ClinVar Miner

List of variants in gene NF1 reported as pathogenic

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 911
Download table as spreadsheet
HGVS dbSNP
GRCh38/hg38 17q11.2(chr17:31206265-31261713)x1
GRCh38/hg38 17q11.2(chr17:31223174-31246335)x1
LRG_214t1:c.3975-1046_4110+902deins333
LRG_214t1:c.3975-364_4515-510indel
LRG_214t1:c.5547-961+5943+244del
LRG_214t1:c.7566_8314+3321_delinsCGCCACGGC
NC_000017.10:g.(?_29486022)_(29533395_?)del
NC_000017.10:g.(?_29508434)_(29509689_?)del
NC_000017.11:g.(?_31163186)_(31163376_?)del
NC_000017.11:g.(?_31163186)_(31169997_?)del
NC_000017.11:g.(?_31200412)_(31206381_?)del
NC_000017.11:g.(?_31200412)_(31265349_?)del
NC_000017.11:g.(?_31260349)_(31265359_?)dup
NC_000017.11:g.(?_31325814)_(31338145_?)del
NC_000017.11:g.(?_31327499)_(31327839_?)del
NC_000017.11:g.(?_31334828)_(31335041_?)del
NC_000017.11:g.(?_31334832)_(31335037_?)del
NC_000017.11:g.(?_31343009)_(31343135_?)del
NF1, 1-BP DEL, 4071C
NF1, 42-BP DUP
NF1, 5-BP DEL
NF1, 80-KB DEL
NF1, ALU INS
NF1, DEL
NF1, IVS34, G-A, +18
NG_009018.1(NF1):g.[134769_136954del2186;136931_139830del2900]
NM_000267.3(NF1):c.1009G>T (p.Glu337Ter) rs747241884
NM_000267.3(NF1):c.1019_1020delCT (p.Ser340Cysfs) rs1555610903
NM_000267.3(NF1):c.1020dup (p.Val341Cysfs) rs1555610905
NM_000267.3(NF1):c.1039C>T (p.Gln347Ter) rs1555610910
NM_000267.3(NF1):c.1058delT (p.Lys354Argfs) rs863224488
NM_000267.3(NF1):c.1063-2A>G rs1060500358
NM_000267.3(NF1):c.1070T>C (p.Leu357Pro) rs137854563
NM_000267.3(NF1):c.1094C>A (p.Ser365Ter) rs864622107
NM_000267.3(NF1):c.1094C>G (p.Ser365Ter) rs864622107
NM_000267.3(NF1):c.1139T>C (p.Leu380Pro) rs1555611004
NM_000267.3(NF1):c.1178delA (p.His393Profs) rs1555611037
NM_000267.3(NF1):c.1185+1G>A rs864622161
NM_000267.3(NF1):c.1185+2T>G rs1555611043
NM_000267.3(NF1):c.121G>T (p.Glu41Ter)
NM_000267.3(NF1):c.1224T>A (p.Tyr408Ter) rs1555611089
NM_000267.3(NF1):c.1237T>C (p.Ser413Pro) rs1555611093
NM_000267.3(NF1):c.1238C>G (p.Ser413Ter)
NM_000267.3(NF1):c.1246C>T (p.Arg416Ter) rs764079291
NM_000267.3(NF1):c.1260+1G>A rs267606603
NM_000267.3(NF1):c.1260+1G>T
NM_000267.3(NF1):c.1260+220_7553-1095del
NM_000267.3(NF1):c.1299T>G (p.Tyr433Ter) rs876660099
NM_000267.3(NF1):c.129_130ins568 (p.?)
NM_000267.3(NF1):c.1302T>A (p.Cys434Ter) rs1555611570
NM_000267.3(NF1):c.1331delG (p.Gly444Valfs)
NM_000267.3(NF1):c.1343dupA (p.His448Glnfs) rs1555611584
NM_000267.3(NF1):c.1344dup (p.Lys449Terfs)
NM_000267.3(NF1):c.1354C>T (p.Gln452Ter) rs1555611590
NM_000267.3(NF1):c.1381C>T (p.Arg461Ter) rs878853865
NM_000267.3(NF1):c.1392+1G>C
NM_000267.3(NF1):c.1392+1delG (p.Ser465Valfs) rs1060500347
NM_000267.3(NF1):c.1393-1905_2251+85dup
NM_000267.3(NF1):c.1393-2488_1642-648delinsAATAG
NM_000267.3(NF1):c.1393-2652_1528-892del
NM_000267.3(NF1):c.1393-3329_3975-6377del
NM_000267.3(NF1):c.1453G>T (p.Glu485Ter) rs1131691610
NM_000267.3(NF1):c.1466A>G (p.Tyr489Cys) rs137854557
NM_000267.3(NF1):c.1467T>A (p.Tyr489Ter)
NM_000267.3(NF1):c.1469_1470insTTAT (p.Lys490Asnfs) rs1060500307
NM_000267.3(NF1):c.1514delA (p.Lys505Serfs) rs1555612289
NM_000267.3(NF1):c.1523T>C (p.Leu508Pro) rs137854558
NM_000267.3(NF1):c.1525delT (p.Cys509Valfs)
NM_000267.3(NF1):c.1527+1509_1641+1137del
NM_000267.3(NF1):c.1527+1G>A rs1060500331
NM_000267.3(NF1):c.1527+443_3709-761dup
NM_000267.3(NF1):c.1527+5G>A rs1060500352
NM_000267.3(NF1):c.1528-960_1761del
NM_000267.3(NF1):c.1540C>T (p.Gln514Ter) rs1316926587
NM_000267.3(NF1):c.1541delA (p.Gln514Argfs) rs1555612815
NM_000267.3(NF1):c.1549G>T (p.Glu517Ter) rs587778548
NM_000267.3(NF1):c.1572delA (p.Glu524Aspfs) rs1085307461
NM_000267.3(NF1):c.1591C>T (p.Gln531Ter) rs1057518134
NM_000267.3(NF1):c.1595T>C (p.Leu532Pro) rs199474737
NM_000267.3(NF1):c.1595T>G (p.Leu532Arg) rs199474737
NM_000267.3(NF1):c.1603C>T (p.Gln535Ter)
NM_000267.3(NF1):c.1607C>A (p.Ser536Ter) rs1555612859
NM_000267.3(NF1):c.1618G>T (p.Glu540Ter)
NM_000267.3(NF1):c.1619delA (p.Glu540Glyfs)
NM_000267.3(NF1):c.1627C>T (p.Gln543Ter) rs894292181
NM_000267.3(NF1):c.1641+156_3975-2222del
NM_000267.3(NF1):c.1642-1G>A rs1555613185
NM_000267.3(NF1):c.1642-1G>T rs1555613185
NM_000267.3(NF1):c.1642-8A>G rs267606602
NM_000267.3(NF1):c.1658A>G (p.His553Arg) rs1064794274
NM_000267.3(NF1):c.1660C>T (p.Gln554Ter) rs953440640
NM_000267.3(NF1):c.1680delG (p.Leu560Phefs)
NM_000267.3(NF1):c.1713G>A (p.Trp571Ter) rs863224489
NM_000267.3(NF1):c.1721+1G>A rs1131691096
NM_000267.3(NF1):c.1721+1G>C
NM_000267.3(NF1):c.1721+3A>G rs1057518904
NM_000267.3(NF1):c.1721G>A (p.Ser574Asn) rs1555613206
NM_000267.3(NF1):c.1724C>G (p.Ser575Ter)
NM_000267.3(NF1):c.1726C>T (p.Gln576Ter) rs1060500278
NM_000267.3(NF1):c.1738dup (p.Tyr580Leufs) rs786204255
NM_000267.3(NF1):c.1754T>G (p.Leu585Ter)
NM_000267.3(NF1):c.1765C>T (p.Gln589Ter)
NM_000267.3(NF1):c.1782_1783delAG (p.Glu595Asnfs) rs786204059
NM_000267.3(NF1):c.1796G>A (p.Trp599Ter) rs1131691130
NM_000267.3(NF1):c.1797G>A (p.Trp599Ter)
NM_000267.3(NF1):c.1811T>A (p.Leu604Ter) rs1555613427
NM_000267.3(NF1):c.1815delC (p.Cys606Alafs)
NM_000267.3(NF1):c.1818C>A (p.Cys606Ter)
NM_000267.3(NF1):c.1845+1G>A
NM_000267.3(NF1):c.1845+537_4661+331del
NM_000267.3(NF1):c.1846-496_2410-645delinsTAGC
NM_000267.3(NF1):c.1846-613_4773-1009delinsTTAGGTTTAT
NM_000267.3(NF1):c.1857_1863del (p.Arg619Serfs)
NM_000267.3(NF1):c.1863delC (p.Cys622Valfs) rs1131691777
NM_000267.3(NF1):c.1882dup (p.Tyr628Leufs) rs1555613558
NM_000267.3(NF1):c.1883_1885delACGinsCC (p.Tyr628Serfs) rs1135402823
NM_000267.3(NF1):c.1884C>A (p.Tyr628Ter) rs555635097
NM_000267.3(NF1):c.1912G>T (p.Gly638Ter) rs1555613567
NM_000267.3(NF1):c.191delA (p.Asn64Metfs) rs1555604941
NM_000267.3(NF1):c.1973_1974delTC (p.Leu658Profs) rs1064796843
NM_000267.3(NF1):c.1988_2410-218delinsTGTC
NM_000267.3(NF1):c.2002-1G>A rs1555613743
NM_000267.3(NF1):c.200delA (p.Asn67Ilefs) rs1555604942
NM_000267.3(NF1):c.2034delG (p.Ile679Phefs)
NM_000267.3(NF1):c.2034delGinsCA (p.Ile679Asnfs) rs1064796331
NM_000267.3(NF1):c.204+155_2990+53del
NM_000267.3(NF1):c.204+1G>A rs886039548
NM_000267.3(NF1):c.204+1G>T rs886039548
NM_000267.3(NF1):c.204+3_204+6delGAGT
NM_000267.3(NF1):c.2041C>T (p.Arg681Ter) rs768638173
NM_000267.3(NF1):c.2041delC (p.Arg681Aspfs)
NM_000267.3(NF1):c.2048_5041del
NM_000267.3(NF1):c.205-1G>C rs1555605362
NM_000267.3(NF1):c.2062G>T (p.Glu688Ter) rs1555613784
NM_000267.3(NF1):c.2064dup (p.Val689Serfs) rs1555613786
NM_000267.3(NF1):c.206_207delGA (p.Arg69Asnfs) rs1060500321
NM_000267.3(NF1):c.2071delC (p.Leu691Cysfs) rs1060500364
NM_000267.3(NF1):c.2077_2078delAT (p.Met693Valfs) rs1555613795
NM_000267.3(NF1):c.2135_2136dup (p.Leu713Thrfs) rs1555613810
NM_000267.3(NF1):c.2136_2142delCCTCTGT (p.His712Glnfs) rs1555613811
NM_000267.3(NF1):c.2142T>A (p.Cys714Ter)
NM_000267.3(NF1):c.2148_2159delAGCAGATATCCGinsTGAAGTGTCT (p.Glu716Aspfs)
NM_000267.3(NF1):c.2149delG (p.Ala717Glnfs)
NM_000267.3(NF1):c.2163T>A (p.Cys721Ter) rs1555613816
NM_000267.3(NF1):c.2167delG (p.Val723Trpfs)
NM_000267.3(NF1):c.2210_2211delCA (p.Thr737Ilefs) rs1555613831
NM_000267.3(NF1):c.2252-2A>C rs1131691105
NM_000267.3(NF1):c.2252-70_2326-39dup rs1555613896
NM_000267.3(NF1):c.2266C>T (p.Gln756Ter)
NM_000267.3(NF1):c.2294_2300delGCATTGA (p.Glu767Profs) rs786204154
NM_000267.3(NF1):c.2322_2323delTG (p.Glu775Glyfs)
NM_000267.3(NF1):c.2325+1G>A rs1555613933
NM_000267.3(NF1):c.2325+1G>T
NM_000267.3(NF1):c.2325+2T>C
NM_000267.3(NF1):c.2325+3A>G rs1057517848
NM_000267.3(NF1):c.2326-2A>G rs1555613975
NM_000267.3(NF1):c.2331G>A (p.Trp777Ter) rs1555613983
NM_000267.3(NF1):c.2338dup (p.Thr780Asnfs)
NM_000267.3(NF1):c.2339C>G (p.Thr780Arg) rs199474746
NM_000267.3(NF1):c.233delA (p.Asn78Ilefs) rs1438566555
NM_000267.3(NF1):c.2351_2352delGGinsC (p.Trp784Serfs)
NM_000267.3(NF1):c.2352G>A (p.Trp784Ter) rs199474778
NM_000267.3(NF1):c.2356C>T (p.Gln786Ter) rs1555613999
NM_000267.3(NF1):c.2380delT (p.Tyr794Ilefs)
NM_000267.3(NF1):c.2388dup (p.Ala797Serfs) rs1555614011
NM_000267.3(NF1):c.2407C>T (p.Gln803Ter)
NM_000267.3(NF1):c.2409+1G>C rs1555614022
NM_000267.3(NF1):c.2409+1G>T rs1555614022
NM_000267.3(NF1):c.2409+2delT rs878853875
NM_000267.3(NF1):c.2410-110_2850+65delinsAAAA rs1555614169
NM_000267.3(NF1):c.2410-1G>C
NM_000267.3(NF1):c.2411delC (p.Ala804Valfs) rs1555614180
NM_000267.3(NF1):c.2424delT (p.His809Thrfs)
NM_000267.3(NF1):c.2434delA (p.Ile812Leufs)
NM_000267.3(NF1):c.2446C>T (p.Arg816Ter) rs886041347
NM_000267.3(NF1):c.2449dup (p.Met817Asnfs)
NM_000267.3(NF1):c.244_247delTCTC (p.Gln83Terfs) rs771115661
NM_000267.3(NF1):c.2455delC (p.His819Metfs)
NM_000267.3(NF1):c.246_247delTC (p.Gln83Valfs) rs771115661
NM_000267.3(NF1):c.2503C>T (p.Gln835Ter) rs1555614207
NM_000267.3(NF1):c.2510G>A (p.Trp837Ter)
NM_000267.3(NF1):c.2511G>A (p.Trp837Ter) rs1555614211
NM_000267.3(NF1):c.2531T>G (p.Leu844Arg) rs137854566
NM_000267.3(NF1):c.2533T>C (p.Cys845Arg) rs1060500254
NM_000267.3(NF1):c.2540T>G (p.Leu847Arg)
NM_000267.3(NF1):c.2542G>C (p.Gly848Arg) rs1060500368
NM_000267.3(NF1):c.2545G>T (p.Gly849Ter) rs1064794275
NM_000267.3(NF1):c.2545_2546dup (p.Val850Glufs)
NM_000267.3(NF1):c.2560C>T (p.Gln854Ter) rs1555614261
NM_000267.3(NF1):c.2604dupT (p.Pro869Serfs) rs878853877
NM_000267.3(NF1):c.2619_2622dup (p.Gly875Terfs)
NM_000267.3(NF1):c.2619dupT (p.Lys874Terfs) rs1555614284
NM_000267.3(NF1):c.2622_2629del (p.Lys874Asnfs)
NM_000267.3(NF1):c.2665dupA (p.Thr889Asnfs) rs886041348
NM_000267.3(NF1):c.2668_2677delCCTGTCAGCA (p.Pro890Asnfs) rs1555614293
NM_000267.3(NF1):c.2674delA (p.Ser892Alafs) rs1555614296
NM_000267.3(NF1):c.2729dupG (p.Leu911Thrfs) rs1555614313
NM_000267.3(NF1):c.2786T>C (p.Leu929Pro) rs1555614338
NM_000267.3(NF1):c.2798T>C (p.Leu933Pro) rs1555614342
NM_000267.3(NF1):c.2802delT (p.Phe934Leufs) rs1555614343
NM_000267.3(NF1):c.2827A>T (p.Lys943Ter)
NM_000267.3(NF1):c.2842C>T (p.Gln948Ter)
NM_000267.3(NF1):c.2848C>T (p.Gln950Ter) rs1060500357
NM_000267.3(NF1):c.2850+1G>A rs1131691122
NM_000267.3(NF1):c.2850+1G>T rs1131691122
NM_000267.3(NF1):c.2850G>A (p.Gln950=)
NM_000267.3(NF1):c.2851-151_2990+121dup rs1555614386
NM_000267.3(NF1):c.2870delA (p.Asn957Ilefs) rs1555614423
NM_000267.3(NF1):c.288+1G>T
NM_000267.3(NF1):c.288+1delG (p.Gln97Asnfs) rs1057519370
NM_000267.3(NF1):c.288+2T>A rs1555605406
NM_000267.3(NF1):c.288+2T>C
NM_000267.3(NF1):c.288+5G>T rs1555605409
NM_000267.3(NF1):c.2890delA (p.Thr964Profs) rs1555614437
NM_000267.3(NF1):c.2934delC (p.Ser979Alafs) rs1555614448
NM_000267.3(NF1):c.2953C>T (p.Gln985Ter) rs1555614455
NM_000267.3(NF1):c.2970_2972delAAT (p.Met992del) rs267606606
NM_000267.3(NF1):c.298delG (p.Asp100Thrfs)
NM_000267.3(NF1):c.2990+1G>T
NM_000267.3(NF1):c.2991-1G>A rs1060500273
NM_000267.3(NF1):c.2991-1G>C rs1060500273
NM_000267.3(NF1):c.3037delA (p.Thr1013Argfs) rs1135402838
NM_000267.3(NF1):c.3043delC (p.Leu1015Cysfs) rs1555614514
NM_000267.3(NF1):c.3046T>C (p.Cys1016Arg) rs878853880
NM_000267.3(NF1):c.3064delA (p.Met1022Terfs) rs878853881
NM_000267.3(NF1):c.3074_3096dup (p.Gln1033Glyfs) rs1555614527
NM_000267.3(NF1):c.3075delG (p.Arg1026Glufs) rs1555614526
NM_000267.3(NF1):c.3076A>T (p.Arg1026Ter) rs1555614529
NM_000267.3(NF1):c.3089C>G (p.Ser1030Ter)
NM_000267.3(NF1):c.3094dup (p.Cys1032Leufs) rs1555614535
NM_000267.3(NF1):c.3104T>G (p.Met1035Arg) rs137854553
NM_000267.3(NF1):c.3106A>T (p.Lys1036Ter)
NM_000267.3(NF1):c.3111delT (p.Phe1037Leufs) rs1131691127
NM_000267.3(NF1):c.3113+1G>A rs267606599
NM_000267.3(NF1):c.3113+1G>T rs267606599
NM_000267.3(NF1):c.3113+5G>A rs1555614549
NM_000267.3(NF1):c.311T>G (p.Leu104Ter) rs1057521097
NM_000267.3(NF1):c.311_312delTA (p.Leu104Terfs) rs1555606053
NM_000267.3(NF1):c.3138_3139delAG (p.Asp1047Leufs) rs863224490
NM_000267.3(NF1):c.3144G>A (p.Trp1048Ter) rs1555614635
NM_000267.3(NF1):c.3161_3165delACCAA (p.Asn1054Serfs) rs1555614642
NM_000267.3(NF1):c.3197+1G>A rs1555614653
NM_000267.3(NF1):c.3197G>C (p.Arg1066Thr) rs1555614652
NM_000267.3(NF1):c.319delA (p.Thr107Argfs) rs1131691116
NM_000267.3(NF1):c.3214dup (p.Ser1072Lysfs) rs1555614825
NM_000267.3(NF1):c.3250_3251dupCC (p.Gln1086Cysfs) rs1555614845
NM_000267.3(NF1):c.3261dup (p.Glu1088Terfs) rs1555614851
NM_000267.3(NF1):c.3277G>A (p.Val1093Met) rs1555614858
NM_000267.3(NF1):c.328delG (p.Val110Serfs)
NM_000267.3(NF1):c.3301_3302delCA (p.Gln1101Valfs) rs1555614866
NM_000267.3(NF1):c.3315-1G>C
NM_000267.3(NF1):c.334C>T (p.Gln112Ter) rs1555606061
NM_000267.3(NF1):c.3361G>T (p.Glu1121Ter)
NM_000267.3(NF1):c.3367G>T (p.Glu1123Ter) rs1555614940
NM_000267.3(NF1):c.3376C>T (p.Gln1126Ter) rs1555614947
NM_000267.3(NF1):c.3384delT (p.Gly1129Alafs)
NM_000267.3(NF1):c.3431_3432dup (p.Thr1145Valfs) rs1555614966
NM_000267.3(NF1):c.3445A>G (p.Met1149Val) rs1187097568
NM_000267.3(NF1):c.3447G>A (p.Met1149Ile) rs1064794277
NM_000267.3(NF1):c.3447G>C (p.Met1149Ile)
NM_000267.3(NF1):c.3447G>T (p.Met1149Ile) rs1064794277
NM_000267.3(NF1):c.3449C>G (p.Ser1150Ter) rs1555614972
NM_000267.3(NF1):c.3494T>A (p.Ile1165Lys) rs786204211
NM_000267.3(NF1):c.3496+57_4772+2639dup
NM_000267.3(NF1):c.3497delG (p.Gly1166Alafs)
NM_000267.3(NF1):c.3500T>G (p.Leu1167Ter) rs786204253
NM_000267.3(NF1):c.3537delT (p.Phe1179Leufs) rs1555615026
NM_000267.3(NF1):c.3563A>C (p.Gln1188Pro) rs758419553
NM_000267.3(NF1):c.3565C>T (p.Gln1189Ter) rs878853884
NM_000267.3(NF1):c.3567delA (p.Gly1190Alafs) rs1060500271
NM_000267.3(NF1):c.3623T>A (p.Leu1208Ter) rs1060500374
NM_000267.3(NF1):c.3657dup (p.Glu1220Argfs)
NM_000267.3(NF1):c.3677dup (p.Leu1227Serfs)
NM_000267.3(NF1):c.3686delA (p.Asn1229Metfs) rs1555615103
NM_000267.3(NF1):c.3695delC (p.Pro1232Leufs)
NM_000267.3(NF1):c.3703C>T (p.Gln1235Ter) rs1555615109
NM_000267.3(NF1):c.3707G>A (p.Trp1236Ter) rs1252674239
NM_000267.3(NF1):c.3708+598_4772+16224del
NM_000267.3(NF1):c.3709-1G>A rs1555615431
NM_000267.3(NF1):c.3709-266_7259-397delinsCAG
NM_000267.3(NF1):c.3709-941_3974+2711del
NM_000267.3(NF1):c.3712G>T (p.Glu1238Ter) rs1060500346
NM_000267.3(NF1):c.3728T>C (p.Leu1243Pro) rs137854564
NM_000267.3(NF1):c.372_373insTT (p.Arg125Phefs) rs1555606080
NM_000267.3(NF1):c.3737dup (p.Phe1247Valfs) rs1555615445
NM_000267.3(NF1):c.3739_3742delTTTG (p.Phe1247Ilefs) rs1064794276
NM_000267.3(NF1):c.3757_3797delCTCTACCAACTGCTCTGGAACATGTTTTCTAAAGAAGTAGA (p.Leu1253Ilefs) rs1555615447
NM_000267.3(NF1):c.3763C>T (p.Gln1255Ter) rs1060500308
NM_000267.3(NF1):c.3773G>A (p.Trp1258Ter) rs1555615458
NM_000267.3(NF1):c.3778_3782delATGTT (p.Met1260Phefs) rs1555615462
NM_000267.3(NF1):c.3790G>A (p.Glu1264Lys) rs863224660
NM_000267.3(NF1):c.3790G>T (p.Glu1264Ter) rs863224660
NM_000267.3(NF1):c.3822_3823delCT (p.Phe1275Profs) rs1555615472
NM_000267.3(NF1):c.3826C>T (p.Arg1276Ter) rs199474742
NM_000267.3(NF1):c.3827G>C (p.Arg1276Pro) rs137854556
NM_000267.3(NF1):c.3870+1G>T
NM_000267.3(NF1):c.3897delA (p.Lys1299Asnfs) rs878853890
NM_000267.3(NF1):c.3911T>A (p.Leu1304Ter) rs761512189
NM_000267.3(NF1):c.3911delT (p.Leu1304Tyrfs) rs1555615549
NM_000267.3(NF1):c.3916C>T (p.Arg1306Ter) rs376576925
NM_000267.3(NF1):c.3948dup (p.Val1317Cysfs) rs1555615559
NM_000267.3(NF1):c.3974+1G>C
NM_000267.3(NF1):c.3975-1922_4111-2448delinsTTTACTTAGGT
NM_000267.3(NF1):c.3975-2A>G rs864622431
NM_000267.3(NF1):c.397delG (p.Glu133Asnfs) rs878853891
NM_000267.3(NF1):c.3986C>A (p.Ser1329Ter) rs1060500319
NM_000267.3(NF1):c.4000G>T (p.Glu1334Ter)
NM_000267.3(NF1):c.4020delT (p.Gln1341Argfs)
NM_000267.3(NF1):c.4021C>T (p.Gln1341Ter) rs137854559
NM_000267.3(NF1):c.4030G>T (p.Glu1344Ter) rs1555617328
NM_000267.3(NF1):c.4044delT (p.His1348Glnfs)
NM_000267.3(NF1):c.4070delT (p.Phe1357Serfs) rs1555617354
NM_000267.3(NF1):c.4076delC (p.Pro1359Leufs) rs1135402852
NM_000267.3(NF1):c.4078C>T (p.Gln1360Ter) rs1555617368
NM_000267.3(NF1):c.4084C>T (p.Arg1362Ter) rs137854560
NM_000267.3(NF1):c.4095_4096insTG (p.His1366Cysfs) rs267606608
NM_000267.3(NF1):c.4110+1G>A rs1555617383
NM_000267.3(NF1):c.4110+1G>T
NM_000267.3(NF1):c.4166delT (p.Phe1389Serfs) rs1555618511
NM_000267.3(NF1):c.4168C>T (p.Leu1390Phe) rs199474789
NM_000267.3(NF1):c.4173A>T (p.Arg1391Ser) rs137854554
NM_000267.3(NF1):c.4197_4198delAC (p.Pro1400Valfs) rs1555618536
NM_000267.3(NF1):c.4199delC (p.Pro1400Argfs)
NM_000267.3(NF1):c.4200delG (p.Tyr1401Metfs) rs1555618542
NM_000267.3(NF1):c.421delG (p.Val141Phefs) rs1131691119
NM_000267.3(NF1):c.422_437del16 (p.Val141Alafs) rs1555606098
NM_000267.3(NF1):c.4230_4231dupAC (p.Pro1411Hisfs) rs1555618552
NM_000267.3(NF1):c.4243G>T (p.Glu1415Ter) rs876660428
NM_000267.3(NF1):c.4255A>G (p.Lys1419Glu) rs199474790
NM_000267.3(NF1):c.4267A>G (p.Lys1423Glu) rs137854550
NM_000267.3(NF1):c.4269+1G>A rs1555618572
NM_000267.3(NF1):c.4269G>C (p.Lys1423Asn) rs199474750
NM_000267.3(NF1):c.4270-2A>G rs1555618634
NM_000267.3(NF1):c.4270-2delA rs886041630
NM_000267.3(NF1):c.4289A>T (p.Asn1430Ile) rs199474754
NM_000267.3(NF1):c.4306A>G (p.Lys1436Glu) rs878853893
NM_000267.3(NF1):c.4312_4314delGAA (p.Glu1438del) rs267606607
NM_000267.3(NF1):c.4317dupT (p.Met1440Tyrfs) rs886041435
NM_000267.3(NF1):c.4367+2T>G rs1555618693
NM_000267.3(NF1):c.4368-391_4515-122delins105
NM_000267.3(NF1):c.4368-?_5943+?del
NM_000267.3(NF1):c.4373dup (p.Leu1459Profs) rs1555618803
NM_000267.3(NF1):c.4375delC (p.Asp1460Ilefs) rs1555618806
NM_000267.3(NF1):c.4393delT (p.Cys1465Valfs)
NM_000267.3(NF1):c.4419_4420delTA (p.His1473Glnfs) rs1555618821
NM_000267.3(NF1):c.4420dupA (p.Ser1474Lysfs) rs878853896
NM_000267.3(NF1):c.4463delG (p.Arg1488Leufs)
NM_000267.3(NF1):c.4480C>T (p.Gln1494Ter)
NM_000267.3(NF1):c.4483G>T (p.Glu1495Ter) rs786203390
NM_000267.3(NF1):c.4495C>T (p.Gln1499Ter) rs1060500242
NM_000267.3(NF1):c.449delT (p.Phe150Serfs)
NM_000267.3(NF1):c.4511dupA (p.Asn1504Lysfs) rs1555618862
NM_000267.3(NF1):c.4514+1G>A rs1279529138
NM_000267.3(NF1):c.4514+1G>T
NM_000267.3(NF1):c.4515-2A>G rs1555618996
NM_000267.3(NF1):c.4515-343_8314+3380del
NM_000267.3(NF1):c.4534A>T (p.Arg1512Ter) rs1064796633
NM_000267.3(NF1):c.4535delG (p.Arg1512Asnfs) rs1060500292
NM_000267.3(NF1):c.4537C>T (p.Arg1513Ter) rs760703505
NM_000267.3(NF1):c.4572C>G (p.Tyr1524Ter) rs754023358
NM_000267.3(NF1):c.4600delG (p.Ala1534Glnfs)
NM_000267.3(NF1):c.4606dup (p.Thr1536Asnfs) rs1555619033
NM_000267.3(NF1):c.4614G>A (p.Trp1538Ter) rs137854555
NM_000267.3(NF1):c.4621delC (p.Asn1542Thrfs) rs1555619041
NM_000267.3(NF1):c.4640delA (p.Lys1547Serfs) rs1555619052
NM_000267.3(NF1):c.4648G>T (p.Glu1550Ter)
NM_000267.3(NF1):c.4661+1660_4773-8837del
NM_000267.3(NF1):c.4661+1G>A rs1555619056
NM_000267.3(NF1):c.4661+1G>C
NM_000267.3(NF1):c.4662-1076_4772+1300delins260
NM_000267.3(NF1):c.4684_4685dupGA (p.Phe1563Asnfs) rs1555619397
NM_000267.3(NF1):c.4686delA (p.Glu1562Aspfs)
NM_000267.3(NF1):c.4707_4714del (p.Leu1569Phefs) rs1555619402
NM_000267.3(NF1):c.4720delC (p.Gln1574Lysfs) rs1555619404
NM_000267.3(NF1):c.4735A>T (p.Lys1579Ter)
NM_000267.3(NF1):c.4761T>A (p.Tyr1587Ter)
NM_000267.3(NF1):c.4772+1G>A rs1085307819
NM_000267.3(NF1):c.4773-1G>A rs1057518326
NM_000267.3(NF1):c.4773-2116_7127-1817delinsAGTTACC
NM_000267.3(NF1):c.4773-23713_7907+14del
NM_000267.3(NF1):c.4773-2A>C rs1555533265
NM_000267.3(NF1):c.479+1G>A rs1555606137
NM_000267.3(NF1):c.479+1G>T
NM_000267.3(NF1):c.479+5G>A
NM_000267.3(NF1):c.480-134_8315-6206del
NM_000267.3(NF1):c.480-2989_586+3445del
NM_000267.3(NF1):c.480-2A>G
NM_000267.3(NF1):c.4812C>G (p.Tyr1604Ter) rs1555533285
NM_000267.3(NF1):c.4829T>G (p.Leu1610Ter) rs1555533292
NM_000267.3(NF1):c.4829delT (p.Leu1610Terfs) rs1555533290
NM_000267.3(NF1):c.4842T>G (p.Tyr1614Ter) rs948982039
NM_000267.3(NF1):c.484C>T (p.Gln162Ter) rs1555607073
NM_000267.3(NF1):c.4854T>A (p.Tyr1618Ter) rs1555533297
NM_000267.3(NF1):c.4903delA (p.Thr1635Glnfs)
NM_000267.3(NF1):c.4904_4905delCA (p.Thr1635Argfs) rs1555533323
NM_000267.3(NF1):c.4914_4917delCTCT (p.Lys1640Glyfs) rs1085307459
NM_000267.3(NF1):c.4920_4922delGTGinsCTTA (p.Lys1640Asnfs) rs1555533326
NM_000267.3(NF1):c.4922G>A (p.Trp1641Ter)
NM_000267.3(NF1):c.4926delT (p.Phe1642Leufs)
NM_000267.3(NF1):c.4935delT (p.Pro1646Leufs) rs1135402867
NM_000267.3(NF1):c.4941_7127-2901del
NM_000267.3(NF1):c.4950C>A (p.Tyr1650Ter) rs1060500255
NM_000267.3(NF1):c.4950_4954dup (p.Asn1652Thrfs) rs1555533336
NM_000267.3(NF1):c.496_497delGT (p.Val166Leufs) rs1135402788
NM_000267.3(NF1):c.4973_4978delTCTATA (p.Ile1658_Tyr1659del) rs1135402868
NM_000267.3(NF1):c.4992G>A (p.Trp1664Ter) rs1555533354
NM_000267.3(NF1):c.5020_5021dupCG (p.Leu1675Glyfs) rs1555533366
NM_000267.3(NF1):c.503C>G (p.Ser168Ter) rs1131691994
NM_000267.3(NF1):c.5054_5055insA (p.Val1686Cysfs)
NM_000267.3(NF1):c.5115delA (p.Pro1706Leufs) rs1555533393
NM_000267.3(NF1):c.5129T>A (p.Leu1710Ter)
NM_000267.3(NF1):c.5205+5G>A rs864622551
NM_000267.3(NF1):c.5206-2A>G rs1555533548
NM_000267.3(NF1):c.5206-2A>T
NM_000267.3(NF1):c.5206-41_5228del rs1555533543
NM_000267.3(NF1):c.5206delG (p.Val1736Leufs) rs1555533549
NM_000267.3(NF1):c.5232_5233delTT (p.Ala1746Argfs) rs1555533552
NM_000267.3(NF1):c.5234C>G (p.Ser1745Ter) rs1555533555
NM_000267.3(NF1):c.5242C>T (p.Arg1748Ter) rs876657714
NM_000267.3(NF1):c.5257_5261dup (p.Ser1755Glyfs) rs1555533562
NM_000267.3(NF1):c.5264delC (p.Ser1755Terfs) rs1131691128
NM_000267.3(NF1):c.5270_5271delTT (p.Phe1757Serfs) rs1555533566
NM_000267.3(NF1):c.5284delT (p.Tyr1762Ilefs)
NM_000267.3(NF1):c.529dup (p.Ile177Asnfs) rs1555607093
NM_000267.3(NF1):c.5368_5386delACCTTCATGCACCAGGAGT (p.Thr1790Valfs)
NM_000267.3(NF1):c.5398delG (p.Val1800Serfs)
NM_000267.3(NF1):c.5425C>A (p.Arg1809Ser) rs797045139
NM_000267.3(NF1):c.5425C>G (p.Arg1809Gly) rs797045139
NM_000267.3(NF1):c.5425C>T (p.Arg1809Cys) rs797045139
NM_000267.3(NF1):c.5426G>C (p.Arg1809Pro) rs771529172
NM_000267.3(NF1):c.5426G>T (p.Arg1809Leu) rs771529172
NM_000267.3(NF1):c.5446G>A (p.Asp1816Asn) rs771597781
NM_000267.3(NF1):c.5448dupC (p.Ser1817Leufs) rs267606596
NM_000267.3(NF1):c.5451_5454delTATC (p.Ile1818Profs) rs1555533621
NM_000267.3(NF1):c.5458C>T (p.Gln1820Ter) rs786203570
NM_000267.3(NF1):c.5465_5466insT (p.Lys1823Glnfs) rs267606597
NM_000267.3(NF1):c.5466dupC (p.Lys1823Glnfs) rs1555533628
NM_000267.3(NF1):c.5472delT (p.Arg1825Glyfs)
NM_000267.3(NF1):c.5478_5484delAAAAGAT (p.Lys1827Serfs) rs1064796631
NM_000267.3(NF1):c.5485_5486delGT (p.Val1829Profs) rs1555533636
NM_000267.3(NF1):c.5498T>G (p.Leu1833Arg) rs878853903
NM_000267.3(NF1):c.5498delT (p.Leu1833Argfs) rs1555533644
NM_000267.3(NF1):c.5508_5509delCGinsT (p.Ala1837Hisfs) rs1135402875
NM_000267.3(NF1):c.551delA (p.Asn184Metfs) rs1555607102
NM_000267.3(NF1):c.5523delA (p.Gly1842Alafs) rs1555533648
NM_000267.3(NF1):c.5531_5532delCT (p.Ser1844Terfs) rs1555533650
NM_000267.3(NF1):c.5546+1G>A rs1131691117
NM_000267.3(NF1):c.5546+336_5943+244del
NM_000267.3(NF1):c.5556dup (p.Tyr1853Leufs) rs1555533842
NM_000267.3(NF1):c.5594T>A (p.Leu1865Ter) rs1555533853
NM_000267.3(NF1):c.5608C>T (p.Gln1870Ter) rs878853904
NM_000267.3(NF1):c.5613dup (p.Leu1872Thrfs) rs1475358670
NM_000267.3(NF1):c.5636delT (p.Ile1879Thrfs) rs1060500353
NM_000267.3(NF1):c.5660_5679del (p.Ile1887Thrfs)
NM_000267.3(NF1):c.5668_5671dupATTA (p.Ser1891Asnfs) rs1555533871
NM_000267.3(NF1):c.569T>G (p.Leu190Ter) rs1555607112
NM_000267.3(NF1):c.569delT (p.Leu190Terfs) rs1555607110
NM_000267.3(NF1):c.5702_5703delTC (p.Leu1901Hisfs) rs1555533880
NM_000267.3(NF1):c.5710G>T (p.Glu1904Ter) rs137854565
NM_000267.3(NF1):c.5717delT (p.Leu1906Trpfs) rs1135402880
NM_000267.3(NF1):c.5723delA (p.Glu1908Glyfs) rs1555533883
NM_000267.3(NF1):c.5749+189_6999+1035del
NM_000267.3(NF1):c.5749+332A>G rs863224491
NM_000267.3(NF1):c.5749+6_6858+633delins130
NM_000267.3(NF1):c.5749+750_5943+244del
NM_000267.3(NF1):c.574C>T (p.Arg192Ter) rs397514641
NM_000267.3(NF1):c.5750-1086_5943+244del
NM_000267.3(NF1):c.5750-1748_6184delinsCTA
NM_000267.3(NF1):c.5750-374_5944-176del
NM_000267.3(NF1):c.5750-460_5943+244del rs1555534307
NM_000267.3(NF1):c.5759T>A (p.Leu1920Ter) rs1555534375
NM_000267.3(NF1):c.5770delT (p.Cys1924Valfs) rs1555534379
NM_000267.3(NF1):c.5779T>G (p.Tyr1927Asp) rs1057520575
NM_000267.3(NF1):c.5792G>A (p.Trp1931Ter)
NM_000267.3(NF1):c.5793G>A (p.Trp1931Ter) rs1555534393
NM_000267.3(NF1):c.5817C>A (p.Cys1939Ter) rs1462287670
NM_000267.3(NF1):c.5839C>T (p.Arg1947Ter) rs137854552
NM_000267.3(NF1):c.5844_5845delAA (p.Arg1949Serfs) rs863224835
NM_000267.3(NF1):c.5845A>T (p.Arg1949Ter) rs267606595
NM_000267.3(NF1):c.5845_5846insTA (p.Arg1949Ilefs) rs1060500354
NM_000267.3(NF1):c.586+1209_1845+35del
NM_000267.3(NF1):c.586+1G>A rs1555607126
NM_000267.3(NF1):c.5862delT (p.Asp1955Thrfs) rs1060500349
NM_000267.3(NF1):c.587-282_8315-3687del
NM_000267.3(NF1):c.587-2A>T rs1057518360
NM_000267.3(NF1):c.5880delG (p.Met1960Ilefs)
NM_000267.3(NF1):c.5896C>T (p.Gln1966Ter)
NM_000267.3(NF1):c.58C>T (p.Gln20Ter)
NM_000267.3(NF1):c.5904C>G (p.Tyr1968Ter)
NM_000267.3(NF1):c.592delG (p.Ala198Hisfs)
NM_000267.3(NF1):c.5941C>T (p.Gln1981Ter)
NM_000267.3(NF1):c.5943+1G>A rs1555534433
NM_000267.3(NF1):c.5943+265_7000-999delins15
NM_000267.3(NF1):c.5943+448_7127-414del
NM_000267.3(NF1):c.5943_5943+1delGGinsAA rs1064796077
NM_000267.3(NF1):c.5944-1G>C rs1555534596
NM_000267.3(NF1):c.5944-5A>G rs267606604
NM_000267.3(NF1):c.594delA (p.Phe199Leufs) rs1555608647
NM_000267.3(NF1):c.5999delG (p.Gly2000Valfs) rs1057518475
NM_000267.3(NF1):c.60+24136_587-5022del
NM_000267.3(NF1):c.60+3120_3975-326del
NM_000267.3(NF1):c.6027dup (p.Met2010Aspfs) rs1555534611
NM_000267.3(NF1):c.6073dup (p.Val2025Glyfs) rs1555534618
NM_000267.3(NF1):c.607delG (p.Ala203Profs)
NM_000267.3(NF1):c.6084+1G>A rs1060500296
NM_000267.3(NF1):c.61-2A>G rs1131691100
NM_000267.3(NF1):c.6103A>T (p.Lys2035Ter)
NM_000267.3(NF1):c.6111delT (p.Ile2037Metfs)
NM_000267.3(NF1):c.6157dup (p.Met2053Asnfs) rs1555534673
NM_000267.3(NF1):c.6162G>A (p.Trp2054Ter) rs1555534677
NM_000267.3(NF1):c.6200T>C (p.Leu2067Pro) rs137854561
NM_000267.3(NF1):c.6212delA (p.Asn2071Ilefs) rs1555534697
NM_000267.3(NF1):c.6244delC (p.Leu2082Serfs) rs1131691125
NM_000267.3(NF1):c.6253_6296dup (p.Ser2100Leufs)
NM_000267.3(NF1):c.6271delG (p.Ala2091Profs) rs1555534735
NM_000267.3(NF1):c.6302_6303insGG (p.His2102Aspfs) rs1555534751
NM_000267.3(NF1):c.6310_6313delCTGG (p.Leu2104Serfs) rs1555534755
NM_000267.3(NF1):c.6334_6335delCT (p.Leu2112Valfs)
NM_000267.3(NF1):c.6339T>A (p.Cys2113Ter) rs1555534766
NM_000267.3(NF1):c.6364+2T>G
NM_000267.3(NF1):c.6365-2A>G rs1060500312
NM_000267.3(NF1):c.6367G>T (p.Glu2123Ter)
NM_000267.3(NF1):c.6424_6425delTT (p.Leu2142Alafs) rs1060500338
NM_000267.3(NF1):c.6427C>A (p.Leu2143Met) rs137854551
NM_000267.3(NF1):c.649G>T (p.Glu217Ter) rs878853909
NM_000267.3(NF1):c.6511T>A (p.Tyr2171Asn) rs267606598
NM_000267.3(NF1):c.6522_6523delGA (p.Glu2174Aspfs) rs1131691084
NM_000267.3(NF1):c.653dup (p.Ala219Glyfs) rs1131691094
NM_000267.3(NF1):c.654+1G>A rs1060500245
NM_000267.3(NF1):c.655-2A>C rs1555608734
NM_000267.3(NF1):c.6579+1G>A rs1060500345
NM_000267.3(NF1):c.6579+1G>T rs1060500345
NM_000267.3(NF1):c.6604delT (p.Cys2202Alafs) rs1555534917
NM_000267.3(NF1):c.6611G>A (p.Trp2204Ter) rs1193716348
NM_000267.3(NF1):c.662G>A (p.Trp221Ter) rs1131691126
NM_000267.3(NF1):c.6636delT (p.Gln2213Lysfs) rs1060500268
NM_000267.3(NF1):c.6637C>T (p.Gln2213Ter)
NM_000267.3(NF1):c.663G>A (p.Trp221Ter) rs1555608737
NM_000267.3(NF1):c.663delG (p.Trp221Terfs) rs1555608736
NM_000267.3(NF1):c.6641+1G>A rs1060500376
NM_000267.3(NF1):c.6641+2T>G rs1555534928
NM_000267.3(NF1):c.6641+2delT rs1555534929
NM_000267.3(NF1):c.6650_6652delTCC (p.Phe2217_Ala2552delinsTer) rs1555534948
NM_000267.3(NF1):c.6659dup (p.Asn2220Lysfs)
NM_000267.3(NF1):c.6663_6664insGGAAA (p.Ser2222Glyfs) rs1555534950
NM_000267.3(NF1):c.667T>C (p.Trp223Arg) rs1555608740
NM_000267.3(NF1):c.6688_6691delGTCT (p.Val2230Leufs)
NM_000267.3(NF1):c.668G>A (p.Trp223Ter)
NM_000267.3(NF1):c.669G>A (p.Trp223Ter) rs1057517967
NM_000267.3(NF1):c.6733C>T (p.Gln2245Ter) rs1555534955
NM_000267.3(NF1):c.6756+2T>A
NM_000267.3(NF1):c.6789_6792delTTAC (p.Tyr2264Thrfs) rs1555535032
NM_000267.3(NF1):c.6791dupA (p.Tyr2264Terfs) rs876657715
NM_000267.3(NF1):c.6792C>G (p.Tyr2264Ter) rs772295894
NM_000267.3(NF1):c.6792delC (p.Tyr2264Terfs) rs1555535042
NM_000267.3(NF1):c.6795_6796delCA (p.Asn2265Lysfs) rs1555535044
NM_000267.3(NF1):c.6798_6801dup (p.Val2268Serfs)
NM_000267.3(NF1):c.6801A>G (p.Gln2267=) rs1064794756
NM_000267.3(NF1):c.681T>A (p.Tyr227Ter)
NM_000267.3(NF1):c.6849_6853delTCTTA (p.Leu2284Terfs) rs878853025
NM_000267.3(NF1):c.6852_6853dup (p.Asn2285Ilefs) rs1555535052
NM_000267.3(NF1):c.6858+1G>A rs1060500355
NM_000267.3(NF1):c.6858+1G>T rs1060500355
NM_000267.3(NF1):c.6859-1G>C rs1131691115
NM_000267.3(NF1):c.6889dup (p.Val2297Glyfs) rs1057519369
NM_000267.3(NF1):c.6930_6945del16 (p.Ser2311Phefs) rs1555535177
NM_000267.3(NF1):c.6952G>T (p.Glu2318Ter) rs1060500359
NM_000267.3(NF1):c.6971T>G (p.Leu2324Ter) rs1555535195
NM_000267.3(NF1):c.6971_6978delTAGATAGT (p.Leu2324Serfs) rs1555535192
NM_000267.3(NF1):c.6999+1G>A rs863224492
NM_000267.3(NF1):c.6999+1_6999+5delGTAAG
NM_000267.3(NF1):c.7000-1G>T rs1131691114
NM_000267.3(NF1):c.7013_7039del (p.Val2338_Leu2346del) rs1555535403
NM_000267.3(NF1):c.7044G>A (p.Trp2348Ter) rs1060500286
NM_000267.3(NF1):c.7054C>T (p.Gln2352Ter) rs1555535417
NM_000267.3(NF1):c.7089dup (p.Asn2364Terfs) rs1555535434
NM_000267.3(NF1):c.7096_7101delAACTTT (p.Asn2366_Phe2367del) rs864622639
NM_000267.3(NF1):c.7125delA (p.Tyr2377Thrfs)
NM_000267.3(NF1):c.7126+3A>C rs267606610
NM_000267.3(NF1):c.7127-2A>G rs772348111
NM_000267.3(NF1):c.7175T>A (p.Leu2392Ter) rs775181940
NM_000267.3(NF1):c.7193_7194delTG (p.Leu2398Argfs) rs1555536027
NM_000267.3(NF1):c.7202_7205delAACA (p.Lys2401Thrfs)
NM_000267.3(NF1):c.7206_7207delCA (p.His2402Glnfs) rs878853913
NM_000267.3(NF1):c.7211delA (p.Asn2404Ilefs) rs1555536030
NM_000267.3(NF1):c.7215T>A (p.Cys2405Ter)
NM_000267.3(NF1):c.7225G>T (p.Glu2409Ter) rs1555536035
NM_000267.3(NF1):c.724dup (p.Met242Asnfs) rs1555608763
NM_000267.3(NF1):c.7251C>G (p.Tyr2417Ter) rs1060500385
NM_000267.3(NF1):c.7257delA (p.Ala2420Leufs) rs1060500300
NM_000267.3(NF1):c.7259delC (p.Ala2420Valfs) rs1131691113
NM_000267.3(NF1):c.7267_7268insAA (p.Thr2423Lysfs) rs1064794278
NM_000267.3(NF1):c.7267dupA (p.Thr2423Asnfs) rs1064794278
NM_000267.3(NF1):c.730+1G>A rs1060500274
NM_000267.3(NF1):c.730+1G>C rs1060500274
NM_000267.3(NF1):c.731-1G>A rs1555608928
NM_000267.3(NF1):c.731-1_731delGA rs1555608925
NM_000267.3(NF1):c.731-2A>T rs1555608924
NM_000267.3(NF1):c.731-302_8314+3681del
NM_000267.3(NF1):c.7310delG (p.Arg2437Lysfs) rs1060500335
NM_000267.3(NF1):c.7359dup (p.Thr2454Tyrfs) rs1131691107
NM_000267.3(NF1):c.7365T>A (p.Tyr2455Ter) rs181397225
NM_000267.3(NF1):c.7385_7394del (p.Pro2462Argfs)
NM_000267.3(NF1):c.7411C>T (p.Gln2471Ter) rs1555536340
NM_000267.3(NF1):c.7419G>A (p.Trp2473Ter) rs863224493
NM_000267.3(NF1):c.7433delG (p.Gly2478Valfs) rs1555536352
NM_000267.3(NF1):c.7442delG (p.Gly2481Aspfs) rs1555536358
NM_000267.3(NF1):c.7446C>A (p.Tyr2482Ter) rs1555536359
NM_000267.3(NF1):c.750delT (p.Phe250Leufs)
NM_000267.3(NF1):c.7518delG (p.Gln2507Asnfs) rs878853917
NM_000267.3(NF1):c.7528C>T (p.Gln2510Ter) rs1555536372
NM_000267.3(NF1):c.7543_7552+1del11 rs1131691120
NM_000267.3(NF1):c.7544delA (p.Lys2515Serfs) rs1060500327
NM_000267.3(NF1):c.7552+1G>T rs1555536380
NM_000267.3(NF1):c.7599_7601delTAAinsAG (p.Lys2534Glufs)
NM_000267.3(NF1):c.7638delC (p.Met2548Terfs) rs1060500295
NM_000267.3(NF1):c.7699C>T (p.Gln2567Ter) rs1555536687
NM_000267.3(NF1):c.7702C>T (p.Gln2568Ter) rs1555536689
NM_000267.3(NF1):c.7709delC (p.Pro2570Hisfs) rs1064795136
NM_000267.3(NF1):c.7715del (p.Leu2572Tyrfs)
NM_000267.3(NF1):c.7727C>A (p.Ser2576Ter)
NM_000267.3(NF1):c.7734dupT (p.Glu2579Terfs) rs863224837
NM_000267.3(NF1):c.7748delT (p.Leu2583Profs) rs1555536701
NM_000267.3(NF1):c.7843C>T (p.Gln2615Ter) rs567988442
NM_000267.3(NF1):c.7857T>G (p.Tyr2619Ter) rs1060500333
NM_000267.3(NF1):c.7858delG (p.Glu2620Asnfs)
NM_000267.3(NF1):c.7863C>G (p.Tyr2621Ter)
NM_000267.3(NF1):c.7868dupC (p.Glu2624Argfs) rs878853918
NM_000267.3(NF1):c.7884_8315-5528del
NM_000267.3(NF1):c.7901_7902ins11 (p.?)
NM_000267.3(NF1):c.7907+149_8097+723dup
NM_000267.3(NF1):c.7907+1G>A rs1555536773
NM_000267.3(NF1):c.7919T>A (p.Leu2640Ter)
NM_000267.3(NF1):c.7926dup (p.Lys2643Terfs) rs1555536882
NM_000267.3(NF1):c.7954C>T (p.Gln2652Ter)
NM_000267.3(NF1):c.7970delT (p.Leu2657Terfs)
NM_000267.3(NF1):c.7996_7997delAG (p.Ser2666Cysfs) rs1060500387
NM_000267.3(NF1):c.79C>T (p.Gln27Ter) rs1060500363
NM_000267.3(NF1):c.8003delT (p.Val2668Glyfs) rs1555536923
NM_000267.3(NF1):c.801G>A (p.Trp267Ter) rs1064794273
NM_000267.3(NF1):c.8021delC (p.Pro2674Hisfs) rs1555536928
NM_000267.3(NF1):c.8042dupA (p.Tyr2681Terfs) rs267606601
NM_000267.3(NF1):c.8049_8050delAA (p.Ser2684Phefs) rs1555536947
NM_000267.3(NF1):c.844C>T (p.Gln282Ter)
NM_000267.3(NF1):c.84delG (p.Asn29Thrfs) rs1555604877
NM_000267.3(NF1):c.882_885delGAAT (p.Met294Ilefs)
NM_000267.3(NF1):c.888+1G>A rs1135402799
NM_000267.3(NF1):c.888+3798_5750-2053del
NM_000267.3(NF1):c.888+5515_1261-1635del
NM_000267.3(NF1):c.888+8334_1721+34delinsTC
NM_000267.3(NF1):c.889-1633_7395-667del
NM_000267.3(NF1):c.889-1G>C rs587781517
NM_000267.3(NF1):c.889-2A>G rs878853922
NM_000267.3(NF1):c.889-2delA
NM_000267.3(NF1):c.889-453_908del rs1555610774
NM_000267.3(NF1):c.889-8107_1261-278del
NM_000267.3(NF1):c.889-8381_6757-5del
NM_000267.3(NF1):c.889-894_1261-284del
NM_000267.3(NF1):c.908delT (p.Leu303Hisfs) rs1555610848
NM_000267.3(NF1):c.909_910delACinsTT (p.Arg304Ter) rs1555610854
NM_000267.3(NF1):c.91_92delCA (p.His31Tyrfs)
NM_000267.3(NF1):c.920_921delTTinsA (p.Leu307Glnfs) rs1555610860
NM_000267.3(NF1):c.924_927delTGGC (p.Gly309Metfs) rs1060500301
NM_000267.3(NF1):c.943C>T (p.Gln315Ter) rs766011053
NM_000267.3(NF1):c.945_946delGCinsAA (p.Leu316Met) rs267606609
NM_000267.3(NF1):c.950_953dup (p.Glu318Aspfs) rs1555610879
NM_000267.3(NF1):c.952delG (p.Glu318Lysfs) rs1555610881
NM_000267.3(NF1):c.955delA (p.Ser319Valfs) rs876660931
NM_000267.3(NF1):c.980T>C (p.Leu327Pro) rs201624827
NM_000267.3(NF1):c.983_984delGT (p.Cys328Terfs) rs1555610893
NM_000267.3(NF1):c.988_995del (p.Ala330Leufs)
NM_000267.3(NF1):c.989C>T (p.Ala330Val) rs1555610898
NM_000267.3(NF1):c.996_999delTTAC (p.Tyr333Serfs) rs1555610900
NM_000267.3(NF1):c.997delT (p.Tyr333Thrfs)
NM_000267.3(NF1):c.99delA (p.Val34Serfs) rs1060500320
NM_000267.3:c.1672delA
NM_000267.3:c.2385delA
NM_000267.3:c.5875delA
NM_000267.3:c.7901delC
NM_001042492.2(NF1):c.1041_1045del (p.Gln347Hisfs) rs1135402800
NM_001042492.2(NF1):c.1152del (p.Arg385Valfs) rs1135402803
NM_001042492.2(NF1):c.1218delT (p.His407Thrfs) rs1131691106
NM_001042492.2(NF1):c.1243dup (p.His415Profs) rs1085307728
NM_001042492.2(NF1):c.1255delA (p.Thr419Profs) rs1555611105
NM_001042492.2(NF1):c.125_126dup (p.Leu43Valfs) rs1555604897
NM_001042492.2(NF1):c.1260+1604A>G rs1131691067
NM_001042492.2(NF1):c.1278G>A (p.Trp426Ter) rs1131691085
NM_001042492.2(NF1):c.1280_1292del (p.Pro427Leufs) rs1135402804
NM_001042492.2(NF1):c.1299T>A (p.Tyr433Ter) rs876660099
NM_001042492.2(NF1):c.1318C>T (p.Arg440Ter) rs778405030
NM_001042492.2(NF1):c.1324_1325del (p.Met442Valfs) rs1135402805
NM_001042492.2(NF1):c.1374dup (p.Ala459Serfs) rs1135402806
NM_001042492.2(NF1):c.1392+1G>A rs267604791
NM_001042492.2(NF1):c.1393-2A>G rs1555612266
NM_001042492.2(NF1):c.1400_1415del (p.Thr467Lysfs) rs1555612270
NM_001042492.2(NF1):c.1400del (p.Thr467Asnfs) rs1135402808
NM_001042492.2(NF1):c.1423dup (p.Leu475Profs) rs1555612274
NM_001042492.2(NF1):c.1462del (p.Ser488Alafs) rs1135402810
NM_001042492.2(NF1):c.1469_1472del (p.Lys490Ilefs) rs1135402811
NM_001042492.2(NF1):c.1525dup (p.Cys509Leufs) rs1135402813
NM_001042492.2(NF1):c.1541_1542delAG (p.Gln514Argfs) rs267606600
NM_001042492.2(NF1):c.154delT (p.Ser52Leufs) rs1131691109
NM_001042492.2(NF1):c.1550_1563del14 (p.Glu517Aspfs) rs1131691068
NM_001042492.2(NF1):c.1561del (p.Ser521Valfs) rs1135402814
NM_001042492.2(NF1):c.1570G>T (p.Glu524Ter) rs1135402815
NM_001042492.2(NF1):c.1584delG (p.Leu529Serfs) rs876658693
NM_001042492.2(NF1):c.1613del (p.Met538Serfs) rs1135402817
NM_001042492.2(NF1):c.1667_1670del (p.Asp556Alafs) rs1135402819
NM_001042492.2(NF1):c.1683G>A (p.Trp561Ter) rs1135402820
NM_001042492.2(NF1):c.1714delG (p.Glu572Argfs) rs876660135
NM_001042492.2(NF1):c.1721+1G>T rs1131691096
NM_001042492.2(NF1):c.1722-2A>G rs763983337
NM_001042492.2(NF1):c.1748A>G (p.Lys583Arg) rs199474760
NM_001042492.2(NF1):c.1756_1759delACTA (p.Thr586Valfs) rs786202782
NM_001042492.2(NF1):c.181dup (p.Ile61Asnfs) rs1555604935
NM_001042492.2(NF1):c.1845G>T (p.Lys615Asn) rs1131691080
NM_001042492.2(NF1):c.1866T>A (p.Cys622Ter) rs753245823
NM_001042492.2(NF1):c.1885G>A (p.Gly629Arg) rs199474738
NM_001042492.2(NF1):c.1918dup (p.Thr640Asnfs) rs1135402825
NM_001042492.2(NF1):c.1919C>T (p.Thr640Ile)
NM_001042492.2(NF1):c.1949T>A (p.Leu650Ter) rs1135402826
NM_001042492.2(NF1):c.1961delC (p.Pro654Leufs) rs1131691108
NM_001042492.2(NF1):c.2033delC (p.Pro678Argfs) rs587781807
NM_001042492.2(NF1):c.2033dupC (p.Ile679Aspfs) rs587781807
NM_001042492.2(NF1):c.2088G>A (p.Trp696Ter) rs1131691099
NM_001042492.2(NF1):c.2178delG (p.Ser727Glnfs) rs786202954
NM_001042492.2(NF1):c.2218G>T (p.Glu740Ter) rs1135402827
NM_001042492.2(NF1):c.2237delA (p.Asn746Ilefs) rs1555613838
NM_001042492.2(NF1):c.2251+1G>A rs1555613843
NM_001042492.2(NF1):c.2252-2A>G rs1131691105
NM_001042492.2(NF1):c.2288T>C (p.Leu763Pro) rs199474762
NM_001042492.2(NF1):c.2338_2343del (p.Thr780_His781del) rs1135402828
NM_001042492.2(NF1):c.2339C>A (p.Thr780Lys) rs199474746
NM_001042492.2(NF1):c.2349del (p.Lys783Asnfs) rs1135402829
NM_001042492.2(NF1):c.2409+2T>G rs876660826
NM_001042492.2(NF1):c.2410-1G>A rs1057518792
NM_001042492.2(NF1):c.245C>T (p.Ser82Phe) rs199474729
NM_001042492.2(NF1):c.2483delT (p.Leu828Cysfs) rs1131691069
NM_001042492.2(NF1):c.2530C>T (p.Leu844Phe) rs199474785
NM_001042492.2(NF1):c.2540T>C (p.Leu847Pro) rs199474747
NM_001042492.2(NF1):c.2543G>A (p.Gly848Glu) rs199474748
NM_001042492.2(NF1):c.2589T>G (p.Tyr863Ter) rs587782814
NM_001042492.2(NF1):c.2589_2592delTAGC (p.Ser864Hisfs) rs876658207
NM_001042492.2(NF1):c.2622_2623insA (p.Gly875Argfs) rs587781933
NM_001042492.2(NF1):c.2709G>A (p.Val903=) rs771820789
NM_001042492.2(NF1):c.2710dup (p.Cys904Leufs) rs1555614310
NM_001042492.2(NF1):c.2753delA (p.Lys918Argfs) rs1131691078
NM_001042492.2(NF1):c.278G>A (p.Cys93Tyr) rs199474728
NM_001042492.2(NF1):c.2790T>G (p.Tyr930Ter) rs1135402832
NM_001042492.2(NF1):c.282delT (p.Ala95Leufs) rs1555605404
NM_001042492.2(NF1):c.2848del (p.Gln950Argfs) rs1135402833
NM_001042492.2(NF1):c.2866dup (p.Thr956Asnfs) rs1555614418
NM_001042492.2(NF1):c.2887C>T (p.Gln963Ter) rs876660444
NM_001042492.2(NF1):c.2952delG (p.Gln985Lysfs) rs1555614453
NM_001042492.2(NF1):c.2969_2970dup (p.Met991Glnfs) rs1555614458
NM_001042492.2(NF1):c.2990+1G>A rs1135402836
NM_001042492.2(NF1):c.3027del (p.Gln1010Lysfs) rs1135402837
NM_001042492.2(NF1):c.3040A>T (p.Lys1014Ter) rs1135402839
NM_001042492.2(NF1):c.3048T>A (p.Cys1016Ter) rs1135402840
NM_001042492.2(NF1):c.3060delA (p.Val1021Terfs) rs1555614521
NM_001042492.2(NF1):c.3097C>T (p.Gln1033Ter) rs1131691104
NM_001042492.2(NF1):c.3111dup (p.Arg1038Terfs) rs1131691127
NM_001042492.2(NF1):c.3113+2T>G rs876658997
NM_001042492.2(NF1):c.3189T>A (p.Cys1063Ter) rs1135402841
NM_001042492.2(NF1):c.3198-2A>G rs1131691089
NM_001042492.2(NF1):c.3208C>T (p.Gln1070Ter) rs786202023
NM_001042492.2(NF1):c.3250C>A (p.Pro1084Thr) rs1555614848
NM_001042492.2(NF1):c.332_335del (p.Lys111Serfs) rs1135402787
NM_001042492.2(NF1):c.3429_3432dup (p.Thr1145Leufs) rs1135402842
NM_001042492.2(NF1):c.3457_3460delCTCA (p.Leu1153Metfs) rs1321848637
NM_001042492.2(NF1):c.3484dup (p.Met1162Asnfs) rs1555614977
NM_001042492.2(NF1):c.3514delG (p.Asp1172Ilefs) rs876660580
NM_001042492.2(NF1):c.3525_3526delAA (p.Arg1176Serfs) rs1131691092
NM_001042492.2(NF1):c.3591dup (p.Glu1198Argfs) rs1135402844
NM_001042492.2(NF1):c.3610C>G (p.Arg1204Gly) rs199474732
NM_001042492.2(NF1):c.3610C>T (p.Arg1204Trp) rs199474732
NM_001042492.2(NF1):c.3665delC (p.Pro1222Leufs) rs867391752
NM_001042492.2(NF1):c.3692_3708del (p.Val1231Glyfs) rs1135402848
NM_001042492.2(NF1):c.3721C>T (p.Arg1241Ter) rs137854562
NM_001042492.2(NF1):c.3732dup (p.Thr1245Tyrfs) rs1135402849
NM_001042492.2(NF1):c.3784del (p.Ser1262Leufs)
NM_001042492.2(NF1):c.3821dupT (p.Phe1275Leufs) rs786203614
NM_001042492.2(NF1):c.3827G>A (p.Arg1276Gln) rs137854556
NM_001042492.2(NF1):c.3870+1G>A rs1131691075
NM_001042492.2(NF1):c.3871-2A>G rs1131691077
NM_001042492.2(NF1):c.3902_3903insTTATTACGAATTG (p.Asp1302Tyrfs) rs786203500
NM_001042492.2(NF1):c.3941G>A (p.Trp1314Ter) rs876658235
NM_001042492.2(NF1):c.4000del (p.Glu1334Lysfs) rs1135402851
NM_001042492.2(NF1):c.4064C>G (p.Ser1355Ter) rs1131691087
NM_001042492.2(NF1):c.4195C>T (p.Gln1399Ter) rs1131691072
NM_001042492.2(NF1):c.4254del (p.Ile1418Metfs) rs1135402855
NM_001042492.2(NF1):c.4266dupT (p.Glu1423Terfs) rs876659964
NM_001042492.2(NF1):c.4324del (p.Met1442Cysfs) rs1135402856
NM_001042492.2(NF1):c.4332+1delG
NM_001042492.2(NF1):c.4339C>T (p.Gln1447Ter) rs1135402857
NM_001042492.2(NF1):c.4340A>C (p.Gln1447Pro) rs786204157
NM_001042492.2(NF1):c.4352A>C (p.Asn1451Thr) rs199474754
NM_001042492.2(NF1):c.4381_4382dup (p.Met1461Ilefs) rs1135402859
NM_001042492.2(NF1):c.4460del (p.Pro1487Leufs) rs1135402861
NM_001042492.2(NF1):c.4465A>G (p.Ser1489Gly) rs199474743
NM_001042492.2(NF1):c.4520T>G (p.Leu1507Ter) rs1135402863
NM_001042492.2(NF1):c.4586A>G (p.Lys1529Arg) rs1555619001
NM_001042492.2(NF1):c.4617_4630dup (p.Ala1544Glyfs)
NM_001042492.2(NF1):c.4627delC (p.Ala1544Hisfs) rs1131691088
NM_001042492.2(NF1):c.4635C>A (p.Tyr1545Ter) rs754023358
NM_001042492.2(NF1):c.4703dup (p.Phe1569Valfs)
NM_001042492.2(NF1):c.4729C>T (p.Gln1577Ter) rs797044942
NM_001042492.2(NF1):c.4743dup (p.Glu1582Argfs)
NM_001042492.2(NF1):c.4765delA (p.Thr1589Argfs) rs1131691098
NM_001042492.2(NF1):c.4816_4820delTTTTA (p.Phe1606Leufs) rs1555619413
NM_001042492.2(NF1):c.4819del (p.Tyr1607Ilefs) rs876658492
NM_001042492.2(NF1):c.4819dupT (p.Tyr1607Leufs) rs876658492
NM_001042492.2(NF1):c.4873_4874dup (p.His1626Thrfs) rs1555533284
NM_001042492.2(NF1):c.4904_4905insAAT (p.Tyr1635_Gln1969delinsTer) rs587781780
NM_001042492.2(NF1):c.4998dup (p.Pro1667Serfs) rs1135402867
NM_001042492.2(NF1):c.499_502delTGTT (p.Cys167Glnfs) rs786201874
NM_001042492.2(NF1):c.5023_5024delTC (p.Ser1675Argfs) rs876660286
NM_001042492.2(NF1):c.5039_5041delATAinsT (p.Tyr1680Leufs)
NM_001042492.2(NF1):c.5062G>T (p.Glu1688Ter) rs1135402869
NM_001042492.2(NF1):c.5087delT (p.Leu1696Argfs) rs1555533368
NM_001042492.2(NF1):c.5157delA (p.Ile1719Metfs) rs1555533382
NM_001042492.2(NF1):c.5269-1G>A rs876660141
NM_001042492.2(NF1):c.5317dup (p.Leu1773Profs) rs1555533561
NM_001042492.2(NF1):c.5376_5379dup (p.Val1794Profs)
NM_001042492.2(NF1):c.538_541del (p.Leu180Serfs) rs1135402789
NM_001042492.2(NF1):c.541C>T (p.Gln181Ter) rs753529924
NM_001042492.2(NF1):c.5427dup (p.Leu1810Alafs)
NM_001042492.2(NF1):c.5469dupT (p.Ile1824Tyrfs) rs267606605
NM_001042492.2(NF1):c.5492G>A (p.Trp1831Ter) rs1135402872
NM_001042492.2(NF1):c.5546_5553del (p.Asp1849Glyfs) rs1135402873
NM_001042492.2(NF1):c.5609G>A (p.Arg1870Gln) rs786202112
NM_001042492.2(NF1):c.560delG (p.Cys187Leufs) rs1555607107
NM_001042492.2(NF1):c.5625_5630delTCTTCTinsG (p.Asn1875Lysfs) rs1131691081
NM_001042492.2(NF1):c.5637del (p.Leu1880Terfs) rs1135402877
NM_001042492.2(NF1):c.5645dup (p.Cys1882Trpfs)
NM_001042492.2(NF1):c.5672dup (p.Leu1892Valfs) rs1135402878
NM_001042492.2(NF1):c.5687C>G (p.Ser1896Ter) rs1135402879
NM_001042492.2(NF1):c.5730dupT (p.Ile1911Tyrfs) rs876660212
NM_001042492.2(NF1):c.5782G>T (p.Glu1928Ter) rs786203896
NM_001042492.2(NF1):c.5812+1G>A rs876658854
NM_001042492.2(NF1):c.5812+2T>C rs1555533887
NM_001042492.2(NF1):c.5830delC (p.Leu1944Phefs) rs1555534378
NM_001042492.2(NF1):c.5835T>A (p.Cys1945Ter) rs1555534380
NM_001042492.2(NF1):c.5839G>T (p.Glu1947Ter) rs587782088
NM_001042492.2(NF1):c.5843dup (p.Tyr1948Terfs) rs1135402881
NM_001042492.2(NF1):c.5858T>C (p.Leu1953Pro) rs199474792
NM_001042492.2(NF1):c.5991G>A (p.Trp1997Ter) rs876660696
NM_001042492.2(NF1):c.6001G>A (p.Gly2001Arg) rs199474751
NM_001042492.2(NF1):c.6007-2A>G rs1555534595
NM_001042492.2(NF1):c.603del (p.Phe201Leufs) rs1135402792
NM_001042492.2(NF1):c.6088dup (p.Val2030Glyfs) rs1555534609
NM_001042492.2(NF1):c.61-2A>T rs1131691100
NM_001042492.2(NF1):c.610dup (p.Leu204Profs) rs1135402793
NM_001042492.2(NF1):c.6197del (p.Thr2066Ilefs) rs1135402883
NM_001042492.2(NF1):c.6211C>T (p.Gln2071Ter) rs1135402884
NM_001042492.2(NF1):c.625C>T (p.Gln209Ter) rs786203448
NM_001042492.2(NF1):c.629T>G (p.Leu210Ter) rs876658570
NM_001042492.2(NF1):c.6306_6307insT (p.Leu2103Serfs) rs876659471
NM_001042492.2(NF1):c.6326del (p.Phe2109Serfs) rs1135402885
NM_001042492.2(NF1):c.6358_6359insTTTAA (p.Ala2120Valfs) rs1131691133
NM_001042492.2(NF1):c.6452_6456delTCAGTinsA (p.Leu2151Hisfs) rs1135402887
NM_001042492.2(NF1):c.6462dup (p.Glu2155Argfs) rs1135402888
NM_001042492.2(NF1):c.6520_6538del19 (p.Ala2174Profs) rs786203806
NM_001042492.2(NF1):c.6525_6537del13 (p.Ile2176Profs) rs1131691071
NM_001042492.2(NF1):c.6545del (p.Tyr2182Serfs) rs1135402889
NM_001042492.2(NF1):c.6546_6550del (p.Tyr2182Terfs) rs1135402890
NM_001042492.2(NF1):c.6557C>G (p.Ser2186Ter) rs1131691091
NM_001042492.2(NF1):c.6569_6570delGC (p.Gly2190Valfs) rs1131691076
NM_001042492.2(NF1):c.6577G>T (p.Glu2193Ter) rs1135402891
NM_001042492.2(NF1):c.6583_6586delGAGA (p.Glu2195Leufs) rs1131691084
NM_001042492.2(NF1):c.6704+1G>T rs1060500376
NM_001042492.2(NF1):c.6715C>T (p.Gln2239Ter) rs1131691093
NM_001042492.2(NF1):c.6772C>T (p.Arg2258Ter) rs876658541
NM_001042492.2(NF1):c.6855C>A (p.Tyr2285Ter) rs772295894
NM_001042492.2(NF1):c.6878del (p.Ala2293Valfs) rs1135402895
NM_001042492.2(NF1):c.6900dup (p.Leu2301Ilefs) rs1555535050
NM_001042492.2(NF1):c.6904C>T (p.Gln2302Ter) rs1057518807
NM_001042492.2(NF1):c.6970C>T (p.Gln2324Ter) rs1131691073
NM_001042492.2(NF1):c.7028_7031delATAC (p.His2343Leufs) rs1131691083
NM_001042492.2(NF1):c.7030del (p.Thr2344Leufs) rs1135402897
NM_001042492.2(NF1):c.705C>G (p.Tyr235Ter) rs769048538
NM_001042492.2(NF1):c.7063-2A>G
NM_001042492.2(NF1):c.7102delG (p.Glu2368Serfs) rs1131691082
NM_001042492.2(NF1):c.7110_7111delCT (p.His2370Glnfs) rs1555535416
NM_001042492.2(NF1):c.7195delA (p.Arg2399Glyfs) rs1131691102
NM_001042492.2(NF1):c.7234delA (p.Ile2412Phefs) rs876658245
NM_001042492.2(NF1):c.7260dup (p.Asn2421Terfs) rs1135402901
NM_001042492.2(NF1):c.7287del (p.Phe2429Leufs) rs1135402902
NM_001042492.2(NF1):c.7337_7338del (p.Ser2446Terfs) rs1135402904
NM_001042492.2(NF1):c.7348C>T (p.Arg2450Ter) rs786202457
NM_001042492.2(NF1):c.7383del (p.Leu2462Phefs) rs1135402905
NM_001042492.2(NF1):c.7392delT (p.Asp2465Ilefs) rs786202180
NM_001042492.2(NF1):c.7409dup (p.Asn2470Lysfs) rs1135402906
NM_001042492.2(NF1):c.7458-1G>C
NM_001042492.2(NF1):c.7549C>T (p.Arg2517Ter) rs866445127
NM_001042492.2(NF1):c.7701dup (p.Lys2568Glnfs) rs1060500295
NM_001042492.2(NF1):c.7745dup (p.Arg2583Glufs) rs1555536683
NM_001042492.2(NF1):c.7747_7748delAG (p.Arg2583Aspfs) rs1135402907
NM_001042492.2(NF1):c.7760C>G (p.Ser2587Ter) rs1131691090
NM_001042492.2(NF1):c.7782del (p.Val2596Phefs) rs1135402908
NM_001042492.2(NF1):c.7838dup (p.Lys2614Glufs) rs1131691129
NM_001042492.2(NF1):c.7869+1G>A rs1329683225
NM_001042492.2(NF1):c.789del (p.Ala264Glnfs) rs1135402795
NM_001042492.2(NF1):c.7909C>T (p.Arg2637Ter) rs786201367
NM_001042492.2(NF1):c.792del (p.Ala265Glnfs) rs1135402796
NM_001042492.2(NF1):c.7956dup (p.Val2653Serfs) rs1555536765
NM_001042492.2(NF1):c.8009C>A (p.Ser2670Ter) rs1131691074
NM_001042492.2(NF1):c.8095C>T (p.Gln2699Ter) rs786203443
NM_001042492.2(NF1):c.82C>T (p.Gln28Ter) rs771764281
NM_001042492.2(NF1):c.910C>T (p.Arg304Ter) rs786203950
NM_001042492.2(NF1):c.955dupA (p.Ser319Lysfs) rs876660931

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.