ClinVar Miner

List of variants in gene NF1 reported as uncertain significance for Neurofibromatosis, type 1

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 1195
Download table as spreadsheet
HGVS dbSNP
NC_000017.10:g.(?_29422322)_(29497021_?)dup
NC_000017.10:g.(?_29422322)_(29592363_?)dup
NC_000017.10:g.(?_29546017)_(29585526_?)dup
NC_000017.11:g.(?_31374003)_(31374165_?)dup
NC_000017.11:g.(?_31374013)_(31377677_?)dup
NM_000267.3(NF1):c.*1202A>C rs886052807
NM_000267.3(NF1):c.*1425C>T rs886052808
NM_000267.3(NF1):c.*1446T>C rs886052809
NM_000267.3(NF1):c.*1899A>G rs547663480
NM_000267.3(NF1):c.*1987C>T rs886052810
NM_000267.3(NF1):c.*2071G>A rs886052811
NM_000267.3(NF1):c.*2132T>C rs551806545
NM_000267.3(NF1):c.*2566C>T rs545937364
NM_000267.3(NF1):c.*2638_*2646delGATAATCTAinsTTATG rs886052813
NM_000267.3(NF1):c.*2777C>A rs185015732
NM_000267.3(NF1):c.*2884T>A rs886052814
NM_000267.3(NF1):c.*3091A>C rs570154156
NM_000267.3(NF1):c.*3174A>C rs886052815
NM_000267.3(NF1):c.*3248G>A rs527971565
NM_000267.3(NF1):c.*3266G>A rs548117626
NM_000267.3(NF1):c.*3514G>C rs574282086
NM_000267.3(NF1):c.*506T>A rs886052804
NM_000267.3(NF1):c.*584G>T rs190144445
NM_000267.3(NF1):c.*871delA rs759306393
NM_000267.3(NF1):c.*873_*874dupAT rs369548314
NM_000267.3(NF1):c.*875T>A rs886052806
NM_000267.3(NF1):c.1004A>G (p.Asn335Ser) rs758212945
NM_000267.3(NF1):c.1019C>G (p.Ser340Cys) rs771089333
NM_000267.3(NF1):c.1042T>C (p.Ser348Pro) rs864622064
NM_000267.3(NF1):c.1045A>G (p.Met349Val) rs776050648
NM_000267.3(NF1):c.1048G>A (p.Val350Met) rs1185636269
NM_000267.3(NF1):c.104G>A (p.Ser35Asn) rs1060500282
NM_000267.3(NF1):c.1052T>A (p.Val351Asp) rs878853861
NM_000267.3(NF1):c.1062+3A>G rs1057521098
NM_000267.3(NF1):c.1062+5C>T rs1555610916
NM_000267.3(NF1):c.1062+6A>G rs1060500291
NM_000267.3(NF1):c.1069C>G (p.Leu357Val)
NM_000267.3(NF1):c.1108C>T (p.Pro370Ser) rs878853862
NM_000267.3(NF1):c.1130T>C (p.Ile377Thr) rs878853863
NM_000267.3(NF1):c.1134C>G (p.Asp378Glu)
NM_000267.3(NF1):c.1135T>C (p.Cys379Arg) rs1060500281
NM_000267.3(NF1):c.1138C>T (p.Leu380Phe) rs1426127948
NM_000267.3(NF1):c.1145C>T (p.Ser382Phe) rs1555611016
NM_000267.3(NF1):c.1154G>A (p.Arg385His) rs1350329837
NM_000267.3(NF1):c.116A>T (p.Asn39Ile)
NM_000267.3(NF1):c.1185G>A (p.Lys395=)
NM_000267.3(NF1):c.1186A>C (p.Ile396Leu) rs1413735911
NM_000267.3(NF1):c.1229T>G (p.Leu410Arg)
NM_000267.3(NF1):c.1247G>A (p.Arg416Gln) rs1343309278
NM_000267.3(NF1):c.1259A>G (p.Asn420Ser) rs1555611107
NM_000267.3(NF1):c.1260+5G>C rs1060500253
NM_000267.3(NF1):c.1260+6T>C rs1555611111
NM_000267.3(NF1):c.1260+6T>G rs1555611111
NM_000267.3(NF1):c.1261-3T>A rs761761583
NM_000267.3(NF1):c.1261T>G (p.Ser421Ala) rs878853864
NM_000267.3(NF1):c.128T>C (p.Leu43Pro) rs1555604899
NM_000267.3(NF1):c.1304A>G (p.His435Arg) rs1555611571
NM_000267.3(NF1):c.1309G>T (p.Val437Phe) rs1555611574
NM_000267.3(NF1):c.1310T>C (p.Val437Ala) rs876658642
NM_000267.3(NF1):c.1319G>A (p.Arg440Gln)
NM_000267.3(NF1):c.1328T>C (p.Phe443Ser) rs1555611581
NM_000267.3(NF1):c.1331G>A (p.Gly444Asp) rs1555611582
NM_000267.3(NF1):c.1357G>A (p.Gly453Ser) rs1273060925
NM_000267.3(NF1):c.1369C>T (p.His457Tyr) rs757560526
NM_000267.3(NF1):c.1370_1372delACC (p.His457del)
NM_000267.3(NF1):c.1382G>A (p.Arg461Gln)
NM_000267.3(NF1):c.1391C>T (p.Pro464Leu)
NM_000267.3(NF1):c.1392G>T (p.Pro464=) rs201604273
NM_000267.3(NF1):c.1393-2dup rs1394021280
NM_000267.3(NF1):c.1405A>G (p.Lys469Glu) rs1555612271
NM_000267.3(NF1):c.143A>C (p.Lys48Thr) rs1555604902
NM_000267.3(NF1):c.1444A>G (p.Thr482Ala) rs770201871
NM_000267.3(NF1):c.144A>G (p.Lys48=) rs763375105
NM_000267.3(NF1):c.1456A>T (p.Thr486Ser) rs1060500305
NM_000267.3(NF1):c.145T>A (p.Tyr49Asn) rs764367878
NM_000267.3(NF1):c.1466A>G (p.Tyr489Cys) rs137854557
NM_000267.3(NF1):c.1469A>G (p.Lys490Arg) rs1060500260
NM_000267.3(NF1):c.1480T>A (p.Leu494Met) rs878853867
NM_000267.3(NF1):c.1496T>C (p.Leu499Pro) rs1555612288
NM_000267.3(NF1):c.1527+1159C>T rs878853868
NM_000267.3(NF1):c.1527+5G>A rs1060500352
NM_000267.3(NF1):c.1527+5G>C rs1060500352
NM_000267.3(NF1):c.1528-3C>T rs1060500294
NM_000267.3(NF1):c.1529A>C (p.Asn510Thr)
NM_000267.3(NF1):c.1549G>A (p.Glu517Lys) rs587778548
NM_000267.3(NF1):c.1579A>T (p.Thr527Ser)
NM_000267.3(NF1):c.1593A>C (p.Gln531His) rs773712266
NM_000267.3(NF1):c.1600C>T (p.Pro534Ser) rs1555612858
NM_000267.3(NF1):c.160G>T (p.Val54Phe) rs1060500330
NM_000267.3(NF1):c.1615C>G (p.Pro539Ala) rs1060500366
NM_000267.3(NF1):c.1641+3A>G rs754159326
NM_000267.3(NF1):c.1642-449A>G rs863224655
NM_000267.3(NF1):c.1643C>T (p.Ala548Val)
NM_000267.3(NF1):c.1655T>G (p.Leu552Arg) rs1555613193
NM_000267.3(NF1):c.1661A>G (p.Gln554Arg) rs863224656
NM_000267.3(NF1):c.1670G>A (p.Ser557Asn)
NM_000267.3(NF1):c.1699G>A (p.Val567Ile) rs1555613200
NM_000267.3(NF1):c.169G>A (p.Gly57Ser) rs779727341
NM_000267.3(NF1):c.170G>A (p.Gly57Asp) rs1555604925
NM_000267.3(NF1):c.1722-9T>G
NM_000267.3(NF1):c.1751A>T (p.Lys584Ile)
NM_000267.3(NF1):c.175A>G (p.Thr59Ala)
NM_000267.3(NF1):c.1769T>C (p.Met590Thr) rs761559887
NM_000267.3(NF1):c.1771C>G (p.Leu591Val) rs767247726
NM_000267.3(NF1):c.1780A>G (p.Thr594Ala) rs1555613419
NM_000267.3(NF1):c.178A>G (p.Thr60Ala) rs546729596
NM_000267.3(NF1):c.179C>G (p.Thr60Ser) rs1007047958
NM_000267.3(NF1):c.1802G>A (p.Arg601Gln) rs1060500288
NM_000267.3(NF1):c.1804G>C (p.Glu602Gln) rs1060500322
NM_000267.3(NF1):c.181A>G (p.Ile61Val) rs754295034
NM_000267.3(NF1):c.1845G>A (p.Lys615=)
NM_000267.3(NF1):c.1846-5T>C
NM_000267.3(NF1):c.1846-8T>A rs886052799
NM_000267.3(NF1):c.1846C>G (p.Gln616Glu) rs1555613543
NM_000267.3(NF1):c.1849G>A (p.Ala617Thr) rs1131691135
NM_000267.3(NF1):c.1862C>T (p.Ser621Phe) rs760346063
NM_000267.3(NF1):c.1867C>T (p.His623Tyr) rs759555122
NM_000267.3(NF1):c.1868A>G (p.His623Arg) rs1555613555
NM_000267.3(NF1):c.1877T>C (p.Leu626Pro)
NM_000267.3(NF1):c.1888G>A (p.Val630Ile) rs751795238
NM_000267.3(NF1):c.1895G>A (p.Cys632Tyr)
NM_000267.3(NF1):c.1900A>G (p.Ile634Val) rs745906742
NM_000267.3(NF1):c.1907C>A (p.Ser636Tyr)
NM_000267.3(NF1):c.1907C>T (p.Ser636Phe) rs780412565
NM_000267.3(NF1):c.1916A>G (p.Asn639Ser) rs1060500275
NM_000267.3(NF1):c.1921A>T (p.Ser641Cys)
NM_000267.3(NF1):c.1939C>T (p.His647Tyr) rs776251084
NM_000267.3(NF1):c.1955G>A (p.Arg652His) rs587778549
NM_000267.3(NF1):c.1960C>T (p.Pro654Ser) rs765281937
NM_000267.3(NF1):c.1966G>A (p.Ala656Thr) rs1555613598
NM_000267.3(NF1):c.1985A>G (p.Lys662Arg) rs578141234
NM_000267.3(NF1):c.1991A>G (p.Asn664Ser) rs756145065
NM_000267.3(NF1):c.1994C>T (p.Ser665Phe) rs145891889
NM_000267.3(NF1):c.2018G>A (p.Cys673Tyr) rs878853872
NM_000267.3(NF1):c.2020A>G (p.Ser674Gly) rs1555613753
NM_000267.3(NF1):c.2033C>T (p.Pro678Leu) rs17881753
NM_000267.3(NF1):c.2038T>C (p.Cys680Arg) rs1555613775
NM_000267.3(NF1):c.203T>C (p.Met68Thr) rs779063198
NM_000267.3(NF1):c.204+6T>G rs1555604948
NM_000267.3(NF1):c.205-13T>A rs886052797
NM_000267.3(NF1):c.2065G>A (p.Val689Met) rs771784652
NM_000267.3(NF1):c.2072T>G (p.Leu691Arg) rs1131691132
NM_000267.3(NF1):c.2077A>G (p.Met693Val) rs1555613794
NM_000267.3(NF1):c.2098A>G (p.Thr700Ala) rs1555613801
NM_000267.3(NF1):c.2126G>A (p.Cys709Tyr) rs864622547
NM_000267.3(NF1):c.2131C>T (p.Arg711Cys) rs1400902839
NM_000267.3(NF1):c.2159G>A (p.Arg720Gln) rs1350468182
NM_000267.3(NF1):c.2189A>C (p.Asn730Thr) rs778033578
NM_000267.3(NF1):c.219A>T (p.Glu73Asp)
NM_000267.3(NF1):c.2203T>C (p.Tyr735His) rs1555613827
NM_000267.3(NF1):c.2206A>C (p.Asn736His)
NM_000267.3(NF1):c.2237A>G (p.Asn746Ser) rs1176567641
NM_000267.3(NF1):c.2252-9T>G rs1555613907
NM_000267.3(NF1):c.2257G>A (p.Ala753Thr) rs758325102
NM_000267.3(NF1):c.2261C>G (p.Ala754Gly) rs1555613912
NM_000267.3(NF1):c.2271A>T (p.Lys757Asn)
NM_000267.3(NF1):c.2288T>G (p.Leu763Arg) rs199474762
NM_000267.3(NF1):c.2293C>G (p.Arg765Gly) rs1383770460
NM_000267.3(NF1):c.2294G>A (p.Arg765His) rs199474777
NM_000267.3(NF1):c.2297T>G (p.Ile766Ser) rs863224657
NM_000267.3(NF1):c.2321C>T (p.Thr774Ile) rs917302286
NM_000267.3(NF1):c.2325+4T>C rs1555613934
NM_000267.3(NF1):c.2325+6C>T
NM_000267.3(NF1):c.2326-10T>G rs1555613971
NM_000267.3(NF1):c.2326-9T>A rs181838967
NM_000267.3(NF1):c.232_234delAAT (p.Asn78del) rs1555605367
NM_000267.3(NF1):c.2339C>G (p.Thr780Arg) rs199474746
NM_000267.3(NF1):c.2342A>T (p.His781Leu) rs199474763
NM_000267.3(NF1):c.2378A>C (p.Asn793Thr) rs772543826
NM_000267.3(NF1):c.237A>T (p.Leu79Phe) rs752208826
NM_000267.3(NF1):c.2390C>T (p.Ala797Val) rs1181350360
NM_000267.3(NF1):c.2393A>C (p.Lys798Thr) rs745498566
NM_000267.3(NF1):c.2395A>G (p.Met799Val)
NM_000267.3(NF1):c.2395A>T (p.Met799Leu) rs1060500317
NM_000267.3(NF1):c.239A>C (p.Tyr80Ser) rs4795581
NM_000267.3(NF1):c.2409+5G>A rs763688567
NM_000267.3(NF1):c.2410-18C>G
NM_000267.3(NF1):c.2410-8G>A rs1060500270
NM_000267.3(NF1):c.2410G>C (p.Ala804Pro) rs761109477
NM_000267.3(NF1):c.2437G>A (p.Val813Ile) rs878853876
NM_000267.3(NF1):c.2447G>A (p.Arg816Gln) rs762709897
NM_000267.3(NF1):c.2468G>A (p.Gly823Glu) rs1060500267
NM_000267.3(NF1):c.2474C>G (p.Ser825Cys) rs1060500314
NM_000267.3(NF1):c.2476A>G (p.Ile826Val) rs767069721
NM_000267.3(NF1):c.2486C>T (p.Ser829Phe)
NM_000267.3(NF1):c.248A>G (p.Gln83Arg) rs1060500360
NM_000267.3(NF1):c.2495A>G (p.Asp832Gly) rs1060500283
NM_000267.3(NF1):c.2512A>T (p.Ile838Phe) rs1555614212
NM_000267.3(NF1):c.2514C>G (p.Ile838Met) rs863224352
NM_000267.3(NF1):c.2516A>T (p.Asn839Ile)
NM_000267.3(NF1):c.2533T>C (p.Cys845Arg) rs1060500254
NM_000267.3(NF1):c.2536G>A (p.Ala846Thr) rs1555614226
NM_000267.3(NF1):c.2537C>A (p.Ala846Asp) rs1555614229
NM_000267.3(NF1):c.2539C>G (p.Leu847Val)
NM_000267.3(NF1):c.2539C>T (p.Leu847Phe) rs753552408
NM_000267.3(NF1):c.2569A>C (p.Asn857His) rs1060500259
NM_000267.3(NF1):c.256A>G (p.Ile86Val)
NM_000267.3(NF1):c.2570A>G (p.Asn857Ser) rs1060500299
NM_000267.3(NF1):c.2581G>A (p.Ala861Thr) rs768425956
NM_000267.3(NF1):c.2585C>G (p.Thr862Ser) rs200302954
NM_000267.3(NF1):c.2596C>T (p.Pro866Ser) rs1555614272
NM_000267.3(NF1):c.2599A>G (p.Met867Val) rs864622715
NM_000267.3(NF1):c.2606C>T (p.Pro869Leu) rs878853878
NM_000267.3(NF1):c.2617C>G (p.Arg873Gly)
NM_000267.3(NF1):c.2618G>C (p.Arg873Pro) rs949092641
NM_000267.3(NF1):c.2624G>T (p.Gly875Val) rs1060500361
NM_000267.3(NF1):c.2633T>C (p.Ile878Thr) rs372049168
NM_000267.3(NF1):c.2641A>G (p.Met881Val) rs1060500263
NM_000267.3(NF1):c.2642T>C (p.Met881Thr)
NM_000267.3(NF1):c.2653G>A (p.Gly885Arg) rs1060500272
NM_000267.3(NF1):c.2659G>A (p.Ala887Thr) rs1251621684
NM_000267.3(NF1):c.2660C>T (p.Ala887Val)
NM_000267.3(NF1):c.2665A>G (p.Thr889Ala) rs1314766383
NM_000267.3(NF1):c.2666C>G (p.Thr889Arg) rs369912079
NM_000267.3(NF1):c.2668C>T (p.Pro890Ser) rs771012891
NM_000267.3(NF1):c.266C>A (p.Thr89Lys) rs1555605392
NM_000267.3(NF1):c.2671G>C (p.Val891Leu) rs1060500256
NM_000267.3(NF1):c.2684T>G (p.Met895Arg) rs1555614301
NM_000267.3(NF1):c.2689C>T (p.Arg897Trp) rs775949348
NM_000267.3(NF1):c.2690G>A (p.Arg897Gln) rs863224658
NM_000267.3(NF1):c.2690G>C (p.Arg897Pro) rs863224658
NM_000267.3(NF1):c.269T>G (p.Leu90Arg) rs1555605393
NM_000267.3(NF1):c.2725G>T (p.Val909Leu)
NM_000267.3(NF1):c.2740C>T (p.Arg914Trp)
NM_000267.3(NF1):c.2741G>A (p.Arg914Gln) rs776447057
NM_000267.3(NF1):c.2749G>A (p.Val917Ile) rs752455591
NM_000267.3(NF1):c.274A>G (p.Lys92Glu) rs1555605396
NM_000267.3(NF1):c.2754G>A (p.Lys918=) rs1555614330
NM_000267.3(NF1):c.2761G>A (p.Val921Met) rs567023433
NM_000267.3(NF1):c.2765G>A (p.Gly922Asp)
NM_000267.3(NF1):c.276A>T (p.Lys92Asn)
NM_000267.3(NF1):c.2782G>A (p.Ala928Thr) rs1277935019
NM_000267.3(NF1):c.2786T>G (p.Leu929Arg) rs1555614338
NM_000267.3(NF1):c.2794A>G (p.Met932Val) rs886052800
NM_000267.3(NF1):c.2798T>C (p.Leu933Pro) rs1555614342
NM_000267.3(NF1):c.2809T>G (p.Leu937Val)
NM_000267.3(NF1):c.2819C>G (p.Thr940Ser) rs368995630
NM_000267.3(NF1):c.2825G>C (p.Ser942Thr) rs1555614350
NM_000267.3(NF1):c.2839T>A (p.Ser947Thr)
NM_000267.3(NF1):c.2840C>G (p.Ser947Cys) rs878853879
NM_000267.3(NF1):c.284C>T (p.Ala95Val)
NM_000267.3(NF1):c.2850+5A>G rs864622633
NM_000267.3(NF1):c.288+4A>G rs781459468
NM_000267.3(NF1):c.289-6T>C rs757074803
NM_000267.3(NF1):c.2897C>G (p.Ala966Gly)
NM_000267.3(NF1):c.2954A>T (p.Gln985Leu)
NM_000267.3(NF1):c.2960G>A (p.Ser987Asn) rs1060500329
NM_000267.3(NF1):c.2963T>C (p.Ile988Thr)
NM_000267.3(NF1):c.2971A>G (p.Met991Val) rs1268543864
NM_000267.3(NF1):c.2972T>C (p.Met991Thr) rs1060500298
NM_000267.3(NF1):c.2990+5G>A rs1555614464
NM_000267.3(NF1):c.2990G>C (p.Arg997Thr)
NM_000267.3(NF1):c.2990G>T (p.Arg997Met) rs1555614462
NM_000267.3(NF1):c.2991-4A>G rs754414489
NM_000267.3(NF1):c.2998C>T (p.Arg1000Cys) rs367684252
NM_000267.3(NF1):c.2999G>A (p.Arg1000His) rs753082620
NM_000267.3(NF1):c.3016G>A (p.Val1006Ile) rs1060500383
NM_000267.3(NF1):c.3040A>G (p.Lys1014Glu) rs1135402839
NM_000267.3(NF1):c.304A>G (p.Met102Val) rs756370324
NM_000267.3(NF1):c.3055G>A (p.Val1019Ile)
NM_000267.3(NF1):c.3056T>C (p.Val1019Ala) rs1555614520
NM_000267.3(NF1):c.3062T>G (p.Val1021Gly) rs1355411201
NM_000267.3(NF1):c.3065_3073dup (p.Ala1024_Arg1025insMetMetAla)
NM_000267.3(NF1):c.3071C>T (p.Ala1024Val) rs1555614525
NM_000267.3(NF1):c.3103A>G (p.Met1035Val) rs771694969
NM_000267.3(NF1):c.3104T>G (p.Met1035Arg) rs137854553
NM_000267.3(NF1):c.3107A>C (p.Lys1036Thr) rs1555614540
NM_000267.3(NF1):c.3113G>T (p.Arg1038Met) rs1060500313
NM_000267.3(NF1):c.3118A>G (p.Lys1040Glu) rs1555614619
NM_000267.3(NF1):c.3134T>C (p.Leu1045Pro)
NM_000267.3(NF1):c.3140A>G (p.Asp1047Gly) rs1555614631
NM_000267.3(NF1):c.3142T>G (p.Trp1048Gly) rs1555614634
NM_000267.3(NF1):c.3145G>A (p.Val1049Ile) rs1060500343
NM_000267.3(NF1):c.3166G>A (p.Ala1056Thr) rs776907522
NM_000267.3(NF1):c.3173A>G (p.Asp1058Gly) rs1387858614
NM_000267.3(NF1):c.3180T>G (p.Asp1060Glu) rs1555614646
NM_000267.3(NF1):c.3197G>T (p.Arg1066Ile) rs1555614652
NM_000267.3(NF1):c.3198-3C>T rs777759972
NM_000267.3(NF1):c.3198-4_3198-3insTGT rs745559136
NM_000267.3(NF1):c.3198-5T>G
NM_000267.3(NF1):c.3198-5_3198-3dupTTC rs1227046003
NM_000267.3(NF1):c.3198-5_3198-4insC rs1555614804
NM_000267.3(NF1):c.3238C>G (p.Leu1080Val) rs1555614832
NM_000267.3(NF1):c.323T>C (p.Met108Thr) rs780233935
NM_000267.3(NF1):c.3241G>A (p.Ala1081Thr) rs1555614834
NM_000267.3(NF1):c.3242C>G (p.Ala1081Gly) rs769941435
NM_000267.3(NF1):c.3243T>A (p.Ala1081=)
NM_000267.3(NF1):c.3245G>C (p.Gly1082Ala) rs1555614839
NM_000267.3(NF1):c.3250C>T (p.Pro1084Ser) rs1555614848
NM_000267.3(NF1):c.3274G>A (p.Gly1092Ser)
NM_000267.3(NF1):c.3287T>C (p.Met1096Thr) rs863224659
NM_000267.3(NF1):c.3315A>G (p.Lys1105=) rs1555614915
NM_000267.3(NF1):c.3332T>C (p.Met1111Thr) rs1555614920
NM_000267.3(NF1):c.3336C>A (p.Asn1112Lys) rs1060500262
NM_000267.3(NF1):c.3346G>C (p.Asp1116His) rs1555614932
NM_000267.3(NF1):c.3352A>G (p.Ser1118Gly) rs201645318
NM_000267.3(NF1):c.3358G>T (p.Val1120Phe) rs200594167
NM_000267.3(NF1):c.3359T>C (p.Val1120Ala) rs751571517
NM_000267.3(NF1):c.3371G>A (p.Ser1124Asn) rs374472758
NM_000267.3(NF1):c.3374C>T (p.Ala1125Val) rs902739109
NM_000267.3(NF1):c.3383G>A (p.Gly1128Asp) rs1060500325
NM_000267.3(NF1):c.3395G>A (p.Arg1132His) rs778920556
NM_000267.3(NF1):c.3404C>T (p.Ser1135Phe) rs1555614952
NM_000267.3(NF1):c.3407G>A (p.Arg1136Gln)
NM_000267.3(NF1):c.3407G>C (p.Arg1136Pro) rs868407539
NM_000267.3(NF1):c.3412C>T (p.Leu1138=) rs1555614958
NM_000267.3(NF1):c.3416C>A (p.Ala1139Glu) rs1555614960
NM_000267.3(NF1):c.3427C>T (p.His1143Tyr) rs1555614963
NM_000267.3(NF1):c.3428A>G (p.His1143Arg) rs1555614965
NM_000267.3(NF1):c.3436G>T (p.Val1146Phe)
NM_000267.3(NF1):c.3451A>G (p.Asn1151Asp)
NM_000267.3(NF1):c.3496+3G>A rs1060500287
NM_000267.3(NF1):c.3496+5G>A
NM_000267.3(NF1):c.3501A>C (p.Leu1167Phe) rs1555615008
NM_000267.3(NF1):c.3502G>C (p.Gly1168Arg) rs878853883
NM_000267.3(NF1):c.3517C>T (p.Leu1173Phe) rs1060500375
NM_000267.3(NF1):c.3533C>A (p.Thr1178Lys) rs1555615025
NM_000267.3(NF1):c.3544G>T (p.Val1182Phe) rs1555615027
NM_000267.3(NF1):c.3548T>C (p.Leu1183Pro) rs1555615028
NM_000267.3(NF1):c.355C>A (p.His119Asn)
NM_000267.3(NF1):c.3590C>G (p.Ala1197Gly) rs370820478
NM_000267.3(NF1):c.3590C>T (p.Ala1197Val) rs370820478
NM_000267.3(NF1):c.3596C>G (p.Thr1199Arg) rs1555615047
NM_000267.3(NF1):c.3596C>T (p.Thr1199Ile)
NM_000267.3(NF1):c.3607G>A (p.Asp1203Asn) rs1555615051
NM_000267.3(NF1):c.3623T>C (p.Leu1208Ser) rs1060500374
NM_000267.3(NF1):c.3625G>C (p.Val1209Leu)
NM_000267.3(NF1):c.3625G>T (p.Val1209Leu) rs1458579232
NM_000267.3(NF1):c.3644T>C (p.Met1215Thr) rs1555615071
NM_000267.3(NF1):c.3644T>G (p.Met1215Arg) rs1555615071
NM_000267.3(NF1):c.3656G>T (p.Gly1219Val) rs878853885
NM_000267.3(NF1):c.3656_3658delGAG (p.Gly1219del) rs1555615077
NM_000267.3(NF1):c.3664C>G (p.Pro1222Ala) rs1555615088
NM_000267.3(NF1):c.3667A>G (p.Ile1223Val)
NM_000267.3(NF1):c.3671C>T (p.Ala1224Val) rs1060500340
NM_000267.3(NF1):c.3673A>G (p.Met1225Val)
NM_000267.3(NF1):c.3683C>T (p.Ala1228Val) rs1060500315
NM_000267.3(NF1):c.3685A>G (p.Asn1229Asp) rs1555615102
NM_000267.3(NF1):c.3685A>T (p.Asn1229Tyr) rs1555615102
NM_000267.3(NF1):c.368C>T (p.Thr123Ile) rs878853886
NM_000267.3(NF1):c.3694C>T (p.Pro1232Ser) rs1482085668
NM_000267.3(NF1):c.3708+8A>G rs1173930586
NM_000267.3(NF1):c.3709-3C>A rs1555615430
NM_000267.3(NF1):c.370T>A (p.Cys124Ser) rs1555606074
NM_000267.3(NF1):c.3722G>C (p.Arg1241Pro)
NM_000267.3(NF1):c.3736C>G (p.Leu1246Val)
NM_000267.3(NF1):c.3748C>T (p.Arg1250Trp) rs1452005208
NM_000267.3(NF1):c.3749G>T (p.Arg1250Leu)
NM_000267.3(NF1):c.3752A>G (p.His1251Arg)
NM_000267.3(NF1):c.3764A>G (p.Gln1255Arg) rs1555615453
NM_000267.3(NF1):c.3767T>G (p.Leu1256Arg) rs1555615457
NM_000267.3(NF1):c.3778A>G (p.Met1260Val) rs1264981144
NM_000267.3(NF1):c.3779T>C (p.Met1260Thr) rs1555615463
NM_000267.3(NF1):c.3790G>A (p.Glu1264Lys) rs863224660
NM_000267.3(NF1):c.3811A>C (p.Met1271Leu) rs746583007
NM_000267.3(NF1):c.3811A>G (p.Met1271Val) rs746583007
NM_000267.3(NF1):c.3830G>T (p.Gly1277Val) rs1555615480
NM_000267.3(NF1):c.3836G>A (p.Ser1279Asn) rs1170788683
NM_000267.3(NF1):c.3842C>G (p.Ala1281Gly) rs1060500341
NM_000267.3(NF1):c.3857C>T (p.Thr1286Ile) rs1060500306
NM_000267.3(NF1):c.386A>G (p.Gln129Arg) rs1060500250
NM_000267.3(NF1):c.3870+4T>C rs1555615499
NM_000267.3(NF1):c.3870G>C (p.Lys1290Asn) rs1555615497
NM_000267.3(NF1):c.3875A>G (p.Tyr1292Cys) rs1060500243
NM_000267.3(NF1):c.387G>C (p.Gln129His) rs1390215440
NM_000267.3(NF1):c.3881C>T (p.Ala1294Val) rs878853889
NM_000267.3(NF1):c.3891A>G (p.Leu1297=) rs753036396
NM_000267.3(NF1):c.389A>G (p.His130Arg) rs876660277
NM_000267.3(NF1):c.3911T>C (p.Leu1304Ser)
NM_000267.3(NF1):c.3916C>A (p.Arg1306=) rs376576925
NM_000267.3(NF1):c.3917G>A (p.Arg1306Gln) rs1306237220
NM_000267.3(NF1):c.3926T>A (p.Ile1309Asn)
NM_000267.3(NF1):c.392C>T (p.Ala131Val)
NM_000267.3(NF1):c.3940T>C (p.Trp1314Arg)
NM_000267.3(NF1):c.3947A>G (p.His1316Arg) rs751023085
NM_000267.3(NF1):c.3949G>C (p.Val1317Leu) rs1555615560
NM_000267.3(NF1):c.3958G>A (p.Glu1320Lys)
NM_000267.3(NF1):c.3962T>C (p.Val1321Ala) rs1060500337
NM_000267.3(NF1):c.3988G>A (p.Glu1330Lys) rs1483311407
NM_000267.3(NF1):c.3989A>C (p.Glu1330Ala)
NM_000267.3(NF1):c.3991A>G (p.Ser1331Gly) rs1411796317
NM_000267.3(NF1):c.3992G>C (p.Ser1331Thr)
NM_000267.3(NF1):c.3998A>G (p.Glu1333Gly) rs200618072
NM_000267.3(NF1):c.4000G>A (p.Glu1334Lys) rs878853892
NM_000267.3(NF1):c.4010G>A (p.Arg1337Gln) rs1060500379
NM_000267.3(NF1):c.4012A>C (p.Asn1338His) rs864622202
NM_000267.3(NF1):c.4016T>C (p.Leu1339Pro)
NM_000267.3(NF1):c.4017_4019delCCT (p.Leu1340del) rs863224834
NM_000267.3(NF1):c.403C>T (p.Arg135Trp) rs775191883
NM_000267.3(NF1):c.404G>A (p.Arg135Gln) rs1060500244
NM_000267.3(NF1):c.4054A>T (p.Ser1352Cys) rs1337343400
NM_000267.3(NF1):c.4061C>A (p.Ser1354Tyr) rs1555617348
NM_000267.3(NF1):c.4072C>T (p.Pro1358Ser) rs1555617359
NM_000267.3(NF1):c.4074_4075delCCinsAA (p.Pro1359Thr) rs1555617362
NM_000267.3(NF1):c.4085G>A (p.Arg1362Gln) rs540108477
NM_000267.3(NF1):c.4098C>G (p.His1366Gln) rs1555617377
NM_000267.3(NF1):c.4122G>T (p.Gln1374His) rs775206746
NM_000267.3(NF1):c.4124G>A (p.Arg1375His) rs368685980
NM_000267.3(NF1):c.4127T>A (p.Phe1376Tyr) rs768223279
NM_000267.3(NF1):c.4130C>T (p.Pro1377Leu) rs864622299
NM_000267.3(NF1):c.4134G>T (p.Gln1378His) rs1355988609
NM_000267.3(NF1):c.4138A>T (p.Ser1380Cys) rs1060500310
NM_000267.3(NF1):c.4139G>C (p.Ser1380Thr) rs1060500249
NM_000267.3(NF1):c.4139G>T (p.Ser1380Ile) rs1060500249
NM_000267.3(NF1):c.4148C>T (p.Ala1383Val) rs1060500257
NM_000267.3(NF1):c.4154G>T (p.Gly1385Val) rs1555618505
NM_000267.3(NF1):c.4162A>G (p.Met1388Val) rs1060500369
NM_000267.3(NF1):c.4163T>C (p.Met1388Thr) rs1555618508
NM_000267.3(NF1):c.4167C>G (p.Phe1389Leu) rs750213850
NM_000267.3(NF1):c.4172G>C (p.Arg1391Thr) rs1555618516
NM_000267.3(NF1):c.4180A>C (p.Asn1394His) rs1555618518
NM_000267.3(NF1):c.4182T>A (p.Asn1394Lys)
NM_000267.3(NF1):c.4193T>A (p.Val1398Asp) rs1555618528
NM_000267.3(NF1):c.4195T>C (p.Ser1399Pro) rs1555618533
NM_000267.3(NF1):c.4199C>T (p.Pro1400Leu) rs753997885
NM_000267.3(NF1):c.4211G>A (p.Gly1404Glu) rs1555618547
NM_000267.3(NF1):c.4227G>T (p.Lys1409Asn) rs373086572
NM_000267.3(NF1):c.4246A>T (p.Arg1416Trp) rs1555618558
NM_000267.3(NF1):c.4247G>A (p.Arg1416Lys)
NM_000267.3(NF1):c.4249G>T (p.Gly1417Cys) rs1555618559
NM_000267.3(NF1):c.4250G>T (p.Gly1417Val)
NM_000267.3(NF1):c.4265C>T (p.Ser1422Leu) rs1555618566
NM_000267.3(NF1):c.4267A>G (p.Lys1423Glu) rs137854550
NM_000267.3(NF1):c.4269G>A (p.Lys1423=) rs199474750
NM_000267.3(NF1):c.4270A>C (p.Ile1424Leu)
NM_000267.3(NF1):c.4270A>T (p.Ile1424Leu) rs1555618637
NM_000267.3(NF1):c.4281T>G (p.Ser1427Arg) rs1555618644
NM_000267.3(NF1):c.4289A>T (p.Asn1430Ile) rs199474754
NM_000267.3(NF1):c.4292A>G (p.His1431Arg)
NM_000267.3(NF1):c.4294G>T (p.Val1432Phe) rs199474755
NM_000267.3(NF1):c.4297C>G (p.Leu1433Val) rs1408832954
NM_000267.3(NF1):c.4306A>C (p.Lys1436Gln)
NM_000267.3(NF1):c.4306_4308delAAA (p.Lys1436del) rs1555618653
NM_000267.3(NF1):c.4308A>C (p.Lys1436Asn) rs1555618658
NM_000267.3(NF1):c.4310A>G (p.Glu1437Gly) rs878853894
NM_000267.3(NF1):c.4316A>T (p.His1439Leu) rs748990989
NM_000267.3(NF1):c.4318A>T (p.Met1440Leu) rs1555618675
NM_000267.3(NF1):c.4319T>A (p.Met1440Lys) rs754639587
NM_000267.3(NF1):c.4320G>A (p.Met1440Ile) rs1555618677
NM_000267.3(NF1):c.4321C>T (p.Arg1441Trp) rs876658127
NM_000267.3(NF1):c.4333G>T (p.Asp1445Tyr) rs878853895
NM_000267.3(NF1):c.433C>T (p.Leu145Phe) rs786203460
NM_000267.3(NF1):c.4363C>T (p.Arg1455Cys) rs771420960
NM_000267.3(NF1):c.4367+6T>A
NM_000267.3(NF1):c.4367G>C (p.Arg1456Thr) rs1060500293
NM_000267.3(NF1):c.4379A>G (p.Asp1460Gly)
NM_000267.3(NF1):c.4381A>G (p.Ile1461Val) rs1060500362
NM_000267.3(NF1):c.4382T>C (p.Ile1461Thr) rs746994734
NM_000267.3(NF1):c.4384G>A (p.Ala1462Thr) rs1555618808
NM_000267.3(NF1):c.4396C>T (p.Pro1466Ser) rs1265291141
NM_000267.3(NF1):c.4399A>C (p.Thr1467Pro)
NM_000267.3(NF1):c.4444A>C (p.Asn1482His) rs1555618837
NM_000267.3(NF1):c.4453_4454delGCinsTT (p.Ala1485Phe)
NM_000267.3(NF1):c.445A>G (p.Asn149Asp)
NM_000267.3(NF1):c.4460A>G (p.His1487Arg)
NM_000267.3(NF1):c.4462C>T (p.Arg1488Cys) rs864622348
NM_000267.3(NF1):c.4466_4480delTACTCTGGAACAATC (p.Leu1489_Asn1493del) rs1555618846
NM_000267.3(NF1):c.4467A>G (p.Leu1489=) rs876660089
NM_000267.3(NF1):c.4473G>C (p.Trp1491Cys) rs878853897
NM_000267.3(NF1):c.4475A>G (p.Asn1492Ser) rs113205862
NM_000267.3(NF1):c.4477A>G (p.Asn1493Asp) rs864622404
NM_000267.3(NF1):c.4485G>C (p.Glu1495Asp)
NM_000267.3(NF1):c.4492G>A (p.Gly1498Arg) rs1060500380
NM_000267.3(NF1):c.4508_4509delGCinsAA (p.Ser1503Lys) rs1555618860
NM_000267.3(NF1):c.4514+3A>G rs1060500246
NM_000267.3(NF1):c.4515-19A>G rs1555618994
NM_000267.3(NF1):c.451A>C (p.Asn151His) rs769391944
NM_000267.3(NF1):c.452A>G (p.Asn151Ser)
NM_000267.3(NF1):c.4538G>A (p.Arg1513Gln) rs867955218
NM_000267.3(NF1):c.4553T>C (p.Met1518Thr)
NM_000267.3(NF1):c.4559_4573delCACTTCTTGCATACC (p.Thr1520_Leu1525delinsMet) rs1064792912
NM_000267.3(NF1):c.4582C>G (p.Pro1528Ala) rs1555619025
NM_000267.3(NF1):c.4592A>G (p.Lys1531Arg)
NM_000267.3(NF1):c.4594C>G (p.Pro1532Ala) rs1033427343
NM_000267.3(NF1):c.4597G>A (p.Val1533Met)
NM_000267.3(NF1):c.4609C>T (p.His1537Tyr) rs1468638747
NM_000267.3(NF1):c.4619G>A (p.Ser1540Asn) rs751414513
NM_000267.3(NF1):c.4637C>T (p.Ser1546Leu) rs1555619051
NM_000267.3(NF1):c.464G>A (p.Ser155Asn) rs1555606113
NM_000267.3(NF1):c.4661+11A>G rs368649260
NM_000267.3(NF1):c.4661+3A>G rs781147524
NM_000267.3(NF1):c.4662-3T>C rs892441625
NM_000267.3(NF1):c.466C>T (p.Arg156Cys) rs755890242
NM_000267.3(NF1):c.467G>A (p.Arg156His) rs754096545
NM_000267.3(NF1):c.4693G>A (p.Ala1565Thr) rs767438491
NM_000267.3(NF1):c.4693G>T (p.Ala1565Ser) rs767438491
NM_000267.3(NF1):c.4703C>T (p.Thr1568Met) rs185660700
NM_000267.3(NF1):c.4705T>G (p.Leu1569Val)
NM_000267.3(NF1):c.4707A>C (p.Leu1569Phe)
NM_000267.3(NF1):c.4718A>G (p.Tyr1573Cys) rs1060500303
NM_000267.3(NF1):c.4724C>G (p.Ala1575Gly)
NM_000267.3(NF1):c.4730C>A (p.Thr1577Asn) rs753453385
NM_000267.3(NF1):c.4738G>A (p.Ala1580Thr) rs754651519
NM_000267.3(NF1):c.4741G>A (p.Gly1581Arg) rs878853898
NM_000267.3(NF1):c.4760A>G (p.Tyr1587Cys) rs1555619417
NM_000267.3(NF1):c.4768C>T (p.Arg1590Trp) rs1060500316
NM_000267.3(NF1):c.4771A>C (p.Arg1591=) rs755137259
NM_000267.3(NF1):c.4773-10T>G rs878853899
NM_000267.3(NF1):c.4773G>A (p.Arg1591=) rs1555533268
NM_000267.3(NF1):c.4773G>T (p.Arg1591Ser) rs1555533268
NM_000267.3(NF1):c.4783G>A (p.Gly1595Ser) rs1555533271
NM_000267.3(NF1):c.480G>A (p.Arg160=) rs1555607071
NM_000267.3(NF1):c.4823T>C (p.Leu1608Pro) rs1555533288
NM_000267.3(NF1):c.4834C>A (p.Pro1612Thr)
NM_000267.3(NF1):c.484C>A (p.Gln162Lys)
NM_000267.3(NF1):c.484C>G (p.Gln162Glu) rs1555607073
NM_000267.3(NF1):c.4859T>C (p.Ile1620Thr)
NM_000267.3(NF1):c.4864G>A (p.Val1622Met) rs1060500381
NM_000267.3(NF1):c.4867G>C (p.Asp1623His) rs1131691123
NM_000267.3(NF1):c.4871T>G (p.Leu1624Arg) rs1555533305
NM_000267.3(NF1):c.4877A>C (p.His1626Pro) rs1555533307
NM_000267.3(NF1):c.4882G>A (p.Gly1628Arg) rs770124316
NM_000267.3(NF1):c.4886_4891del (p.Pro1629_Asn1631delinsHis)
NM_000267.3(NF1):c.4888A>C (p.Ser1630Arg) rs1555533314
NM_000267.3(NF1):c.4888A>T (p.Ser1630Cys) rs1555533314
NM_000267.3(NF1):c.4895G>T (p.Arg1632Leu) rs763413441
NM_000267.3(NF1):c.4921T>C (p.Trp1641Arg) rs1555533328
NM_000267.3(NF1):c.494C>G (p.Thr165Ser) rs876660009
NM_000267.3(NF1):c.4951G>A (p.Asp1651Asn) rs1483541195
NM_000267.3(NF1):c.4952A>T (p.Asp1651Val) rs1555533338
NM_000267.3(NF1):c.4955A>G (p.Asn1652Ser) rs1201910133
NM_000267.3(NF1):c.4957G>A (p.Val1653Ile) rs1555533342
NM_000267.3(NF1):c.4967T>A (p.Val1656Asp) rs1060500384
NM_000267.3(NF1):c.4970A>G (p.Tyr1657Cys) rs1555533347
NM_000267.3(NF1):c.4973_4978delTCTATA (p.Ile1658_Tyr1659del) rs1135402868
NM_000267.3(NF1):c.5009A>G (p.Lys1670Arg) rs863224661
NM_000267.3(NF1):c.5020C>T (p.Arg1674Trp)
NM_000267.3(NF1):c.5035C>T (p.Leu1679Phe)
NM_000267.3(NF1):c.5044A>G (p.Ser1682Gly) rs1555533374
NM_000267.3(NF1):c.5052G>C (p.Arg1684Ser) rs749669269
NM_000267.3(NF1):c.5063T>G (p.Ile1688Arg) rs876660316
NM_000267.3(NF1):c.5069G>T (p.Cys1690Phe)
NM_000267.3(NF1):c.5079A>G (p.Lys1693=) rs1555533379
NM_000267.3(NF1):c.5083G>A (p.Ala1695Thr) rs767469374
NM_000267.3(NF1):c.5083G>C (p.Ala1695Pro)
NM_000267.3(NF1):c.5089C>T (p.His1697Tyr) rs1555533381
NM_000267.3(NF1):c.5097G>C (p.Glu1699Asp) rs773378630
NM_000267.3(NF1):c.5120C>T (p.Ala1707Val) rs1555533395
NM_000267.3(NF1):c.5132C>G (p.Ala1711Gly) rs202037436
NM_000267.3(NF1):c.514G>A (p.Val172Ile) rs1555607083
NM_000267.3(NF1):c.5158C>A (p.His1720Asn) rs780529277
NM_000267.3(NF1):c.5162A>G (p.Asn1721Ser) rs745407845
NM_000267.3(NF1):c.5164G>C (p.Ala1722Pro) rs878853900
NM_000267.3(NF1):c.5167C>T (p.Leu1723Phe) rs1555533407
NM_000267.3(NF1):c.5192A>G (p.Lys1731Arg) rs864622373
NM_000267.3(NF1):c.5200A>G (p.Ile1734Val) rs370181275
NM_000267.3(NF1):c.5205+4A>G rs1555533418
NM_000267.3(NF1):c.5210G>C (p.Gly1737Ala) rs1358882546
NM_000267.3(NF1):c.5221G>A (p.Val1741Ile) rs1060500290
NM_000267.3(NF1):c.5227G>T (p.Val1743Leu) rs778427434
NM_000267.3(NF1):c.5230A>G (p.Thr1744Ala) rs747584987
NM_000267.3(NF1):c.5236G>A (p.Ala1746Thr) rs529905904
NM_000267.3(NF1):c.5236G>T (p.Ala1746Ser) rs529905904
NM_000267.3(NF1):c.5243G>A (p.Arg1748Gln) rs1555533559
NM_000267.3(NF1):c.5266G>T (p.Val1756Phe) rs876658562
NM_000267.3(NF1):c.5276A>G (p.Asn1759Ser) rs1411525800
NM_000267.3(NF1):c.5281A>G (p.Ile1761Val) rs1160436761
NM_000267.3(NF1):c.5288A>C (p.Tyr1763Ser) rs1060500280
NM_000267.3(NF1):c.5288A>T (p.Tyr1763Phe) rs1060500280
NM_000267.3(NF1):c.528T>A (p.Asp176Glu) rs112306990
NM_000267.3(NF1):c.5294C>T (p.Ser1765Leu) rs1555533569
NM_000267.3(NF1):c.5295G>A (p.Ser1765=) rs373313111
NM_000267.3(NF1):c.5297A>C (p.Glu1766Ala) rs1555533570
NM_000267.3(NF1):c.5314C>A (p.Leu1772Ile) rs761676110
NM_000267.3(NF1):c.5321A>G (p.Asp1774Gly)
NM_000267.3(NF1):c.5358C>T (p.Gly1786=) rs1060500279
NM_000267.3(NF1):c.5380C>G (p.Gln1794Glu) rs1555533587
NM_000267.3(NF1):c.5393C>T (p.Ala1798Val) rs1555533590
NM_000267.3(NF1):c.5402A>C (p.Gln1801Pro) rs1060500328
NM_000267.3(NF1):c.5407A>G (p.Ile1803Val) rs370858405
NM_000267.3(NF1):c.5414A>G (p.His1805Arg) rs878853902
NM_000267.3(NF1):c.5417T>C (p.Ile1806Thr) rs1555533605
NM_000267.3(NF1):c.5418C>G (p.Ile1806Met) rs1555533607
NM_000267.3(NF1):c.5419C>T (p.Arg1807Trp) rs1555533609
NM_000267.3(NF1):c.5426G>A (p.Arg1809His) rs771529172
NM_000267.3(NF1):c.5449T>C (p.Ser1817Pro) rs1555533619
NM_000267.3(NF1):c.5465C>T (p.Thr1822Ile)
NM_000267.3(NF1):c.5471T>G (p.Ile1824Ser) rs1060500339
NM_000267.3(NF1):c.5477C>T (p.Pro1826Leu)
NM_000267.3(NF1):c.550A>C (p.Asn184His) rs1555607101
NM_000267.3(NF1):c.5524G>A (p.Gly1842Ser) rs1060500332
NM_000267.3(NF1):c.5547-4C>G
NM_000267.3(NF1):c.5573C>T (p.Ala1858Val) rs1555533845
NM_000267.3(NF1):c.5576T>C (p.Leu1859Ser)
NM_000267.3(NF1):c.5579C>T (p.Thr1860Ile) rs876658349
NM_000267.3(NF1):c.557A>T (p.Asp186Val)
NM_000267.3(NF1):c.5598A>G (p.Lys1866=) rs149759456
NM_000267.3(NF1):c.5599A>T (p.Ile1867Phe) rs863224662
NM_000267.3(NF1):c.5606G>T (p.Gly1869Val)
NM_000267.3(NF1):c.5613A>C (p.Leu1871Phe) rs876658130
NM_000267.3(NF1):c.5617G>C (p.Glu1873Gln) rs774893767
NM_000267.3(NF1):c.5631A>G (p.Leu1877=) rs1555533863
NM_000267.3(NF1):c.563C>T (p.Ala188Val) rs1060500309
NM_000267.3(NF1):c.5642C>T (p.Ala1881Val) rs1465309384
NM_000267.3(NF1):c.5648A>G (p.Asn1883Ser) rs864622647
NM_000267.3(NF1):c.5657T>A (p.Phe1886Tyr)
NM_000267.3(NF1):c.5666C>G (p.Ser1889Cys) rs751904277
NM_000267.3(NF1):c.567A>G (p.Lys189=)
NM_000267.3(NF1):c.5705C>G (p.Thr1902Arg) rs786203824
NM_000267.3(NF1):c.5724G>T (p.Glu1908Asp) rs786202591
NM_000267.3(NF1):c.5749+3_5749+4delAA rs1555533888
NM_000267.3(NF1):c.5749+5G>A rs1555533889
NM_000267.3(NF1):c.5750G>A (p.Ser1917Asn) rs906075234
NM_000267.3(NF1):c.5788C>G (p.Pro1930Ala) rs1555534391
NM_000267.3(NF1):c.5800A>T (p.Asn1934Tyr)
NM_000267.3(NF1):c.5822A>G (p.His1941Arg) rs1555534402
NM_000267.3(NF1):c.5837A>G (p.Lys1946Arg)
NM_000267.3(NF1):c.586+5G>C
NM_000267.3(NF1):c.586+5delG
NM_000267.3(NF1):c.5861T>C (p.Leu1954Pro) rs1555534411
NM_000267.3(NF1):c.587-3C>T rs375188075
NM_000267.3(NF1):c.5872A>G (p.Ile1958Val) rs775480099
NM_000267.3(NF1):c.5872A>T (p.Ile1958Leu)
NM_000267.3(NF1):c.5876C>T (p.Thr1959Ile) rs1060500336
NM_000267.3(NF1):c.5888A>G (p.Asn1963Ser) rs764291252
NM_000267.3(NF1):c.589A>G (p.Thr197Ala)
NM_000267.3(NF1):c.5921A>G (p.Lys1974Arg)
NM_000267.3(NF1):c.5929G>A (p.Gly1977Arg) rs1555534426
NM_000267.3(NF1):c.592G>A (p.Ala198Thr) rs1555608643
NM_000267.3(NF1):c.5938G>C (p.Gly1980Arg) rs199474751
NM_000267.3(NF1):c.5939G>A (p.Gly1980Glu) rs878853905
NM_000267.3(NF1):c.5939G>T (p.Gly1980Val) rs878853905
NM_000267.3(NF1):c.593C>A (p.Ala198Glu) rs863224663
NM_000267.3(NF1):c.5943+4T>C rs754909198
NM_000267.3(NF1):c.5944-6A>G rs775960363
NM_000267.3(NF1):c.5969T>C (p.Leu1990Pro) rs878853906
NM_000267.3(NF1):c.5975G>A (p.Ser1992Asn)
NM_000267.3(NF1):c.5991T>G (p.Ser1997Arg) rs1555534600
NM_000267.3(NF1):c.5993C>T (p.Ala1998Val)
NM_000267.3(NF1):c.5999G>A (p.Gly2000Asp) rs1555534605
NM_000267.3(NF1):c.60+5C>G rs879413062
NM_000267.3(NF1):c.6006G>C (p.Leu2002Phe) rs1555534607
NM_000267.3(NF1):c.6019G>A (p.Ala2007Thr) rs767869530
NM_000267.3(NF1):c.6038C>T (p.Thr2013Ile)
NM_000267.3(NF1):c.6053C>T (p.Ala2018Val) rs1555534614
NM_000267.3(NF1):c.6055T>C (p.Ser2019Pro)
NM_000267.3(NF1):c.6095G>A (p.Arg2032Lys) rs1060500289
NM_000267.3(NF1):c.6098T>C (p.Met2033Thr)
NM_000267.3(NF1):c.6112G>A (p.Asp2038Asn) rs761029453
NM_000267.3(NF1):c.6133A>G (p.Thr2045Ala)
NM_000267.3(NF1):c.6140C>G (p.Thr2047Ser)
NM_000267.3(NF1):c.614A>G (p.Lys205Arg) rs1555608659
NM_000267.3(NF1):c.6167A>T (p.Asp2056Val) rs1555534684
NM_000267.3(NF1):c.616A>G (p.Lys206Glu) rs1060500269
NM_000267.3(NF1):c.6186C>G (p.Arg2062=)
NM_000267.3(NF1):c.618G>C (p.Lys206Asn)
NM_000267.3(NF1):c.6209A>G (p.Asn2070Ser) rs1555534696
NM_000267.3(NF1):c.6215C>G (p.Ser2072Cys) rs1555534698
NM_000267.3(NF1):c.6232C>T (p.His2078Tyr) rs1060500382
NM_000267.3(NF1):c.6236T>G (p.Leu2079Arg) rs1555534708
NM_000267.3(NF1):c.6244C>T (p.Leu2082Phe) rs1555534719
NM_000267.3(NF1):c.6249C>G (p.Phe2083Leu) rs780728198
NM_000267.3(NF1):c.624_632delGCAGTTAGC (p.Gln209_Ala211del) rs1555608666
NM_000267.3(NF1):c.6251A>C (p.His2084Pro) rs1555534726
NM_000267.3(NF1):c.6253G>A (p.Val2085Ile) rs755791578
NM_000267.3(NF1):c.6271G>A (p.Ala2091Thr) rs749672954
NM_000267.3(NF1):c.6277G>T (p.Gly2093Cys)
NM_000267.3(NF1):c.62T>C (p.Leu21Pro)
NM_000267.3(NF1):c.6302C>T (p.Thr2101Ile) rs878853907
NM_000267.3(NF1):c.6305A>G (p.His2102Arg) rs112546213
NM_000267.3(NF1):c.6305A>T (p.His2102Leu)
NM_000267.3(NF1):c.6310C>G (p.Leu2104Val) rs786204236
NM_000267.3(NF1):c.6313G>A (p.Val2105Ile)
NM_000267.3(NF1):c.6341C>T (p.Thr2114Ile) rs1555534770
NM_000267.3(NF1):c.6363T>C (p.Ser2121=) rs1060500251
NM_000267.3(NF1):c.6364+5G>A rs1060500311
NM_000267.3(NF1):c.6376C>A (p.Gln2126Lys) rs1555534859
NM_000267.3(NF1):c.6379G>A (p.Val2127Ile)
NM_000267.3(NF1):c.6407C>T (p.Ser2136Leu)
NM_000267.3(NF1):c.6458C>T (p.Ala2153Val) rs1555534865
NM_000267.3(NF1):c.6472C>T (p.Arg2158Cys) rs878853908
NM_000267.3(NF1):c.6473G>A (p.Arg2158His) rs772639479
NM_000267.3(NF1):c.6496T>C (p.Phe2166Leu) rs1555534876
NM_000267.3(NF1):c.6509C>T (p.Ser2170Phe)
NM_000267.3(NF1):c.6514G>C (p.Glu2172Gln)
NM_000267.3(NF1):c.6560C>G (p.Ala2187Gly) rs1555534886
NM_000267.3(NF1):c.6560C>T (p.Ala2187Val)
NM_000267.3(NF1):c.6567G>A (p.Leu2189=) rs886052801
NM_000267.3(NF1):c.6574A>G (p.Met2192Val) rs864622330
NM_000267.3(NF1):c.6579+18A>G rs1555534893
NM_000267.3(NF1):c.6579+5A>G
NM_000267.3(NF1):c.6580-5T>G rs1555534907
NM_000267.3(NF1):c.6580-8T>A
NM_000267.3(NF1):c.6583T>C (p.Cys2195Arg) rs757736155
NM_000267.3(NF1):c.6584G>T (p.Cys2195Phe)
NM_000267.3(NF1):c.6593A>T (p.Asp2198Val)
NM_000267.3(NF1):c.6616G>A (p.Asp2206Asn)
NM_000267.3(NF1):c.6622T>C (p.Trp2208Arg) rs1060500342
NM_000267.3(NF1):c.6628G>A (p.Glu2210Lys) rs1024484381
NM_000267.3(NF1):c.6637C>G (p.Gln2213Glu)
NM_000267.3(NF1):c.6686T>C (p.Val2229Ala)
NM_000267.3(NF1):c.670G>C (p.Val224Leu)
NM_000267.3(NF1):c.6721G>T (p.Gly2241Trp) rs1392981001
NM_000267.3(NF1):c.6727A>T (p.Ile2243Leu) rs761213794
NM_000267.3(NF1):c.6731A>G (p.Lys2244Arg)
NM_000267.3(NF1):c.6731A>T (p.Lys2244Met) rs1060500258
NM_000267.3(NF1):c.6753C>T (p.Ser2251=) rs864622360
NM_000267.3(NF1):c.6756+3A>G rs1555534966
NM_000267.3(NF1):c.6756+6T>C
NM_000267.3(NF1):c.6756G>A (p.Lys2252=) rs1060500373
NM_000267.3(NF1):c.6757-7C>A
NM_000267.3(NF1):c.6757G>T (p.Ala2253Ser) rs1555535023
NM_000267.3(NF1):c.6776A>G (p.Lys2259Arg) rs773858629
NM_000267.3(NF1):c.677A>C (p.Asn226Thr)
NM_000267.3(NF1):c.6788C>T (p.Thr2263Ile) rs747881072
NM_000267.3(NF1):c.67A>G (p.Ile23Val) rs542824372
NM_000267.3(NF1):c.680A>T (p.Tyr227Phe) rs1555608742
NM_000267.3(NF1):c.6858+5T>C rs370402788
NM_000267.3(NF1):c.6858G>A (p.Lys2286=)
NM_000267.3(NF1):c.6859-16A>G rs202158964
NM_000267.3(NF1):c.6868C>G (p.Leu2290Val)
NM_000267.3(NF1):c.686A>G (p.Asp229Gly) rs1060500285
NM_000267.3(NF1):c.6873C>G (p.His2291Gln)
NM_000267.3(NF1):c.6886T>G (p.Trp2296Gly) rs1060500297
NM_000267.3(NF1):c.6889G>T (p.Val2297Leu) rs760528229
NM_000267.3(NF1):c.6895G>A (p.Val2299Met) rs766323701
NM_000267.3(NF1):c.6905T>C (p.Leu2302Pro) rs1131691267
NM_000267.3(NF1):c.6929A>T (p.Tyr2310Phe) rs1060500304
NM_000267.3(NF1):c.6934G>T (p.Ala2312Ser) rs1555535178
NM_000267.3(NF1):c.693_694delTAinsCT (p.Thr232Ser) rs1555608748
NM_000267.3(NF1):c.6943G>C (p.Ala2315Pro) rs587781428
NM_000267.3(NF1):c.6943G>T (p.Ala2315Ser) rs587781428
NM_000267.3(NF1):c.6944C>A (p.Ala2315Glu) rs886052802
NM_000267.3(NF1):c.6946C>T (p.Leu2316Phe)
NM_000267.3(NF1):c.6947T>G (p.Leu2316Arg) rs1555535179
NM_000267.3(NF1):c.695C>T (p.Thr232Ile) rs769719064
NM_000267.3(NF1):c.6967A>G (p.Thr2323Ala) rs1555535189
NM_000267.3(NF1):c.6976A>G (p.Ser2326Gly) rs1060500318
NM_000267.3(NF1):c.6977G>C (p.Ser2326Thr)
NM_000267.3(NF1):c.697A>C (p.Lys233Gln) rs922257267
NM_000267.3(NF1):c.697A>G (p.Lys233Glu) rs922257267
NM_000267.3(NF1):c.6982C>G (p.Arg2328Gly)
NM_000267.3(NF1):c.6982C>T (p.Arg2328Cys) rs56013763
NM_000267.3(NF1):c.6983G>A (p.Arg2328His) rs864622065
NM_000267.3(NF1):c.6983G>T (p.Arg2328Leu) rs864622065
NM_000267.3(NF1):c.6992A>G (p.Asn2331Ser) rs763082717
NM_000267.3(NF1):c.7001G>A (p.Ser2334Asn) rs1555535399
NM_000267.3(NF1):c.7011A>G (p.Glu2337=) rs1388098913
NM_000267.3(NF1):c.7016T>G (p.Phe2339Cys)
NM_000267.3(NF1):c.7018A>G (p.Met2340Val) rs1022562410
NM_000267.3(NF1):c.7028G>A (p.Arg2343Gln) rs1555535407
NM_000267.3(NF1):c.7038G>A (p.Leu2346=)
NM_000267.3(NF1):c.703T>C (p.Tyr235His) rs864622465
NM_000267.3(NF1):c.7072G>A (p.Gly2358Arg) rs775476318
NM_000267.3(NF1):c.7079A>G (p.Asn2360Ser) rs878853912
NM_000267.3(NF1):c.7085A>G (p.Asn2362Ser) rs146296921
NM_000267.3(NF1):c.7087T>C (p.Ser2363Pro) rs1555535429
NM_000267.3(NF1):c.7094T>C (p.Phe2365Ser) rs1555535439
NM_000267.3(NF1):c.7098C>G (p.Asn2366Lys) rs1555535444
NM_000267.3(NF1):c.7107G>C (p.Leu2369Phe) rs751081026
NM_000267.3(NF1):c.7107G>T (p.Leu2369Phe)
NM_000267.3(NF1):c.7117C>G (p.Leu2373Val)
NM_000267.3(NF1):c.7120T>G (p.Leu2374Val)
NM_000267.3(NF1):c.7126G>C (p.Gly2376Arg)
NM_000267.3(NF1):c.7127-5T>G rs748245325
NM_000267.3(NF1):c.712C>G (p.Pro238Ala) rs1060500365
NM_000267.3(NF1):c.7135C>T (p.His2379Tyr)
NM_000267.3(NF1):c.7148C>T (p.Ala2383Val) rs771706364
NM_000267.3(NF1):c.7165G>A (p.Val2389Ile) rs1060500372
NM_000267.3(NF1):c.7169_7195delGAATTTTACATACACTACTAACTCTGG (p.Arg2390_Val2399delinsIle)
NM_000267.3(NF1):c.7186_7188delCTA (p.Leu2396del) rs1555536023
NM_000267.3(NF1):c.7190C>T (p.Thr2397Ile) rs764022114
NM_000267.3(NF1):c.7199A>C (p.Asn2400Thr) rs774339063
NM_000267.3(NF1):c.7199A>G (p.Asn2400Ser) rs774339063
NM_000267.3(NF1):c.7218C>A (p.Asp2406Glu)
NM_000267.3(NF1):c.7240A>G (p.Ser2414Gly) rs1555536038
NM_000267.3(NF1):c.7263A>G (p.Leu2421=) rs753224880
NM_000267.3(NF1):c.7276G>C (p.Glu2426Gln) rs878853914
NM_000267.3(NF1):c.7278A>C (p.Glu2426Asp) rs878853915
NM_000267.3(NF1):c.7286G>A (p.Arg2429Gln) rs533110479
NM_000267.3(NF1):c.7291C>T (p.Arg2431Cys) rs377662483
NM_000267.3(NF1):c.7298G>C (p.Ser2433Thr) rs1555536127
NM_000267.3(NF1):c.730+16dupA rs373999174
NM_000267.3(NF1):c.730+5G>A
NM_000267.3(NF1):c.7305A>C (p.Lys2435Asn) rs201287021
NM_000267.3(NF1):c.7306C>T (p.His2436Tyr) rs768404575
NM_000267.3(NF1):c.7307A>G (p.His2436Arg) rs863224664
NM_000267.3(NF1):c.730G>A (p.Glu244Lys)
NM_000267.3(NF1):c.7310G>A (p.Arg2437Lys) rs1555536130
NM_000267.3(NF1):c.7318C>G (p.Leu2440Val) rs1199046022
NM_000267.3(NF1):c.7322T>C (p.Leu2441Pro) rs1060500302
NM_000267.3(NF1):c.732A>C (p.Glu244Asp)
NM_000267.3(NF1):c.7331A>G (p.Asp2444Gly) rs143474365
NM_000267.3(NF1):c.7333A>C (p.Ile2445Leu) rs748027595
NM_000267.3(NF1):c.7333A>G (p.Ile2445Val) rs748027595
NM_000267.3(NF1):c.7334T>C (p.Ile2445Thr) rs771915484
NM_000267.3(NF1):c.7337C>T (p.Ser2446Leu) rs1555536135
NM_000267.3(NF1):c.7339A>G (p.Met2447Val) rs151211377
NM_000267.3(NF1):c.7343A>G (p.Glu2448Gly)
NM_000267.3(NF1):c.7354A>G (p.Met2452Val) rs1555536144
NM_000267.3(NF1):c.7361C>T (p.Thr2454Ile) rs770532573
NM_000267.3(NF1):c.7363T>C (p.Tyr2455His) rs864622745
NM_000267.3(NF1):c.7369A>G (p.Ile2457Val) rs759307070
NM_000267.3(NF1):c.7391A>G (p.Tyr2464Cys) rs1022605462
NM_000267.3(NF1):c.7393A>G (p.Arg2465Gly) rs752162999
NM_000267.3(NF1):c.7394+3A>G rs1555536170
NM_000267.3(NF1):c.7395-?_*3522+?dup
NM_000267.3(NF1):c.7402A>G (p.Lys2468Glu) rs1555536338
NM_000267.3(NF1):c.7403A>G (p.Lys2468Arg) rs864622249
NM_000267.3(NF1):c.740A>G (p.Glu247Gly) rs864622385
NM_000267.3(NF1):c.7433G>A (p.Gly2478Asp) rs375176282
NM_000267.3(NF1):c.7450G>A (p.Ala2484Thr)
NM_000267.3(NF1):c.7451C>T (p.Ala2484Val)
NM_000267.3(NF1):c.7462C>T (p.Pro2488Ser) rs886052803
NM_000267.3(NF1):c.746T>G (p.Leu249Arg)
NM_000267.3(NF1):c.7471G>A (p.Gly2491Ser) rs766496842
NM_000267.3(NF1):c.7489G>A (p.Ala2497Thr)
NM_000267.3(NF1):c.7490C>A (p.Ala2497Asp) rs1060500265
NM_000267.3(NF1):c.7522C>T (p.Pro2508Ser) rs1555536370
NM_000267.3(NF1):c.7525T>C (p.Ser2509Pro)
NM_000267.3(NF1):c.753C>G (p.Asp251Glu)
NM_000267.3(NF1):c.7551T>C (p.Leu2517=) rs1555536374
NM_000267.3(NF1):c.7552+5G>A rs1555536382
NM_000267.3(NF1):c.7555A>G (p.Thr2519Ala) rs1555536632
NM_000267.3(NF1):c.7556C>A (p.Thr2519Lys) rs1555536633
NM_000267.3(NF1):c.757G>T (p.Val253Leu) rs786203607
NM_000267.3(NF1):c.7580T>G (p.Ile2527Arg) rs864622266
NM_000267.3(NF1):c.7594G>C (p.Ala2532Pro) rs1555536644
NM_000267.3(NF1):c.7637C>G (p.Pro2546Arg) rs754511534
NM_000267.3(NF1):c.7654G>A (p.Ala2552Thr) rs1555536654
NM_000267.3(NF1):c.7726T>C (p.Ser2576Pro) rs864622364
NM_000267.3(NF1):c.7730T>C (p.Val2577Ala) rs760531845
NM_000267.3(NF1):c.7741A>T (p.Asn2581Tyr) rs150657839
NM_000267.3(NF1):c.7744G>A (p.Val2582Ile)
NM_000267.3(NF1):c.7744G>C (p.Val2582Leu) rs766135206
NM_000267.3(NF1):c.7747C>G (p.Leu2583Val) rs776602307
NM_000267.3(NF1):c.7752G>A (p.Leu2584=) rs1555536703
NM_000267.3(NF1):c.7762G>C (p.Val2588Leu) rs786203848
NM_000267.3(NF1):c.7779G>T (p.Lys2593Asn) rs1555536710
NM_000267.3(NF1):c.7781T>A (p.Ile2594Asn) rs1555536711
NM_000267.3(NF1):c.778A>G (p.Thr260Ala)
NM_000267.3(NF1):c.779C>T (p.Thr260Ile)
NM_000267.3(NF1):c.7806+4A>G
NM_000267.3(NF1):c.7806+6G>A rs864622318
NM_000267.3(NF1):c.7807-13dupT rs369360556
NM_000267.3(NF1):c.7807-20A>G rs574898272
NM_000267.3(NF1):c.7807-8C>A rs372441422
NM_000267.3(NF1):c.7813C>G (p.Leu2605Val) rs1555536748
NM_000267.3(NF1):c.7825A>G (p.Thr2609Ala)
NM_000267.3(NF1):c.7826C>G (p.Thr2609Ser) rs1283946778
NM_000267.3(NF1):c.784C>T (p.Arg262Cys) rs754343223
NM_000267.3(NF1):c.7852C>G (p.Leu2618Val) rs1057518362
NM_000267.3(NF1):c.785G>A (p.Arg262His) rs1555608957
NM_000267.3(NF1):c.7882G>A (p.Val2628Met) rs1555536761
NM_000267.3(NF1):c.7900C>T (p.Pro2634Ser) rs587781791
NM_000267.3(NF1):c.7907+3A>G
NM_000267.3(NF1):c.7907+6T>G rs1555536775
NM_000267.3(NF1):c.7929G>C (p.Lys2643Asn) rs1060500377
NM_000267.3(NF1):c.7987A>C (p.Ile2663Leu) rs1555536913
NM_000267.3(NF1):c.7999G>T (p.Val2667Leu)
NM_000267.3(NF1):c.8010T>G (p.His2670Gln) rs375468032
NM_000267.3(NF1):c.8017T>A (p.Ser2673Thr)
NM_000267.3(NF1):c.8020C>T (p.Pro2674Ser) rs772707560
NM_000267.3(NF1):c.8040T>G (p.Ser2680=) rs1555536935
NM_000267.3(NF1):c.8044C>A (p.Leu2682Met) rs955074155
NM_000267.3(NF1):c.8075G>A (p.Arg2692Gln)
NM_000267.3(NF1):c.8076dup (p.Phe2693Valfs)
NM_000267.3(NF1):c.814A>G (p.Ile272Val) rs1555608971
NM_000267.3(NF1):c.8159C>A (p.Thr2720Lys) rs144178015
NM_000267.3(NF1):c.8159C>T (p.Thr2720Met) rs144178015
NM_000267.3(NF1):c.8181A>T (p.Glu2727Asp) rs878853919
NM_000267.3(NF1):c.8204T>A (p.Leu2735Gln) rs1555537241
NM_000267.3(NF1):c.8225C>A (p.Pro2742His) rs878853920
NM_000267.3(NF1):c.823A>T (p.Ile275Phe) rs786202464
NM_000267.3(NF1):c.8260A>T (p.Asn2754Tyr) rs1555537252
NM_000267.3(NF1):c.8261A>G (p.Asn2754Ser) rs772090874
NM_000267.3(NF1):c.8300C>T (p.Ser2767Phe)
NM_000267.3(NF1):c.8313A>C (p.Pro2771=) rs1028961967
NM_000267.3(NF1):c.8329A>T (p.Asn2777Tyr) rs1555538514
NM_000267.3(NF1):c.8344C>A (p.Pro2782Thr) rs779180729
NM_000267.3(NF1):c.8358C>A (p.His2786Gln)
NM_000267.3(NF1):c.8393G>A (p.Ser2798Asn) rs934837854
NM_000267.3(NF1):c.8398G>A (p.Val2800Met)
NM_000267.3(NF1):c.8406G>T (p.Lys2802Asn) rs1203883572
NM_000267.3(NF1):c.8414G>C (p.Ser2805Thr) rs1057523477
NM_000267.3(NF1):c.8416G>A (p.Ala2806Thr) rs199878086
NM_000267.3(NF1):c.8427C>G (p.Phe2809Leu)
NM_000267.3(NF1):c.8435A>G (p.Asn2812Ser)
NM_000267.3(NF1):c.845A>G (p.Gln282Arg) rs779034900
NM_000267.3(NF1):c.847G>T (p.Asp283Tyr) rs200572531
NM_000267.3(NF1):c.848A>G (p.Asp283Gly) rs878853921
NM_000267.3(NF1):c.852A>G (p.Ile284Met)
NM_000267.3(NF1):c.853T>G (p.Ser285Ala) rs1555608981
NM_000267.3(NF1):c.873A>C (p.Glu291Asp) rs754915138
NM_000267.3(NF1):c.884A>G (p.Asn295Ser) rs1555608994
NM_000267.3(NF1):c.885T>A (p.Asn295Lys) rs864622300
NM_000267.3(NF1):c.888+6G>T rs1555609000
NM_000267.3(NF1):c.88A>C (p.Thr30Pro) rs1555604881
NM_000267.3(NF1):c.926G>A (p.Gly309Asp) rs1555610862
NM_000267.3(NF1):c.964A>G (p.Ile322Val) rs755007999
NM_000267.3(NF1):c.97A>G (p.Lys33Glu) rs1060500324
NM_000267.3(NF1):c.988G>C (p.Ala330Pro) rs199474767
NM_000267.3(NF1):c.98A>G (p.Lys33Arg) rs1555604887
NM_000267.3:c.799_802delTGGC
NM_001042492.2(NF1):c.100G>A (p.Val34Ile) rs772995929
NM_001042492.2(NF1):c.1061A>G (p.Lys354Arg) rs1135402801
NM_001042492.2(NF1):c.1063-13G>A rs1131691066
NM_001042492.2(NF1):c.1082G>C (p.Ser361Thr) rs876660103
NM_001042492.2(NF1):c.1166A>G (p.His389Arg) rs149739570
NM_001042492.2(NF1):c.1213A>G (p.Thr405Ala) rs587782233
NM_001042492.2(NF1):c.122A>C (p.Glu41Ala) rs786203038
NM_001042492.2(NF1):c.1244A>G (p.His415Arg) rs1555611097
NM_001042492.2(NF1):c.1264G>A (p.Ala422Thr) rs786202145
NM_001042492.2(NF1):c.1308G>A (p.Ser436=) rs765425127
NM_001042492.2(NF1):c.1310T>A (p.Val437Asp) rs876658642
NM_001042492.2(NF1):c.134A>G (p.Asn45Ser) rs753189381
NM_001042492.2(NF1):c.1358G>T (p.Gly453Val) rs876660915
NM_001042492.2(NF1):c.1370A>T (p.His457Leu) rs786202763
NM_001042492.2(NF1):c.1392+5_1392+6delGAinsTT rs587782851
NM_001042492.2(NF1):c.1392G>A (p.Pro464=) rs201604273
NM_001042492.2(NF1):c.1460G>A (p.Arg487Lys) rs1135402809
NM_001042492.2(NF1):c.1472A>G (p.Tyr491Cys) rs199474757
NM_001042492.2(NF1):c.1477C>G (p.Leu493Val) rs1135402812
NM_001042492.2(NF1):c.1553C>T (p.Thr518Ile) rs587782696
NM_001042492.2(NF1):c.1585C>T (p.Leu529Phe) rs1135402816
NM_001042492.2(NF1):c.1588G>A (p.Val530Ile) rs145191978
NM_001042492.2(NF1):c.1609C>T (p.His537Tyr) rs786203860
NM_001042492.2(NF1):c.1620G>T (p.Glu540Asp) rs766748586
NM_001042492.2(NF1):c.1646T>C (p.Leu549Pro) rs199474758
NM_001042492.2(NF1):c.1649T>C (p.Leu550Pro) rs886052798
NM_001042492.2(NF1):c.1662G>T (p.Gln554His) rs147594815
NM_001042492.2(NF1):c.1714_1721+5del rs1135402821
NM_001042492.2(NF1):c.1775G>A (p.Ser592Asn) rs760256377
NM_001042492.2(NF1):c.1801C>T (p.Arg601Trp) rs587782592
NM_001042492.2(NF1):c.1810T>C (p.Leu604=) rs142712751
NM_001042492.2(NF1):c.1845G>T (p.Lys615Asn) rs1131691080
NM_001042492.2(NF1):c.1855A>G (p.Arg619Gly) rs587781821
NM_001042492.2(NF1):c.1870T>C (p.Phe624Leu) rs765060733
NM_001042492.2(NF1):c.1889T>A (p.Val630Glu) rs1135402824
NM_001042492.2(NF1):c.1891G>A (p.Gly631Arg) rs757424379
NM_001042492.2(NF1):c.1894T>A (p.Cys632Ser) rs370789267
NM_001042492.2(NF1):c.1921A>G (p.Ser641Gly) rs769154907
NM_001042492.2(NF1):c.1954C>T (p.Arg652Cys) rs786202436
NM_001042492.2(NF1):c.1972C>T (p.Leu658Phe) rs763901597
NM_001042492.2(NF1):c.1975C>T (p.Arg659Trp) rs757512142
NM_001042492.2(NF1):c.1987G>A (p.Gly663Arg) rs140653372
NM_001042492.2(NF1):c.1999A>G (p.Met667Val) rs749833271
NM_001042492.2(NF1):c.2002-4_2002-3delTC rs786203664
NM_001042492.2(NF1):c.200A>G (p.Asn67Ser) rs375038808
NM_001042492.2(NF1):c.2014G>A (p.Gly672Arg) rs786202632
NM_001042492.2(NF1):c.2015G>T (p.Gly672Val) rs371817372
NM_001042492.2(NF1):c.2023G>A (p.Gly675Arg) rs779546178
NM_001042492.2(NF1):c.2032C>A (p.Pro678Thr) rs758691069
NM_001042492.2(NF1):c.2032C>G (p.Pro678Ala) rs758691069
NM_001042492.2(NF1):c.2032C>T (p.Pro678Ser) rs758691069
NM_001042492.2(NF1):c.2042G>A (p.Arg681Gln) rs786201768
NM_001042492.2(NF1):c.2054C>G (p.Thr685Ser) rs876658190
NM_001042492.2(NF1):c.2072T>C (p.Leu691Pro) rs1131691132
NM_001042492.2(NF1):c.2158C>T (p.Arg720Trp) rs759679443
NM_001042492.2(NF1):c.2188A>C (p.Asn730His) rs758893131
NM_001042492.2(NF1):c.2188A>T (p.Asn730Tyr) rs758893131
NM_001042492.2(NF1):c.2191C>T (p.Leu731Phe) rs185204667
NM_001042492.2(NF1):c.2233A>G (p.Ser745Gly) rs786201865
NM_001042492.2(NF1):c.2244G>A (p.Met748Ile) rs786202478
NM_001042492.2(NF1):c.2248A>G (p.Thr750Ala) rs748064845
NM_001042492.2(NF1):c.231A>T (p.Lys77Asn) rs373563053
NM_001042492.2(NF1):c.234T>A (p.Asn78Lys) rs876658354
NM_001042492.2(NF1):c.239A>G (p.Tyr80Cys) rs4795581
NM_001042492.2(NF1):c.241C>A (p.Leu81Ile) rs587782772
NM_001042492.2(NF1):c.2434A>C (p.Ile812Leu) rs587781899
NM_001042492.2(NF1):c.2434A>G (p.Ile812Val) rs587781899
NM_001042492.2(NF1):c.2476A>C (p.Ile826Leu) rs767069721
NM_001042492.2(NF1):c.2564G>C (p.Arg855Thr) rs786203716
NM_001042492.2(NF1):c.2573C>G (p.Ser858Cys) rs369493270
NM_001042492.2(NF1):c.2576G>C (p.Gly859Ala) rs876659829
NM_001042492.2(NF1):c.2581G>C (p.Ala861Pro) rs768425956
NM_001042492.2(NF1):c.2594C>T (p.Pro865Leu) rs786203084
NM_001042492.2(NF1):c.2597C>T (p.Pro866Leu) rs767159555
NM_001042492.2(NF1):c.2617C>T (p.Arg873Cys) rs199474739
NM_001042492.2(NF1):c.2629A>G (p.Met877Val) rs764950557
NM_001042492.2(NF1):c.2643G>A (p.Met881Ile) rs376666221
NM_001042492.2(NF1):c.2652G>A (p.Glu884=) rs757843283
NM_001042492.2(NF1):c.2683A>G (p.Met895Val) rs876659129
NM_001042492.2(NF1):c.2747A>G (p.Asn916Ser) rs765043916
NM_001042492.2(NF1):c.2764G>A (p.Gly922Ser) rs1135402831
NM_001042492.2(NF1):c.278G>A (p.Cys93Tyr) rs199474728
NM_001042492.2(NF1):c.2803A>C (p.Asn935His) rs786201823
NM_001042492.2(NF1):c.2821A>G (p.Ile941Val) rs876659888
NM_001042492.2(NF1):c.2870A>T (p.Asn957Ile) rs1135402834
NM_001042492.2(NF1):c.2886_2897del (p.Glu962_Ala966delinsAsp) rs1135402835
NM_001042492.2(NF1):c.2896G>A (p.Ala966Thr) rs876658849
NM_001042492.2(NF1):c.2899A>G (p.Ile967Val) rs876660279
NM_001042492.2(NF1):c.2968A>C (p.Thr990Pro) rs876658299
NM_001042492.2(NF1):c.2999G>T (p.Arg1000Leu) rs753082620
NM_001042492.2(NF1):c.3038C>T (p.Thr1013Met) rs786203132
NM_001042492.2(NF1):c.3074G>A (p.Arg1025Lys) rs876659876
NM_001042492.2(NF1):c.3104T>C (p.Met1035Thr) rs137854553
NM_001042492.2(NF1):c.3113+2T>C rs876658997
NM_001042492.2(NF1):c.3197+3A>T rs1359512152
NM_001042492.2(NF1):c.3198-4T>C rs587782218
NM_001042492.2(NF1):c.3217A>G (p.Met1073Val) rs199474740
NM_001042492.2(NF1):c.3362A>G (p.Glu1121Gly) rs757222815
NM_001042492.2(NF1):c.3394C>T (p.Arg1132Cys) rs587781725
NM_001042492.2(NF1):c.3436G>A (p.Val1146Ile) rs201047812
NM_001042492.2(NF1):c.3461A>G (p.Asn1154Ser) rs371544233
NM_001042492.2(NF1):c.3485T>G (p.Met1162Arg) rs200732832
NM_001042492.2(NF1):c.3490T>G (p.Ser1164Ala) rs750303863
NM_001042492.2(NF1):c.3498C>T (p.Gly1166=) rs2066733
NM_001042492.2(NF1):c.3521A>G (p.Gln1174Arg) rs1135402843
NM_001042492.2(NF1):c.3578T>C (p.Phe1193Ser) rs199474780
NM_001042492.2(NF1):c.3604G>T (p.Ala1202Ser) rs146641724
NM_001042492.2(NF1):c.3621A>G (p.Arg1207=) rs141390152
NM_001042492.2(NF1):c.3632T>G (p.Leu1211Arg) rs1135402845
NM_001042492.2(NF1):c.3651T>G (p.Asp1217Glu) rs1135402846
NM_001042492.2(NF1):c.3653A>G (p.Gln1218Arg) rs876659541
NM_001042492.2(NF1):c.367A>G (p.Thr123Ala) rs587781757
NM_001042492.2(NF1):c.3722G>A (p.Arg1241Gln) rs543387071
NM_001042492.2(NF1):c.3732T>A (p.Val1244=) rs756653022
NM_001042492.2(NF1):c.374G>A (p.Arg125His) rs149003051
NM_001042492.2(NF1):c.3765A>G (p.Gln1255=) rs766896025
NM_001042492.2(NF1):c.3812T>C (p.Met1271Thr) rs876659801
NM_001042492.2(NF1):c.3834C>G (p.Asn1278Lys) rs1135402850
NM_001042492.2(NF1):c.3867C>T (p.Phe1289=) rs138186428
NM_001042492.2(NF1):c.3883A>G (p.Thr1295Ala) rs143836226
NM_001042492.2(NF1):c.3906T>G (p.Asp1302Glu) rs549058591
NM_001042492.2(NF1):c.3921T>G (p.Ile1307Met) rs876660805
NM_001042492.2(NF1):c.3932C>T (p.Ser1311Phe) rs587782894
NM_001042492.2(NF1):c.3970A>G (p.Thr1324Ala) rs189522993
NM_001042492.2(NF1):c.3976T>A (p.Leu1326Ile) rs765957571
NM_001042492.2(NF1):c.3978A>T (p.Leu1326Phe) rs876660506
NM_001042492.2(NF1):c.4009C>T (p.Arg1337Trp) rs146306756
NM_001042492.2(NF1):c.4043A>G (p.His1348Arg) rs786201844
NM_001042492.2(NF1):c.4055G>C (p.Ser1352Thr) rs876660908
NM_001042492.2(NF1):c.4109A>C (p.Gln1370Pro) rs1135402853
NM_001042492.2(NF1):c.4110+3A>G rs774669878
NM_001042492.2(NF1):c.4110+4T>C rs587781700
NM_001042492.2(NF1):c.4110G>C (p.Gln1370His) rs1135402854
NM_001042492.2(NF1):c.4207G>A (p.Gly1403Ser) rs138227618
NM_001042492.2(NF1):c.4219A>G (p.Ser1407Gly) rs587781755
NM_001042492.2(NF1):c.4227G>C (p.Met1409Ile) rs786201895
NM_001042492.2(NF1):c.4252A>G (p.Ile1418Val) rs369345045
NM_001042492.2(NF1):c.4306G>A (p.Glu1436Lys) rs876660428
NM_001042492.2(NF1):c.4330A>C (p.Lys1444Gln) rs137854550
NM_001042492.2(NF1):c.4341G>C (p.Gln1447His) rs876660206
NM_001042492.2(NF1):c.4352A>C (p.Asn1451Thr) rs199474754
NM_001042492.2(NF1):c.4352A>G (p.Asn1451Ser) rs199474754
NM_001042492.2(NF1):c.4357G>A (p.Val1453Ile) rs199474755
NM_001042492.2(NF1):c.4372G>A (p.Glu1458Lys) rs1135402858
NM_001042492.2(NF1):c.4378C>T (p.His1460Tyr) rs377295676
NM_001042492.2(NF1):c.4382T>C (p.Met1461Thr) rs754639587
NM_001042492.2(NF1):c.4385G>A (p.Arg1462Gln) rs370852681
NM_001042492.2(NF1):c.4409G>A (p.Ser1470Asn) rs876660093
NM_001042492.2(NF1):c.4412A>G (p.Asn1471Ser) rs876658250
NM_001042492.2(NF1):c.4421C>T (p.Ala1474Val) rs587781553
NM_001042492.2(NF1):c.4446A>G (p.Ile1482Met) rs876658776
NM_001042492.2(NF1):c.4462A>G (p.Thr1488Ala) rs876660162
NM_001042492.2(NF1):c.4472C>T (p.Ala1491Val) rs876658334
NM_001042492.2(NF1):c.4489T>C (p.Ser1497Pro) rs763266925
NM_001042492.2(NF1):c.4495A>G (p.Ile1499Val) rs764654925
NM_001042492.2(NF1):c.4498A>G (p.Ser1500Gly) rs1135402862
NM_001042492.2(NF1):c.4504G>A (p.Gly1502Ser) rs876659607
NM_001042492.2(NF1):c.4508A>G (p.Asn1503Ser) rs587781445
NM_001042492.2(NF1):c.4526G>A (p.Arg1509His) rs546073780
NM_001042492.2(NF1):c.4532T>G (p.Leu1511Arg) rs1135402864
NM_001042492.2(NF1):c.4544A>G (p.Gln1515Arg) rs1135402865
NM_001042492.2(NF1):c.4631C>A (p.Ala1544Glu) rs1555619015
NM_001042492.2(NF1):c.4670C>G (p.Thr1557Arg) rs876660065
NM_001042492.2(NF1):c.467G>T (p.Arg156Leu) rs754096545
NM_001042492.2(NF1):c.4749A>G (p.Glu1583=) rs144091165
NM_001042492.2(NF1):c.475A>G (p.Thr159Ala) rs371192107
NM_001042492.2(NF1):c.4813A>G (p.Ile1605Val) rs199474766
NM_001042492.2(NF1):c.4835+5G>C rs786201306
NM_001042492.2(NF1):c.4836-3T>C rs372460369
NM_001042492.2(NF1):c.4851A>G (p.Gln1617=) rs150309802
NM_001042492.2(NF1):c.4882T>C (p.Leu1628=) rs10512435
NM_001042492.2(NF1):c.4929G>T (p.Val1643=) rs17880521
NM_001042492.2(NF1):c.493A>G (p.Thr165Ala) rs786203186
NM_001042492.2(NF1):c.4942A>G (p.Thr1648Ala) rs770558820
NM_001042492.2(NF1):c.4943C>T (p.Thr1648Ile) rs376655102
NM_001042492.2(NF1):c.4957C>T (p.Arg1653Cys) rs876659922
NM_001042492.2(NF1):c.5026G>A (p.Ala1676Thr) rs756450772
NM_001042492.2(NF1):c.5087T>C (p.Leu1696Pro) rs745489489
NM_001042492.2(NF1):c.5092A>T (p.Thr1698Ser) rs876659017
NM_001042492.2(NF1):c.5114G>A (p.Arg1705Lys) rs876660487
NM_001042492.2(NF1):c.512A>G (p.Asn171Ser) rs767500770
NM_001042492.2(NF1):c.5160G>T (p.Glu1720Asp) rs773378630
NM_001042492.2(NF1):c.5169A>T (p.Gln1723His) rs864622372
NM_001042492.2(NF1):c.5257G>A (p.Val1753Ile) rs148540952
NM_001042492.2(NF1):c.5289A>G (p.Gln1763=) rs199703296
NM_001042492.2(NF1):c.5290G>A (p.Val1764Ile) rs778427434
NM_001042492.2(NF1):c.529A>G (p.Ile177Val) rs766213678
NM_001042492.2(NF1):c.5311A>G (p.Lys1771Glu) rs1131691103
NM_001042492.2(NF1):c.5381T>C (p.Val1794Ala) rs142867979
NM_001042492.2(NF1):c.5385T>A (p.Asp1795Glu) rs1135402870
NM_001042492.2(NF1):c.5407A>G (p.Ile1803Val) rs559910904
NM_001042492.2(NF1):c.5423C>T (p.Thr1808Met) rs760649828
NM_001042492.2(NF1):c.5426C>T (p.Pro1809Leu) rs587782220
NM_001042492.2(NF1):c.5458A>C (p.Ile1820Leu) rs786202459
NM_001042492.2(NF1):c.5476C>G (p.His1826Asp) rs1135402871
NM_001042492.2(NF1):c.5483G>A (p.Arg1828Gln) rs876660298
NM_001042492.2(NF1):c.5513C>G (p.Ser1838Cys) rs368654378
NM_001042492.2(NF1):c.5523A>G (p.Gln1841=) rs151046636
NM_001042492.2(NF1):c.5572G>A (p.Ala1858Thr) rs786203416
NM_001042492.2(NF1):c.5719T>C (p.Phe1907Leu) rs876660040
NM_001042492.2(NF1):c.5731A>G (p.Ile1911Val) rs146523293
NM_001042492.2(NF1):c.5741C>A (p.Thr1914Lys) rs1555533873
NM_001042492.2(NF1):c.5753A>G (p.Asn1918Ser) rs534249104
NM_001042492.2(NF1):c.575G>A (p.Arg192Gln) rs587781670
NM_001042492.2(NF1):c.584A>G (p.Lys195Arg) rs587778552
NM_001042492.2(NF1):c.586G>A (p.Glu196Lys) rs876659079
NM_001042492.2(NF1):c.5906A>T (p.Gln1969Leu) rs143502927
NM_001042492.2(NF1):c.5947A>G (p.Ile1983Val) rs876658484
NM_001042492.2(NF1):c.5959C>G (p.Gln1987Glu) rs876659070
NM_001042492.2(NF1):c.6006G>C (p.Gln2002His) rs1555534432
NM_001042492.2(NF1):c.615G>A (p.Lys205=) rs1135402794
NM_001042492.2(NF1):c.6172A>G (p.Ile2058Val) rs201712827
NM_001042492.2(NF1):c.6293C>T (p.Ala2098Val) rs764106639
NM_001042492.2(NF1):c.6310T>C (p.Phe2104Leu) rs876660000
NM_001042492.2(NF1):c.6323C>T (p.Thr2108Ile) rs876658920
NM_001042492.2(NF1):c.6424A>C (p.Ser2142Arg) rs1135402886
NM_001042492.2(NF1):c.6428-3C>T rs374014162
NM_001042492.2(NF1):c.647T>C (p.Leu216Pro) rs199474756
NM_001042492.2(NF1):c.654+4del rs1555608683
NM_001042492.2(NF1):c.6555G>A (p.Arg2185=) rs786203189
NM_001042492.2(NF1):c.6586A>G (p.Thr2196Ala) rs372169109
NM_001042492.2(NF1):c.6642+4T>C rs587781687
NM_001042492.2(NF1):c.6657T>G (p.Asp2219Glu) rs786203831
NM_001042492.2(NF1):c.6664A>G (p.Thr2222Ala) rs745945481
NM_001042492.2(NF1):c.6665C>T (p.Thr2222Met) rs369803831
NM_001042492.2(NF1):c.6704+3A>G rs375560135
NM_001042492.2(NF1):c.6758G>A (p.Gly2253Glu) rs876659295
NM_001042492.2(NF1):c.6773G>A (p.Arg2258Gln) rs786202030
NM_001042492.2(NF1):c.6779C>T (p.Ser2260Phe) rs876658775
NM_001042492.2(NF1):c.6781C>T (p.His2261Tyr) rs750869272
NM_001042492.2(NF1):c.6806G>A (p.Arg2269His) rs562367786
NM_001042492.2(NF1):c.6818A>G (p.Lys2273Arg) rs1060500344
NM_001042492.2(NF1):c.6819G>T (p.Lys2273Asn) rs1060500373
NM_001042492.2(NF1):c.6837A>C (p.Leu2279Phe) rs144287929
NM_001042492.2(NF1):c.6900A>C (p.Lys2300Asn) rs786203861
NM_001042492.2(NF1):c.6922-3C>T rs876659438
NM_001042492.2(NF1):c.6955G>A (p.Ala2319Thr) rs786203881
NM_001042492.2(NF1):c.6978T>C (p.Asp2326=) rs1135402896
NM_001042492.2(NF1):c.7003A>G (p.Thr2335Ala) rs370209920
NM_001042492.2(NF1):c.7006G>A (p.Ala2336Thr) rs587781428
NM_001042492.2(NF1):c.7026G>A (p.Leu2342=) rs371581213
NM_001042492.2(NF1):c.7027C>T (p.His2343Tyr) rs781578248
NM_001042492.2(NF1):c.7057_7059delGAC (p.Asp2353del) rs786203558
NM_001042492.2(NF1):c.7087A>G (p.Ile2363Val) rs137966859
NM_001042492.2(NF1):c.7108C>T (p.His2370Tyr) rs587781479
NM_001042492.2(NF1):c.7181T>G (p.Leu2394Arg) rs1135402899
NM_001042492.2(NF1):c.7189G>A (p.Gly2397Arg) rs1135402900
NM_001042492.2(NF1):c.7213A>G (p.Ile2405Val) rs565708398
NM_001042492.2(NF1):c.7246C>T (p.Leu2416=) rs786201310
NM_001042492.2(NF1):c.7298C>T (p.Thr2433Ile) rs755749772
NM_001042492.2(NF1):c.7306G>A (p.Val2436Met) rs876659856
NM_001042492.2(NF1):c.7343_7345delAAG (p.Glu2448del) rs587781961
NM_001042492.2(NF1):c.7387_7389delCTT (p.Leu2463del) rs786203184
NM_001042492.2(NF1):c.7415C>G (p.Pro2472Arg) rs786202184
NM_001042492.2(NF1):c.7429C>G (p.Pro2477Ala) rs876658722
NM_001042492.2(NF1):c.7439A>G (p.His2480Arg) rs371151718
NM_001042492.2(NF1):c.7446C>A (p.Asp2482Glu) rs876660614
NM_001042492.2(NF1):c.7484C>T (p.Ser2495Phe) rs757245615
NM_001042492.2(NF1):c.7487C>G (p.Ser2496Cys) rs371773406
NM_001042492.2(NF1):c.7520C>T (p.Thr2507Ile) rs149055633
NM_001042492.2(NF1):c.7526C>T (p.Pro2509Leu) rs786202146
NM_001042492.2(NF1):c.7528A>G (p.Thr2510Ala) rs145794301
NM_001042492.2(NF1):c.7536C>T (p.Gly2512=) rs786203187
NM_001042492.2(NF1):c.7584A>G (p.Gln2528=) rs55865524
NM_001042492.2(NF1):c.7600A>G (p.Thr2534Ala) rs779737221
NM_001042492.2(NF1):c.7645T>C (p.Ser2549Pro) rs767458044
NM_001042492.2(NF1):c.7693A>G (p.Thr2565Ala) rs786202548
NM_001042492.2(NF1):c.7700C>T (p.Pro2567Leu) rs754511534
NM_001042492.2(NF1):c.7742C>G (p.Thr2581Ser) rs757632129
NM_001042492.2(NF1):c.7767G>C (p.Gln2589His) rs587782168
NM_001042492.2(NF1):c.7781G>A (p.Arg2594His) rs774781617
NM_001042492.2(NF1):c.7825G>A (p.Val2609Ile) rs786203848
NM_001042492.2(NF1):c.7838C>T (p.Pro2613Leu) rs750972729
NM_001042492.2(NF1):c.7841A>G (p.Lys2614Arg) rs587781502
NM_001042492.2(NF1):c.7850C>T (p.Ala2617Val) rs375990655
NM_001042492.2(NF1):c.7891A>G (p.Thr2631Ala) rs199474793
NM_001042492.2(NF1):c.7910G>A (p.Arg2637Gln) rs560262404
NM_001042492.2(NF1):c.8080T>C (p.Ser2694Pro) rs876658554
NM_001042492.2(NF1):c.8160+2T>G rs1135402909
NM_001042492.2(NF1):c.8176G>A (p.Asp2726Asn) rs1135402910
NM_001042492.2(NF1):c.8183C>T (p.Ala2728Val) rs760973918
NM_001042492.2(NF1):c.8216T>C (p.Ile2739Thr) rs752541243
NM_001042492.2(NF1):c.8238T>G (p.Ile2746Met) rs779789452
NM_001042492.2(NF1):c.8324A>C (p.Asn2775Thr) rs772090874
NM_001042492.2(NF1):c.8395G>A (p.Val2799Ile) rs377393842
NM_001042492.2(NF1):c.83A>C (p.Gln28Pro) rs587782686
NM_001042492.2(NF1):c.8446G>A (p.Gly2816Arg) rs778233452
NM_001042492.2(NF1):c.8479G>T (p.Ala2827Ser) rs199878086
NM_001042492.2(NF1):c.8490C>A (p.Phe2830Leu) rs760550772
NM_001042492.2(NF1):c.8494C>T (p.Arg2832Cys) rs587782893
NM_001042492.2(NF1):c.8495G>A (p.Arg2832His) rs587781523
NM_001042492.2(NF1):c.8497A>C (p.Asn2833His) rs786202863
NM_001042492.2(NF1):c.8499T>C (p.Asn2833=) rs142636150
NM_001042492.2(NF1):c.8515G>A (p.Val2839Met) rs368149035
NM_001042492.2(NF1):c.862G>A (p.Val288Met) rs755670651
NM_001042492.2(NF1):c.886A>T (p.Lys296Ter) rs1135402798
NM_001042492.2(NF1):c.888+5G>A rs556444929
NM_001042492.2(NF1):c.905G>A (p.Ser302Asn) rs786202746
NM_001042492.2(NF1):c.923C>G (p.Ala308Gly) rs876660836
NM_001042492.2(NF1):c.965T>C (p.Ile322Thr) rs1417994243
NM_001042492.2(NF1):c.99A>G (p.Lys33=) rs786203280

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.