+6_1900+8delAAG rs754148244
NM_003803.3(MYOM1):c.1901-14T>C rs200115559
NM_003803.3(MYOM1):c.1901-4T>G rs1054418598
NM_003803.3(MYOM1):c.1911G>A (p.Val637=) rs1166836325
NM_003803.3(MYOM1):c.1917C>T (p.Gly639=) rs761762328
NM_003803.3(MYOM1):c.1952G>A (p.Arg651Gln) rs184721031
NM_003803.3(MYOM1):c.1978C>G (p.Pro660Ala) rs201104206
NM_003803.3(MYOM1):c.2025+10T>G rs972434580
NM_003803.3(MYOM1):c.2062A>T (p.Thr688Ser) rs188677538
NM_003803.3(MYOM1):c.2064G>A (p.Thr688=) rs374462999
NM_003803.3(MYOM1):c.2079G>A (p.Lys693=) rs1014448013
NM_003803.3(MYOM1):c.2087G>A (p.Arg696His) rs767192545
NM_003803.3(MYOM1):c.2221G>C (p.Ala741Pro) rs546357155
NM_003803.3(MYOM1):c.2295C>T (p.Ala765=) rs927104464
NM_003803.3(MYOM1):c.2350G>A (p.Glu784Lys) rs368949465
NM_003803.3(MYOM1):c.2384+4A>T rs73373171
NM_003803.3(MYOM1):c.2385-13G>A rs116126674
NM_003803.3(MYOM1):c.2385-9T>C rs199829674
NM_003803.3(MYOM1):c.2506+15C>G rs1272570164
NM_003803.3(MYOM1):c.2598G>A (p.Pro866=) rs778413922
NM_003803.3(MYOM1):c.2656A>G (p.Ser886Gly) rs199900004
NM_003803.3(MYOM1):c.2697A>C (p.Val899=) rs771666952
NM_003803.3(MYOM1):c.2727G>A (p.Pro909=) rs72860212
NM_003803.3(MYOM1):c.2877G>A (p.Lys959=) rs755157204
NM_003803.3(MYOM1):c.2895T>C (p.Ile965=) rs1453527364
NM_003803.3(MYOM1):c.297A>G (p.Thr99=) rs369402806
NM_003803.3(MYOM1):c.3003G>A (p.Leu1001=) rs754487227
NM_003803.3(MYOM1):c.3010A>G (p.Asn1004Asp) rs543434883
NM_003803.3(MYOM1):c.3063G>A (p.Ala1021=) rs373744359
NM_003803.3(MYOM1):c.3084C>T (p.Cys1028=) rs750152279
NM_003803.3(MYOM1):c.3129C>T (p.His1043=) rs372294428
NM_003803.3(MYOM1):c.3183G>A (p.Pro1061=) rs374873325
NM_003803.3(MYOM1):c.3189C>G (p.Val1063=) rs1060504727
NM_003803.3(MYOM1):c.3190C>T (p.His1064Tyr) rs755409090
NM_003803.3(MYOM1):c.3231G>A (p.Leu1077=) rs1060504724
NM_003803.3(MYOM1):c.3243G>A (p.Lys1081=) rs1060504726
NM_003803.3(MYOM1):c.3291C>T (p.Asn1097=) rs201092091
NM_003803.3(MYOM1):c.3300G>A (p.Leu1100=) rs373624207
NM_003803.3(MYOM1):c.3308G>A (p.Arg1103Gln) rs186972208
NM_003803.3(MYOM1):c.3539A>G (p.Asp1180Gly) rs188319622
NM_003803.3(MYOM1):c.3543T>C (p.Ser1181=) rs1252354401
NM_003803.3(MYOM1):c.3548G>A (p.Arg1183Gln) rs147050513
NM_003803.3(MYOM1):c.3572A>G (p.Asn1191Ser) rs200480164
NM_003803.3(MYOM1):c.3579G>A (p.Thr1193=) rs575759850
NM_003803.3(MYOM1):c.3618T>C (p.Gly1206=) rs1555617218
NM_003803.3(MYOM1):c.3639A>G (p.Thr1213=) rs558779097
NM_003803.3(MYOM1):c.3683-9C>T rs1060504725
NM_003803.3(MYOM1):c.387A>G (p.Lys129=) rs370293379
NM_003803.3(MYOM1):c.4251+7G>A rs377515296
NM_003803.3(MYOM1):c.4376T>A (p.Ile1459Lys) rs730880167
NM_003803.3(MYOM1):c.4379-4T>G rs755014620
NM_003803.3(MYOM1):c.4648+7A>G rs555598943
NM_003803.3(MYOM1):c.4672T>C (p.Phe1558Leu) rs187108957
NM_003803.3(MYOM1):c.4740C>T (p.Asp1580=) rs201979586
NM_003803.3(MYOM1):c.4776C>G (p.Leu1592=) rs1143658
NM_003803.3(MYOM1):c.4800G>A (p.Pro1600=) rs368423483
NM_003803.3(MYOM1):c.4806G>A (p.Pro1602=) rs376121702
NM_003803.3(MYOM1):c.4815G>A (p.Ser1605=) rs763565843
NM_003803.3(MYOM1):c.4827C>T (p.Asn1609=) rs745895344
NM_003803.3(MYOM1):c.4830G>A (p.Glu1610=) rs1555613121
NM_003803.3(MYOM1):c.4908G>A (p.Val1636=) rs531803971
NM_003803.3(MYOM1):c.4914C>T (p.Thr1638=) rs368172542
NM_003803.3(MYOM1):c.4962G>A (p.Ser1654=) rs774192177
NM_003803.3(MYOM1):c.5001G>A (p.Glu1667=) rs376007739
NM_003803.3(MYOM1):c.5019C>T (p.Ala1673=) rs199980922
NM_003803.3(MYOM1):c.5045_5046insA (p.Lys1683Glufs) rs573184538
NM_003803.3(MYOM1):c.568_603delACCACGGCATCTAAGCAGTCCACGGCATCCAAGCAG (p.Thr190_Gln201del) rs745347160
NM_003803.3(MYOM1):c.572C>T (p.Thr191Met) rs191505313
NM_003803.3(MYOM1):c.609A>G (p.Thr203=) rs562448650
NM_003803.3(MYOM1):c.645G>A (p.Thr215=) rs764706590
NM_003803.3(MYOM1):c.648A>G (p.Ala216=) rs1060504728
NM_003803.3(MYOM1):c.739G>A (p.Glu247Lys) rs139422575
NM_003803.3(MYOM1):c.822C>T (p.Leu274=) rs201409582
NM_003803.3(MYOM1):c.93G>A (p.Arg31=) rs876657536
NM_003803.3(MYOM1):c.992G>A (p.Arg331Gln) rs199610460

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.