ClinVar Miner

List of variants in gene NF1 reported as pathogenic by ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 56
Download table as spreadsheet
HGVS dbSNP
NM_000267.3(NF1):c.1009G>T (p.Glu337Ter) rs747241884
NM_000267.3(NF1):c.1094C>G (p.Ser365Ter) rs864622107
NM_000267.3(NF1):c.1178delA (p.His393Profs) rs1555611037
NM_000267.3(NF1):c.1185+2T>G rs1555611043
NM_000267.3(NF1):c.1246C>T (p.Arg416Ter) rs764079291
NM_000267.3(NF1):c.1381C>T (p.Arg461Ter) rs878853865
NM_000267.3(NF1):c.1466A>G (p.Tyr489Cys) rs137854557
NM_000267.3(NF1):c.1467T>A (p.Tyr489Ter)
NM_000267.3(NF1):c.1660C>T (p.Gln554Ter) rs953440640
NM_000267.3(NF1):c.2041C>T (p.Arg681Ter) rs768638173
NM_000267.3(NF1):c.2077_2078delAT (p.Met693Valfs) rs1555613795
NM_000267.3(NF1):c.2331G>A (p.Trp777Ter) rs1555613983
NM_000267.3(NF1):c.2842C>T (p.Gln948Ter)
NM_000267.3(NF1):c.2848C>T (p.Gln950Ter) rs1060500357
NM_000267.3(NF1):c.3076A>T (p.Arg1026Ter) rs1555614529
NM_000267.3(NF1):c.334C>T (p.Gln112Ter) rs1555606061
NM_000267.3(NF1):c.3537delT (p.Phe1179Leufs) rs1555615026
NM_000267.3(NF1):c.3757_3797delCTCTACCAACTGCTCTGGAACATGTTTTCTAAAGAAGTAGA (p.Leu1253Ilefs) rs1555615447
NM_000267.3(NF1):c.3790G>T (p.Glu1264Ter) rs863224660
NM_000267.3(NF1):c.4078C>T (p.Gln1360Ter) rs1555617368
NM_000267.3(NF1):c.4084C>T (p.Arg1362Ter) rs137854560
NM_000267.3(NF1):c.4514+1G>A rs1279529138
NM_000267.3(NF1):c.4537C>T (p.Arg1513Ter) rs760703505
NM_000267.3(NF1):c.4829T>G (p.Leu1610Ter) rs1555533292
NM_000267.3(NF1):c.5054_5055insA (p.Val1686Cysfs)
NM_000267.3(NF1):c.5242C>T (p.Arg1748Ter) rs876657714
NM_000267.3(NF1):c.5270_5271delTT (p.Phe1757Serfs) rs1555533566
NM_000267.3(NF1):c.5425C>T (p.Arg1809Cys) rs797045139
NM_000267.3(NF1):c.551delA (p.Asn184Metfs) rs1555607102
NM_000267.3(NF1):c.5702_5703delTC (p.Leu1901Hisfs) rs1555533880
NM_000267.3(NF1):c.5717delT (p.Leu1906Trpfs) rs1135402880
NM_000267.3(NF1):c.5792G>A (p.Trp1931Ter)
NM_000267.3(NF1):c.6310_6313delCTGG (p.Leu2104Serfs) rs1555534755
NM_000267.3(NF1):c.654+1G>A rs1060500245
NM_000267.3(NF1):c.662G>A (p.Trp221Ter) rs1131691126
NM_000267.3(NF1):c.6792C>G (p.Tyr2264Ter) rs772295894
NM_000267.3(NF1):c.7054C>T (p.Gln2352Ter) rs1555535417
NM_000267.3(NF1):c.7225G>T (p.Glu2409Ter) rs1555536035
NM_000267.3(NF1):c.7267dupA (p.Thr2423Asnfs) rs1064794278
NM_000267.3(NF1):c.731-1_731delGA rs1555608925
NM_000267.3(NF1):c.7411C>T (p.Gln2471Ter) rs1555536340
NM_000267.3(NF1):c.7699C>T (p.Gln2567Ter) rs1555536687
NM_000267.3(NF1):c.7907+1G>A rs1555536773
NM_000267.3:c.1672delA
NM_000267.3:c.5875delA
NM_000267.3:c.7901delC
NM_001042492.2(NF1):c.1885G>A (p.Gly629Arg) rs199474738
NM_001042492.2(NF1):c.2339C>A (p.Thr780Lys) rs199474746
NM_001042492.2(NF1):c.3665delC (p.Pro1222Leufs) rs867391752
NM_001042492.2(NF1):c.3721C>T (p.Arg1241Ter) rs137854562
NM_001042492.2(NF1):c.3827G>A (p.Arg1276Gln) rs137854556
NM_001042492.2(NF1):c.4195C>T (p.Gln1399Ter) rs1131691072
NM_001042492.2(NF1):c.6855C>A (p.Tyr2285Ter) rs772295894
NM_001042492.2(NF1):c.7348C>T (p.Arg2450Ter) rs786202457
NM_001042492.2(NF1):c.7549C>T (p.Arg2517Ter) rs866445127
NM_001042492.2(NF1):c.910C>T (p.Arg304Ter) rs786203950

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.