ClinVar Miner

List of variants in gene POLD1 reported as uncertain significance

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 901
Download table as spreadsheet
HGVS dbSNP
NC_000019.10:g.(?_50398842)_(50403607_?)dup
NC_000019.10:g.(?_50398842)_(50409676_?)del
NC_000019.10:g.(?_50398842)_(50417957_?)dup
NC_000019.10:g.(?_50398846)_(50399490_?)del
NC_000019.10:g.(?_50398846)_(50403603_?)del
NC_000019.10:g.(?_50398846)_(50406523_?)del
NC_000019.10:g.(?_50398851)_(50399484_?)dup
NC_000019.10:g.(?_50399365)_(50401930_?)del
NC_000019.10:g.(?_50401772)_(50403603_?)del
NC_000019.10:g.(?_50408779)_(50417275_?)dup
NG_033800.1:g.37140_37141ins7
NM_001256849.1(POLD1):c.-3A>C rs1254845405
NM_001256849.1(POLD1):c.1171dup (p.Asp391Glyfs) rs1555790567
NM_001256849.1(POLD1):c.1186dup (p.Tyr396Leufs) rs1414945254
NM_001256849.1(POLD1):c.1687-2A>G
NM_001256849.1(POLD1):c.1735G>A (p.Glu579Lys) rs1354117345
NM_001256849.1(POLD1):c.1773dup (p.Gly592Argfs) rs1555791532
NM_001256849.1(POLD1):c.17G>A (p.Arg6Gln) rs778275831
NM_001256849.1(POLD1):c.189G>T (p.Glu63Asp)
NM_001256849.1(POLD1):c.208G>T (p.Val70Phe) rs147911699
NM_001256849.1(POLD1):c.2275G>A (p.Val759Ile) rs145473716
NM_001256849.1(POLD1):c.2317dup (p.Ala773Glyfs)
NM_001256849.1(POLD1):c.2428_2440dup (p.Phe814Cysfs)
NM_001256849.1(POLD1):c.2435_2454dup (p.Asp819Cysfs) rs1555792829
NM_001256849.1(POLD1):c.2460_2467dup (p.Arg823Profs) rs751309893
NM_001256849.1(POLD1):c.2667_2670dup (p.Ala891Argfs)
NM_001256849.1(POLD1):c.2795dup (p.Val933Cysfs) rs1211000727
NM_001256849.1(POLD1):c.2824C>G (p.Pro942Ala) rs1203736050
NM_001256849.1(POLD1):c.2874G>A (p.Leu958=)
NM_001256849.1(POLD1):c.2959dup (p.Asp987Glyfs) rs756872503
NM_001256849.1(POLD1):c.2T>A (p.Met1Lys) rs1057517594
NM_001256849.1(POLD1):c.3035G>A (p.Cys1012Tyr) rs1057519693
NM_001256849.1(POLD1):c.3041G>A (p.Gly1014Asp) rs1057519694
NM_001256849.1(POLD1):c.3068-2A>G rs1555793565
NM_001256849.1(POLD1):c.3074_3076dup (p.Val1025_Cys1026insLeu) rs1555793570
NM_001256849.1(POLD1):c.46A>G (p.Lys16Glu) rs765185645
NM_001256849.1(POLD1):c.590-2A>G rs758877520
NM_001256849.1(POLD1):c.80_82dup (p.Asp27_Ala28insAsp) rs767241512
NM_001256849.1(POLD1):c.810_811invTG (p.Gly271Arg)
NM_001256849.1(POLD1):c.970+1dup rs1412316742
NM_001256849.1(POLD1):c.980C>T (p.Pro327Leu) rs397514633
NM_001308632.1(POLD1):c.1049_1070dup (p.Arg358Profs) rs1555790419
NM_001308632.1(POLD1):c.1240A>G (p.Lys414Glu) rs1555790592
NM_001308632.1(POLD1):c.2232+2T>C rs1555792026
NM_001308632.1(POLD1):c.487G>T (p.Asp163Tyr) rs753299061
NM_002691.3(POLD1):c.-1G>A rs1312876547
NM_002691.3(POLD1):c.-2+1G>C rs1064794875
NM_002691.3(POLD1):c.-23C>T rs957961260
NM_002691.3(POLD1):c.-44_-36delTCACGGCGGinsACACGGCGA rs1064796251
NM_002691.3(POLD1):c.-5G>C rs1555786763
NM_002691.3(POLD1):c.1008G>T (p.Gln336His) rs1060501825
NM_002691.3(POLD1):c.1023_1033del (p.Leu342Glyfs) rs1555790398
NM_002691.3(POLD1):c.1027C>T (p.Arg343Cys) rs762494977
NM_002691.3(POLD1):c.1028G>A (p.Arg343His) rs140539427
NM_002691.3(POLD1):c.1028G>C (p.Arg343Pro) rs140539427
NM_002691.3(POLD1):c.102C>A (p.Phe34Leu)
NM_002691.3(POLD1):c.1031G>C (p.Trp344Ser) rs1555790406
NM_002691.3(POLD1):c.1032G>T (p.Trp344Cys)
NM_002691.3(POLD1):c.1034G>T (p.Gly345Val) rs1555790409
NM_002691.3(POLD1):c.1036G>T (p.Glu346Ter) rs1064796383
NM_002691.3(POLD1):c.103G>A (p.Glu35Lys) rs554554906
NM_002691.3(POLD1):c.1040C>T (p.Pro347Leu) rs2230243
NM_002691.3(POLD1):c.104A>T (p.Glu35Val) rs1060501832
NM_002691.3(POLD1):c.1054C>T (p.Arg352Cys) rs762330164
NM_002691.3(POLD1):c.1055G>A (p.Arg352His) rs556862476
NM_002691.3(POLD1):c.1055G>T (p.Arg352Leu) rs556862476
NM_002691.3(POLD1):c.1061C>T (p.Ala354Val) rs140990974
NM_002691.3(POLD1):c.1070T>G (p.Leu357Arg) rs143340270
NM_002691.3(POLD1):c.1072C>T (p.Arg358Trp) rs751775497
NM_002691.3(POLD1):c.1073G>A (p.Arg358Gln) rs878854518
NM_002691.3(POLD1):c.108_110delGGA (p.Glu36del) rs1555789096
NM_002691.3(POLD1):c.1091T>C (p.Leu364Pro) rs947583054
NM_002691.3(POLD1):c.1094G>C (p.Gly365Ala) rs1555790445
NM_002691.3(POLD1):c.1097C>G (p.Ala366Gly) rs1555790449
NM_002691.3(POLD1):c.1107G>C (p.Gln369His) rs1400257948
NM_002691.3(POLD1):c.1108A>C (p.Ser370Arg)
NM_002691.3(POLD1):c.1109G>T (p.Ser370Ile) rs868850526
NM_002691.3(POLD1):c.1114G>A (p.Glu372Lys) rs960226186
NM_002691.3(POLD1):c.1115A>G (p.Glu372Gly) rs1057119431
NM_002691.3(POLD1):c.1117A>G (p.Lys373Glu) rs897166414
NM_002691.3(POLD1):c.1118A>G (p.Lys373Arg) rs770407151
NM_002691.3(POLD1):c.1126G>A (p.Asp376Asn) rs773891726
NM_002691.3(POLD1):c.1127A>G (p.Asp376Gly) rs1231801192
NM_002691.3(POLD1):c.1135C>T (p.Gln379Ter) rs1064794926
NM_002691.3(POLD1):c.1136A>G (p.Gln379Arg) rs1355345852
NM_002691.3(POLD1):c.1137+1G>A rs1555790474
NM_002691.3(POLD1):c.1137+3A>G rs1064796024
NM_002691.3(POLD1):c.1137+3A>T rs1064796024
NM_002691.3(POLD1):c.1138-3C>T rs200072694
NM_002691.3(POLD1):c.1138-5C>A rs1374129343
NM_002691.3(POLD1):c.1138-6C>G rs1278597997
NM_002691.3(POLD1):c.1144T>C (p.Ser382Pro) rs1555790556
NM_002691.3(POLD1):c.1147A>G (p.Thr383Ala) rs1555790559
NM_002691.3(POLD1):c.1148C>T (p.Thr383Ile) rs201654210
NM_002691.3(POLD1):c.1156C>T (p.Arg386Cys) rs373046355
NM_002691.3(POLD1):c.1157G>A (p.Arg386His) rs764023083
NM_002691.3(POLD1):c.1171G>A (p.Asp391Asn) rs1555790565
NM_002691.3(POLD1):c.1174G>A (p.Val392Met) rs778843530
NM_002691.3(POLD1):c.1178T>C (p.Ile393Thr) rs750322846
NM_002691.3(POLD1):c.1183G>A (p.Gly395Ser) rs1555790574
NM_002691.3(POLD1):c.1194C>G (p.Ile398Met) rs878854519
NM_002691.3(POLD1):c.1195C>G (p.Gln399Glu) rs1555790575
NM_002691.3(POLD1):c.1195C>T (p.Gln399Ter) rs1555790575
NM_002691.3(POLD1):c.1204G>A (p.Asp402Asn) rs1426325954
NM_002691.3(POLD1):c.1205A>G (p.Asp402Gly) rs1555790579
NM_002691.3(POLD1):c.1211C>T (p.Pro404Leu) rs1260247042
NM_002691.3(POLD1):c.1223C>G (p.Ser408Cys) rs1433696636
NM_002691.3(POLD1):c.1225C>T (p.Arg409Trp) rs778135510
NM_002691.3(POLD1):c.1226G>A (p.Arg409Gln) rs749611798
NM_002691.3(POLD1):c.1226G>C (p.Arg409Pro)
NM_002691.3(POLD1):c.1228G>A (p.Ala410Thr)
NM_002691.3(POLD1):c.1233G>C (p.Gln411His) rs771349646
NM_002691.3(POLD1):c.1234A>G (p.Thr412Ala) rs1038164521
NM_002691.3(POLD1):c.1243-3C>T rs1555791075
NM_002691.3(POLD1):c.1243-5_1243-3delCTC rs760329559
NM_002691.3(POLD1):c.1243G>A (p.Val415Ile) rs1555791076
NM_002691.3(POLD1):c.1250C>G (p.Thr417Arg) rs1555791079
NM_002691.3(POLD1):c.125_136delAGGAGATGGAGG (p.Glu42_Glu45del) rs1300269779
NM_002691.3(POLD1):c.1267C>T (p.Arg423Cys)
NM_002691.3(POLD1):c.1268G>A (p.Arg423His) rs199576140
NM_002691.3(POLD1):c.1270G>T (p.Val424Leu) rs1315928771
NM_002691.3(POLD1):c.1273G>T (p.Ala425Ser) rs1027677934
NM_002691.3(POLD1):c.1274C>G (p.Ala425Gly) rs1555791090
NM_002691.3(POLD1):c.1276G>A (p.Gly426Ser) rs1060501840
NM_002691.3(POLD1):c.1289A>G (p.Asn430Ser) rs546554950
NM_002691.3(POLD1):c.1291A>G (p.Ile431Val) rs752444746
NM_002691.3(POLD1):c.1294C>G (p.Arg432Gly) rs774130423
NM_002691.3(POLD1):c.1294C>T (p.Arg432Trp) rs774130423
NM_002691.3(POLD1):c.1295G>A (p.Arg432Gln) rs139557851
NM_002691.3(POLD1):c.1297G>A (p.Asp433Asn) rs1555791103
NM_002691.3(POLD1):c.1298A>C (p.Asp433Ala) rs767560532
NM_002691.3(POLD1):c.1298A>T (p.Asp433Val) rs767560532
NM_002691.3(POLD1):c.129G>A (p.Glu43=)
NM_002691.3(POLD1):c.1301C>G (p.Ser434Cys) rs1060501845
NM_002691.3(POLD1):c.1310A>G (p.Gln437Arg) rs1555791118
NM_002691.3(POLD1):c.1317G>T (p.Lys439Asn) rs758977084
NM_002691.3(POLD1):c.1318C>T (p.Gln440Ter) rs1060501841
NM_002691.3(POLD1):c.1322C>T (p.Thr441Met) rs376711125
NM_002691.3(POLD1):c.1327C>G (p.Arg443Gly)
NM_002691.3(POLD1):c.132G>A (p.Met44Ile) rs757575448
NM_002691.3(POLD1):c.1331G>A (p.Arg444Gln) rs201503929
NM_002691.3(POLD1):c.1340A>G (p.Lys447Arg) rs1555791135
NM_002691.3(POLD1):c.1357G>C (p.Gly453Arg) rs1555791139
NM_002691.3(POLD1):c.1360C>T (p.Arg454Cys) rs906743894
NM_002691.3(POLD1):c.1361G>A (p.Arg454His) rs1004124075
NM_002691.3(POLD1):c.1363G>A (p.Val455Met) rs762670703
NM_002691.3(POLD1):c.1366C>G (p.Gln456Glu) rs878854520
NM_002691.3(POLD1):c.1366C>T (p.Gln456Ter) rs878854520
NM_002691.3(POLD1):c.1367A>T (p.Gln456Leu) rs1157114471
NM_002691.3(POLD1):c.1371G>T (p.Met457Ile) rs1457008478
NM_002691.3(POLD1):c.1375A>G (p.Met459Val) rs774331018
NM_002691.3(POLD1):c.1379T>C (p.Leu460Pro) rs1555791146
NM_002691.3(POLD1):c.1382A>G (p.Gln461Arg) rs1555791147
NM_002691.3(POLD1):c.1383+4T>A rs1060501854
NM_002691.3(POLD1):c.1383+6G>A rs1162583403
NM_002691.3(POLD1):c.1384-13C>G rs536467012
NM_002691.3(POLD1):c.1384-7C>G
NM_002691.3(POLD1):c.1384G>A (p.Val462Met) rs759504885
NM_002691.3(POLD1):c.1389G>C (p.Leu463=) rs1368969207
NM_002691.3(POLD1):c.1393C>T (p.Arg465Trp) rs771858429
NM_002691.3(POLD1):c.1394G>A (p.Arg465Gln) rs199700312
NM_002691.3(POLD1):c.13C>T (p.Arg5Trp) rs9282830
NM_002691.3(POLD1):c.1400A>G (p.Tyr467Cys) rs1060501851
NM_002691.3(POLD1):c.1403A>G (p.Lys468Arg) rs1004191319
NM_002691.3(POLD1):c.1422C>T (p.Leu474=) rs369332787
NM_002691.3(POLD1):c.1424A>G (p.Asn475Ser) rs1064794896
NM_002691.3(POLD1):c.1429G>A (p.Val477Met) rs766881510
NM_002691.3(POLD1):c.1429G>T (p.Val477Leu)
NM_002691.3(POLD1):c.143A>C (p.His48Pro) rs1555789124
NM_002691.3(POLD1):c.1449C>T (p.Gly483=) rs878854522
NM_002691.3(POLD1):c.1456A>G (p.Lys486Glu) rs527486070
NM_002691.3(POLD1):c.1456_1458delAAG (p.Lys486del) rs1555791207
NM_002691.3(POLD1):c.1463A>G (p.Asp488Gly) rs1374013475
NM_002691.3(POLD1):c.1465G>A (p.Val489Met) rs753244422
NM_002691.3(POLD1):c.1469A>G (p.Gln490Arg)
NM_002691.3(POLD1):c.1471C>T (p.His491Tyr) rs1381049004
NM_002691.3(POLD1):c.1476C>G (p.Ser492Arg)
NM_002691.3(POLD1):c.1483_1488delACCGAC (p.Thr495_Asp496del) rs1555791217
NM_002691.3(POLD1):c.1486G>C (p.Asp496His) rs777809352
NM_002691.3(POLD1):c.1494+3G>A rs749556778
NM_002691.3(POLD1):c.1495-15_1495-14delCGinsGA rs1064794332
NM_002691.3(POLD1):c.1495-3C>T rs1555791320
NM_002691.3(POLD1):c.14G>A (p.Arg5Gln) rs748471297
NM_002691.3(POLD1):c.1504G>A (p.Asp502Asn) rs777866589
NM_002691.3(POLD1):c.1504_1506delGAC (p.Asp502del) rs1555791323
NM_002691.3(POLD1):c.1505A>G (p.Asp502Gly) rs1313176102
NM_002691.3(POLD1):c.1507C>G (p.Gln503Glu) rs1555791331
NM_002691.3(POLD1):c.1509_1510delGA (p.Gln503Hisfs) rs1060501850
NM_002691.3(POLD1):c.1511C>T (p.Thr504Ile) rs1555791333
NM_002691.3(POLD1):c.1513C>T (p.Arg505Cys)
NM_002691.3(POLD1):c.1514G>A (p.Arg505His) rs1043752384
NM_002691.3(POLD1):c.1516C>T (p.Arg506Cys) rs528292347
NM_002691.3(POLD1):c.1517G>A (p.Arg506His) rs140379348
NM_002691.3(POLD1):c.1519C>T (p.Arg507Cys) rs878854523
NM_002691.3(POLD1):c.1527T>A (p.Ala509=) rs1229053013
NM_002691.3(POLD1):c.1528G>A (p.Val510Met) rs1555791349
NM_002691.3(POLD1):c.1529T>C (p.Val510Ala) rs1555791351
NM_002691.3(POLD1):c.1534T>C (p.Cys512Arg) rs1060501815
NM_002691.3(POLD1):c.1542G>A (p.Lys514=) rs779864085
NM_002691.3(POLD1):c.1543G>A (p.Asp515Asn) rs1169141963
NM_002691.3(POLD1):c.1549T>C (p.Tyr517His) rs1060501843
NM_002691.3(POLD1):c.154G>A (p.Glu52Lys) rs984358794
NM_002691.3(POLD1):c.1552C>A (p.Leu518Met) rs149043082
NM_002691.3(POLD1):c.1561C>T (p.Arg521Trp) rs1341055535
NM_002691.3(POLD1):c.1562G>A (p.Arg521Gln) rs143076166
NM_002691.3(POLD1):c.1573C>T (p.Arg525Trp) rs201804732
NM_002691.3(POLD1):c.1574G>A (p.Arg525Gln) rs372190244
NM_002691.3(POLD1):c.157_162delCAGGAG (p.Gln53_Glu54del) rs760207160
NM_002691.3(POLD1):c.1594G>A (p.Ala532Thr) rs765276497
NM_002691.3(POLD1):c.1597G>A (p.Val533Met) rs758602573
NM_002691.3(POLD1):c.15G>A (p.Arg5=)
NM_002691.3(POLD1):c.1605G>C (p.Met535Ile) rs1555791404
NM_002691.3(POLD1):c.1607C>T (p.Ala536Val) rs779735891
NM_002691.3(POLD1):c.1610G>C (p.Arg537Thr) rs1555791415
NM_002691.3(POLD1):c.1615A>G (p.Thr539Ala) rs1555791424
NM_002691.3(POLD1):c.1640T>C (p.Leu547Pro) rs1555791435
NM_002691.3(POLD1):c.1645C>T (p.Arg549Cys) rs775734510
NM_002691.3(POLD1):c.1646G>A (p.Arg549His) rs201038430
NM_002691.3(POLD1):c.1657G>A (p.Val553Ile) rs1213970824
NM_002691.3(POLD1):c.1658T>C (p.Val553Ala) rs1060501822
NM_002691.3(POLD1):c.1666G>A (p.Val556Ile) rs762273084
NM_002691.3(POLD1):c.1669T>G (p.Ser557Ala)
NM_002691.3(POLD1):c.1681C>T (p.Arg561Trp) rs368738479
NM_002691.3(POLD1):c.1682G>A (p.Arg561Gln)
NM_002691.3(POLD1):c.1686+3C>T rs1555791459
NM_002691.3(POLD1):c.1686+5delG rs1555791460
NM_002691.3(POLD1):c.1687-1G>A rs1555791492
NM_002691.3(POLD1):c.1687-3C>A rs878854525
NM_002691.3(POLD1):c.1687-3C>T
NM_002691.3(POLD1):c.1687-5C>T rs199733325
NM_002691.3(POLD1):c.1691T>G (p.Met564Arg) rs748444470
NM_002691.3(POLD1):c.1694A>C (p.His565Pro)
NM_002691.3(POLD1):c.1696G>A (p.Glu566Lys) rs372429157
NM_002691.3(POLD1):c.16C>T (p.Arg6Trp) rs55955638
NM_002691.3(POLD1):c.1716G>T (p.Val572=)
NM_002691.3(POLD1):c.1717G>T (p.Val573Leu) rs760616076
NM_002691.3(POLD1):c.1732G>A (p.Gly578Ser)
NM_002691.3(POLD1):c.1733_1735delGCG (p.Gly578del) rs1060501856
NM_002691.3(POLD1):c.1734C>T (p.Gly578=) rs1293284420
NM_002691.3(POLD1):c.1745C>T (p.Thr582Met) rs547831370
NM_002691.3(POLD1):c.1759A>T (p.Ile587Phe) rs1060501838
NM_002691.3(POLD1):c.1762G>A (p.Glu588Lys) rs746649739
NM_002691.3(POLD1):c.1768C>T (p.Leu590Phe) rs878854526
NM_002691.3(POLD1):c.1774G>A (p.Gly592Arg)
NM_002691.3(POLD1):c.1774G>C (p.Gly592Arg)
NM_002691.3(POLD1):c.1775+2T>A rs878854527
NM_002691.3(POLD1):c.1775+6G>A rs943447587
NM_002691.3(POLD1):c.1775+6delG rs1555791538
NM_002691.3(POLD1):c.1776-4C>T
NM_002691.3(POLD1):c.1776G>A (p.Gly592=)
NM_002691.3(POLD1):c.1783G>A (p.Asp595Asn) rs200864923
NM_002691.3(POLD1):c.1786G>A (p.Val596Ile) rs773180520
NM_002691.3(POLD1):c.1786G>C (p.Val596Leu) rs773180520
NM_002691.3(POLD1):c.178T>C (p.Ser60Pro) rs1555789135
NM_002691.3(POLD1):c.1792A>G (p.Ile598Val) rs368349780
NM_002691.3(POLD1):c.1795G>A (p.Ala599Thr) rs149569984
NM_002691.3(POLD1):c.1799C>T (p.Thr600Ile) rs1060501810
NM_002691.3(POLD1):c.17G>C (p.Arg6Pro) rs778275831
NM_002691.3(POLD1):c.1810T>G (p.Ser604Ala) rs1555791780
NM_002691.3(POLD1):c.1811C>A (p.Ser604Tyr) rs1060501807
NM_002691.3(POLD1):c.1816C>A (p.Leu606Met)
NM_002691.3(POLD1):c.1837G>A (p.Ala613Thr)
NM_002691.3(POLD1):c.1841A>G (p.His614Arg)
NM_002691.3(POLD1):c.1841A>T (p.His614Leu) rs1555791790
NM_002691.3(POLD1):c.1859C>T (p.Thr620Met) rs1309243644
NM_002691.3(POLD1):c.1867C>T (p.Arg623Trp) rs768773535
NM_002691.3(POLD1):c.1868G>A (p.Arg623Gln) rs781327088
NM_002691.3(POLD1):c.1869G>T (p.Arg623=) rs748380365
NM_002691.3(POLD1):c.1873G>A (p.Gly625Arg) rs1060501836
NM_002691.3(POLD1):c.1874G>C (p.Gly625Ala)
NM_002691.3(POLD1):c.1877C>T (p.Thr626Ile) rs1060501842
NM_002691.3(POLD1):c.187G>A (p.Glu63Lys) rs200736325
NM_002691.3(POLD1):c.1886A>T (p.Lys629Ile) rs772953240
NM_002691.3(POLD1):c.1889_1890delTG (p.Leu630Argfs)
NM_002691.3(POLD1):c.1891G>A (p.Gly631Ser) rs1555791808
NM_002691.3(POLD1):c.1892+5A>G
NM_002691.3(POLD1):c.1892G>A (p.Gly631Asp)
NM_002691.3(POLD1):c.1893-6A>G rs963949260
NM_002691.3(POLD1):c.1897A>G (p.Thr633Ala) rs1555791840
NM_002691.3(POLD1):c.1901A>C (p.Glu634Ala) rs1236887089
NM_002691.3(POLD1):c.1907A>G (p.Gln636Arg)
NM_002691.3(POLD1):c.1917G>T (p.Arg639Ser) rs1334171687
NM_002691.3(POLD1):c.1918A>G (p.Thr640Ala) rs201212113
NM_002691.3(POLD1):c.1919C>A (p.Thr640Asn) rs771527077
NM_002691.3(POLD1):c.1925C>G (p.Thr642Ser) rs878854529
NM_002691.3(POLD1):c.1930G>A (p.Asp644Asn) rs763465385
NM_002691.3(POLD1):c.1932C>A (p.Asp644Glu) rs80214209
NM_002691.3(POLD1):c.1933G>A (p.Glu645Lys) rs1161281976
NM_002691.3(POLD1):c.1937T>A (p.Phe646Tyr) rs767518281
NM_002691.3(POLD1):c.193G>A (p.Val65Ile) rs975951740
NM_002691.3(POLD1):c.193G>C (p.Val65Leu) rs975951740
NM_002691.3(POLD1):c.1945A>C (p.Thr649Pro)
NM_002691.3(POLD1):c.1955G>A (p.Arg652Gln) rs778037523
NM_002691.3(POLD1):c.1959G>C (p.Lys653Asn) rs1443432312
NM_002691.3(POLD1):c.1969C>T (p.Pro657Ser) rs1555791873
NM_002691.3(POLD1):c.197C>G (p.Ala66Gly) rs199792522
NM_002691.3(POLD1):c.197C>T (p.Ala66Val)
NM_002691.3(POLD1):c.1986C>A (p.Asn662Lys) rs878854530
NM_002691.3(POLD1):c.1993A>G (p.Ser665Gly) rs878854531
NM_002691.3(POLD1):c.1994G>A (p.Ser665Asn) rs757053149
NM_002691.3(POLD1):c.2007-4G>T rs202035484
NM_002691.3(POLD1):c.2007-5C>T rs199506387
NM_002691.3(POLD1):c.2009C>T (p.Ala670Val) rs1555791976
NM_002691.3(POLD1):c.2017G>A (p.Glu673Lys) rs61751955
NM_002691.3(POLD1):c.202+3A>G rs375365167
NM_002691.3(POLD1):c.2021T>C (p.Leu674Pro)
NM_002691.3(POLD1):c.2023G>A (p.Ala675Thr) rs753870000
NM_002691.3(POLD1):c.202G>A (p.Gly68Arg) rs772866918
NM_002691.3(POLD1):c.203-1G>C rs1555789205
NM_002691.3(POLD1):c.2033C>T (p.Thr678Ile)
NM_002691.3(POLD1):c.2038C>G (p.Pro680Ala) rs1555791989
NM_002691.3(POLD1):c.2039C>T (p.Pro680Leu) rs765557862
NM_002691.3(POLD1):c.203G>A (p.Gly68Glu) rs144707871
NM_002691.3(POLD1):c.2041C>G (p.Leu681Val) rs750594314
NM_002691.3(POLD1):c.2044C>T (p.Arg682Trp) rs758260006
NM_002691.3(POLD1):c.2045G>A (p.Arg682Gln) rs773665739
NM_002691.3(POLD1):c.2048G>A (p.Arg683His)
NM_002691.3(POLD1):c.2052G>C (p.Gln684His) rs144143245
NM_002691.3(POLD1):c.2065C>T (p.Arg689Trp) rs747628342
NM_002691.3(POLD1):c.2066G>A (p.Arg689Gln) rs146530638
NM_002691.3(POLD1):c.2083G>A (p.Val695Met) rs1051419059
NM_002691.3(POLD1):c.208G>A (p.Val70Ile) rs147911699
NM_002691.3(POLD1):c.2093A>G (p.Asn698Ser) rs1555792012
NM_002691.3(POLD1):c.2098G>A (p.Val700Ile) rs868562435
NM_002691.3(POLD1):c.2100A>G (p.Val700=) rs772468675
NM_002691.3(POLD1):c.2115C>T (p.Gly705=)
NM_002691.3(POLD1):c.2116G>A (p.Ala706Thr)
NM_002691.3(POLD1):c.2122G>A (p.Val708Met) rs1060501847
NM_002691.3(POLD1):c.2123T>G (p.Val708Gly) rs1555792019
NM_002691.3(POLD1):c.2142G>A (p.Leu714=) rs1060501816
NM_002691.3(POLD1):c.2143G>A (p.Glu715Lys) rs369988982
NM_002691.3(POLD1):c.2154+4G>A rs373416476
NM_002691.3(POLD1):c.2166delG (p.Phe723Serfs)
NM_002691.3(POLD1):c.2173C>T (p.Arg725Cys) rs878854532
NM_002691.3(POLD1):c.2178G>C (p.Gln726His) rs747483140
NM_002691.3(POLD1):c.217T>A (p.Ser73Thr)
NM_002691.3(POLD1):c.2185G>A (p.Glu729Lys) rs200931999
NM_002691.3(POLD1):c.2186A>G (p.Glu729Gly) rs1060501804
NM_002691.3(POLD1):c.2188A>C (p.Lys730Gln) rs1060501853
NM_002691.3(POLD1):c.2197C>G (p.Gln733Glu)
NM_002691.3(POLD1):c.2206G>A (p.Glu736Lys) rs1555792546
NM_002691.3(POLD1):c.2209T>C (p.Ser737Pro) rs1555792551
NM_002691.3(POLD1):c.2218A>C (p.Thr740Pro)
NM_002691.3(POLD1):c.2218A>G (p.Thr740Ala) rs781629170
NM_002691.3(POLD1):c.2224G>A (p.Glu742Lys) rs752937018
NM_002691.3(POLD1):c.2224G>C (p.Glu742Gln) rs752937018
NM_002691.3(POLD1):c.2225A>T (p.Glu742Val)
NM_002691.3(POLD1):c.2228A>C (p.Asn743Thr)
NM_002691.3(POLD1):c.2231G>A (p.Gly744Asp) rs1555792558
NM_002691.3(POLD1):c.2236A>G (p.Ser746Gly)
NM_002691.3(POLD1):c.223A>G (p.Ile75Val) rs940296193
NM_002691.3(POLD1):c.2248A>G (p.Lys750Glu) rs878854533
NM_002691.3(POLD1):c.224T>C (p.Ile75Thr) rs878854534
NM_002691.3(POLD1):c.2250+4G>A rs370478977
NM_002691.3(POLD1):c.2250+4G>C rs370478977
NM_002691.3(POLD1):c.2250+5G>C rs772130395
NM_002691.3(POLD1):c.2250+7G>A rs775363857
NM_002691.3(POLD1):c.2251-1G>C rs1060501808
NM_002691.3(POLD1):c.2251-4G>A rs768364989
NM_002691.3(POLD1):c.2251-5C>T rs1236954722
NM_002691.3(POLD1):c.2284C>T (p.Arg762Ter) rs769650989
NM_002691.3(POLD1):c.2285G>A (p.Arg762Gln) rs760638243
NM_002691.3(POLD1):c.2290G>A (p.Gly764Ser) rs148838746
NM_002691.3(POLD1):c.2292C>T (p.Gly764=) rs146960286
NM_002691.3(POLD1):c.2293G>A (p.Val765Met) rs759190487
NM_002691.3(POLD1):c.2294T>G (p.Val765Gly) rs1555792660
NM_002691.3(POLD1):c.2300C>T (p.Ser767Leu) rs556196668
NM_002691.3(POLD1):c.2302delG (p.Val768Trpfs) rs1555792662
NM_002691.3(POLD1):c.2309_2310delAG (p.Glu770Glyfs) rs1064794537
NM_002691.3(POLD1):c.230C>G (p.Pro77Arg) rs1555789213
NM_002691.3(POLD1):c.2317G>A (p.Ala773Thr) rs753865441
NM_002691.3(POLD1):c.2318C>T (p.Ala773Val)
NM_002691.3(POLD1):c.2320C>G (p.Leu774Val) rs1197236198
NM_002691.3(POLD1):c.2326C>T (p.Arg776Trp) rs780138978
NM_002691.3(POLD1):c.2327G>A (p.Arg776Gln) rs141801845
NM_002691.3(POLD1):c.232C>T (p.Arg78Cys) rs141319800
NM_002691.3(POLD1):c.2338G>A (p.Asp780Asn) rs1064795184
NM_002691.3(POLD1):c.2338G>T (p.Asp780Tyr) rs1064795184
NM_002691.3(POLD1):c.233G>A (p.Arg78His) rs750825686
NM_002691.3(POLD1):c.233G>C (p.Arg78Pro) rs750825686
NM_002691.3(POLD1):c.2340C>G (p.Asp780Glu) rs572055425
NM_002691.3(POLD1):c.2342G>T (p.Trp781Leu) rs1434951609
NM_002691.3(POLD1):c.2345T>C (p.Val782Ala) rs1060501846
NM_002691.3(POLD1):c.2351G>A (p.Gly784Asp)
NM_002691.3(POLD1):c.2360C>A (p.Pro787Gln) rs199783227
NM_002691.3(POLD1):c.2360C>T (p.Pro787Leu) rs199783227
NM_002691.3(POLD1):c.2363C>T (p.Ser788Leu) rs866494171
NM_002691.3(POLD1):c.2371C>T (p.Arg791Trp) rs1057522945
NM_002691.3(POLD1):c.2372G>A (p.Arg791Gln) rs1174011798
NM_002691.3(POLD1):c.2377G>C (p.Glu793Gln) rs1555792697
NM_002691.3(POLD1):c.2388+4C>T rs371542643
NM_002691.3(POLD1):c.2388+5G>A rs750085275
NM_002691.3(POLD1):c.2388+9C>G rs1001555540
NM_002691.3(POLD1):c.2388G>C (p.Lys796Asn) rs1060501806
NM_002691.3(POLD1):c.238C>G (p.Leu80Val) rs1555789219
NM_002691.3(POLD1):c.2397C>A (p.Phe799Leu) rs878854535
NM_002691.3(POLD1):c.2412_2434del23 (p.Ser805Alafs) rs1064795476
NM_002691.3(POLD1):c.2415C>A (p.Ser805Arg) rs996697515
NM_002691.3(POLD1):c.241C>T (p.Arg81Trp)
NM_002691.3(POLD1):c.2427C>A (p.Tyr809Ter)
NM_002691.3(POLD1):c.2428G>A (p.Ala810Thr) rs760358465
NM_002691.3(POLD1):c.2428G>T (p.Ala810Ser) rs760358465
NM_002691.3(POLD1):c.2429C>A (p.Ala810Glu) rs765981178
NM_002691.3(POLD1):c.2429C>T (p.Ala810Val) rs765981178
NM_002691.3(POLD1):c.242G>A (p.Arg81Gln) rs755461109
NM_002691.3(POLD1):c.2432delG (p.Gly811Alafs) rs1555792827
NM_002691.3(POLD1):c.2433C>T (p.Gly811=) rs1051057675
NM_002691.3(POLD1):c.2443_2444delTCinsCT (p.Ser815Leu)
NM_002691.3(POLD1):c.2446_2448delTCC (p.Ser816del) rs763850764
NM_002691.3(POLD1):c.2447C>T (p.Ser816Phe) rs1555792834
NM_002691.3(POLD1):c.2449C>G (p.Arg817Gly) rs148176230
NM_002691.3(POLD1):c.2449C>T (p.Arg817Trp)
NM_002691.3(POLD1):c.244C>G (p.Pro82Ala) rs1064794543
NM_002691.3(POLD1):c.2450G>A (p.Arg817Gln) rs142017093
NM_002691.3(POLD1):c.2450_2462dupGGCCCGACGCCCA (p.His821Glnfs) rs1555792840
NM_002691.3(POLD1):c.2455G>A (p.Asp819Asn) rs372947760
NM_002691.3(POLD1):c.2458G>A (p.Ala820Thr) rs753609023
NM_002691.3(POLD1):c.2458G>T (p.Ala820Ser) rs753609023
NM_002691.3(POLD1):c.2459C>T (p.Ala820Val)
NM_002691.3(POLD1):c.245C>T (p.Pro82Leu) rs201006221
NM_002691.3(POLD1):c.2463C>A (p.His821Gln)
NM_002691.3(POLD1):c.2464G>A (p.Asp822Asn) rs778972543
NM_002691.3(POLD1):c.2467C>T (p.Arg823Cys) rs376946722
NM_002691.3(POLD1):c.2468G>T (p.Arg823Leu) rs771734704
NM_002691.3(POLD1):c.2470A>G (p.Met824Val) rs779675467
NM_002691.3(POLD1):c.2478C>T (p.Cys826=) rs1555792861
NM_002691.3(POLD1):c.2507A>G (p.Asn836Ser) rs1555792872
NM_002691.3(POLD1):c.2510G>A (p.Cys837Tyr) rs1555792877
NM_002691.3(POLD1):c.2513C>T (p.Pro838Leu) rs1555792878
NM_002691.3(POLD1):c.2515C>A (p.Leu839Ile) rs878854538
NM_002691.3(POLD1):c.2518G>A (p.Val840Met) rs763443242
NM_002691.3(POLD1):c.2537C>T (p.Ala846Val) rs878854539
NM_002691.3(POLD1):c.2541A>C (p.Ser847=)
NM_002691.3(POLD1):c.2545C>T (p.Arg849Cys) rs759987234
NM_002691.3(POLD1):c.2548C>T (p.Arg850Cys) rs760898812
NM_002691.3(POLD1):c.2549G>A (p.Arg850His) rs764432550
NM_002691.3(POLD1):c.2552T>C (p.Leu851Pro) rs1555792892
NM_002691.3(POLD1):c.2560G>A (p.Asp854Asn) rs373650022
NM_002691.3(POLD1):c.2560G>T (p.Asp854Tyr) rs373650022
NM_002691.3(POLD1):c.2563C>G (p.Arg855Gly) rs768048535
NM_002691.3(POLD1):c.2563C>T (p.Arg855Ter) rs768048535
NM_002691.3(POLD1):c.2564+5G>A rs878854540
NM_002691.3(POLD1):c.2564G>A (p.Arg855Gln)
NM_002691.3(POLD1):c.2564G>T (p.Arg855Leu) rs868847470
NM_002691.3(POLD1):c.2565-3C>G rs772419397
NM_002691.3(POLD1):c.2570C>T (p.Pro857Leu) rs776013537
NM_002691.3(POLD1):c.2574G>T (p.Glu858Asp) rs1060501820
NM_002691.3(POLD1):c.2578G>A (p.Ala860Thr) rs768799892
NM_002691.3(POLD1):c.2579C>T (p.Ala860Val) rs1060501818
NM_002691.3(POLD1):c.257C>T (p.Ala86Val) rs148040399
NM_002691.3(POLD1):c.2581G>A (p.Val861Met) rs762113011
NM_002691.3(POLD1):c.2590G>A (p.Ala864Thr) rs765437818
NM_002691.3(POLD1):c.2590G>T (p.Ala864Ser)
NM_002691.3(POLD1):c.2593C>T (p.Gln865Ter) rs1555793026
NM_002691.3(POLD1):c.2594A>G (p.Gln865Arg)
NM_002691.3(POLD1):c.2599G>A (p.Val867Ile) rs367680864
NM_002691.3(POLD1):c.2606C>T (p.Ser869Leu) rs1422842883
NM_002691.3(POLD1):c.260T>C (p.Leu87Pro)
NM_002691.3(POLD1):c.2612_2623delTGCTGTGCAACC (p.Leu871_Asn874del) rs1064792943
NM_002691.3(POLD1):c.2623C>T (p.Arg875Cys) rs751565067
NM_002691.3(POLD1):c.2624G>A (p.Arg875His)
NM_002691.3(POLD1):c.2624G>T (p.Arg875Leu) rs754832710
NM_002691.3(POLD1):c.2626A>G (p.Ile876Val)
NM_002691.3(POLD1):c.2629G>A (p.Asp877Asn) rs1555793039
NM_002691.3(POLD1):c.262G>A (p.Asp88Asn)
NM_002691.3(POLD1):c.2630A>G (p.Asp877Gly) rs1263981527
NM_002691.3(POLD1):c.2641C>G (p.Leu881Val) rs1189641592
NM_002691.3(POLD1):c.2656_2657delGAinsTT (p.Glu886Leu)
NM_002691.3(POLD1):c.2657A>G (p.Glu886Gly)
NM_002691.3(POLD1):c.2665C>T (p.Arg889Cys)
NM_002691.3(POLD1):c.2667C>T (p.Arg889=) rs572100354
NM_002691.3(POLD1):c.2668G>A (p.Ala890Thr) rs1555793052
NM_002691.3(POLD1):c.2669C>T (p.Ala890Val) rs146344351
NM_002691.3(POLD1):c.2677G>A (p.Asp893Asn) rs747559034
NM_002691.3(POLD1):c.2678A>G (p.Asp893Gly) rs1249502531
NM_002691.3(POLD1):c.2686G>A (p.Gly896Ser) rs370557271
NM_002691.3(POLD1):c.2686G>T (p.Gly896Cys)
NM_002691.3(POLD1):c.2689_2696delAAGCAGGC (p.Lys897Profs) rs755492646
NM_002691.3(POLD1):c.2691G>C (p.Lys897Asn)
NM_002691.3(POLD1):c.269A>G (p.Gln90Arg) rs778838312
NM_002691.3(POLD1):c.269A>T (p.Gln90Leu) rs778838312
NM_002691.3(POLD1):c.26C>T (p.Pro9Leu) rs1555789025
NM_002691.3(POLD1):c.2704G>C (p.Glu902Gln) rs373951714
NM_002691.3(POLD1):c.2717+11G>A rs753506843
NM_002691.3(POLD1):c.2717+15G>A rs372493810
NM_002691.3(POLD1):c.2717+4C>T rs1064795361
NM_002691.3(POLD1):c.2717+5T>C rs1555793089
NM_002691.3(POLD1):c.2717+7C>T rs767410345
NM_002691.3(POLD1):c.2717+9C>A rs760140187
NM_002691.3(POLD1):c.2718-2A>C rs1555793132
NM_002691.3(POLD1):c.2718-4G>A rs755348897
NM_002691.3(POLD1):c.2718-5C>T rs368965066
NM_002691.3(POLD1):c.2718G>T (p.Arg906Ser) rs1555793133
NM_002691.3(POLD1):c.2722A>G (p.Arg908Gly) rs1555793137
NM_002691.3(POLD1):c.2727G>T (p.Lys909Asn) rs753176146
NM_002691.3(POLD1):c.2729G>A (p.Arg910Gln)
NM_002691.3(POLD1):c.2731G>A (p.Asp911Asn) rs878854541
NM_002691.3(POLD1):c.2737G>A (p.Gly913Arg) rs778012264
NM_002691.3(POLD1):c.2744C>T (p.Ala915Val) rs1483458869
NM_002691.3(POLD1):c.274G>A (p.Glu92Lys)
NM_002691.3(POLD1):c.2757C>T (p.Gly919=) rs757406292
NM_002691.3(POLD1):c.2758G>A (p.Asp920Asn) rs1060501811
NM_002691.3(POLD1):c.2758_2759delGAinsTT (p.Asp920Phe)
NM_002691.3(POLD1):c.2759A>G (p.Asp920Gly) rs779041717
NM_002691.3(POLD1):c.2760C>G (p.Asp920Glu) rs1057521209
NM_002691.3(POLD1):c.2764G>A (p.Val922Ile) rs775310798
NM_002691.3(POLD1):c.2773G>A (p.Val925Met) rs746950229
NM_002691.3(POLD1):c.2779A>C (p.Ile927Leu)
NM_002691.3(POLD1):c.2783G>C (p.Ser928Thr) rs1189529370
NM_002691.3(POLD1):c.2785G>T (p.Ala929Ser) rs1555793166
NM_002691.3(POLD1):c.2788G>A (p.Ala930Thr) rs144111108
NM_002691.3(POLD1):c.2789C>G (p.Ala930Gly) rs1060501855
NM_002691.3(POLD1):c.2789C>T (p.Ala930Val) rs1060501855
NM_002691.3(POLD1):c.2792A>G (p.Lys931Arg) rs1555793174
NM_002691.3(POLD1):c.2794G>C (p.Gly932Arg) rs761355038
NM_002691.3(POLD1):c.2795G>C (p.Gly932Ala)
NM_002691.3(POLD1):c.2797G>T (p.Val933Leu) rs764785216
NM_002691.3(POLD1):c.2800G>A (p.Ala934Thr)
NM_002691.3(POLD1):c.2803G>A (p.Ala935Thr) rs555452657
NM_002691.3(POLD1):c.2807A>C (p.Tyr936Ser)
NM_002691.3(POLD1):c.2809A>G (p.Met937Val)
NM_002691.3(POLD1):c.2809A>T (p.Met937Leu) rs1060501839
NM_002691.3(POLD1):c.2810T>G (p.Met937Arg) rs1011628932
NM_002691.3(POLD1):c.2813A>G (p.Lys938Arg) rs1356081968
NM_002691.3(POLD1):c.2816C>T (p.Ser939Leu) rs1064795958
NM_002691.3(POLD1):c.2818G>A (p.Glu940Lys)
NM_002691.3(POLD1):c.2820+3C>T rs986822818
NM_002691.3(POLD1):c.2820+5G>A rs1555793187
NM_002691.3(POLD1):c.2821-4G>A rs369042179
NM_002691.3(POLD1):c.2821-5C>T rs1057521374
NM_002691.3(POLD1):c.2824C>T (p.Pro942Ser) rs1203736050
NM_002691.3(POLD1):c.2825C>T (p.Pro942Leu)
NM_002691.3(POLD1):c.2825dupC (p.Leu943Alafs) rs878854542
NM_002691.3(POLD1):c.2829G>A (p.Leu943=) rs1225289450
NM_002691.3(POLD1):c.2833G>A (p.Val945Met) rs565328583
NM_002691.3(POLD1):c.2838G>A (p.Leu946=) rs1060501814
NM_002691.3(POLD1):c.283A>T (p.Ile95Phe) rs1060501835
NM_002691.3(POLD1):c.2854A>G (p.Ile952Val) rs879254101
NM_002691.3(POLD1):c.2855T>C (p.Ile952Thr) rs1555793299
NM_002691.3(POLD1):c.2861C>G (p.Thr954Arg) rs374016016
NM_002691.3(POLD1):c.2861C>T (p.Thr954Met) rs374016016
NM_002691.3(POLD1):c.2864A>G (p.Gln955Arg) rs1555793307
NM_002691.3(POLD1):c.2864A>T (p.Gln955Leu) rs1555793307
NM_002691.3(POLD1):c.2888C>T (p.Ala963Val) rs754416243
NM_002691.3(POLD1):c.2892G>C (p.Lys964Asn) rs956916335
NM_002691.3(POLD1):c.2900T>C (p.Leu967Pro)
NM_002691.3(POLD1):c.2900T>G (p.Leu967Arg) rs367920933
NM_002691.3(POLD1):c.2902C>G (p.Arg968Gly) rs878854545
NM_002691.3(POLD1):c.2910C>G (p.Phe970Leu) rs757740787
NM_002691.3(POLD1):c.2911G>A (p.Glu971Lys)
NM_002691.3(POLD1):c.2911G>T (p.Glu971Ter) rs897259743
NM_002691.3(POLD1):c.2916delC (p.Ile973Serfs) rs1555793339
NM_002691.3(POLD1):c.2925C>T (p.Gly975=) rs376743216
NM_002691.3(POLD1):c.2926G>A (p.Glu976Lys) rs750457028
NM_002691.3(POLD1):c.2927A>T (p.Glu976Val) rs1431752851
NM_002691.3(POLD1):c.2929G>A (p.Gly977Ser) rs1064794933
NM_002691.3(POLD1):c.2932C>T (p.Arg978Cys) rs758407212
NM_002691.3(POLD1):c.2932_2934delCGT (p.Arg978del)
NM_002691.3(POLD1):c.2933G>A (p.Arg978His) rs371628260
NM_002691.3(POLD1):c.2933G>C (p.Arg978Pro)
NM_002691.3(POLD1):c.2938G>A (p.Glu980Lys) rs373389672
NM_002691.3(POLD1):c.2938_2948dup (p.Leu984Argfs) rs1555793355
NM_002691.3(POLD1):c.2941G>T (p.Ala981Ser) rs878854546
NM_002691.3(POLD1):c.294G>T (p.Gln98His) rs1219450171
NM_002691.3(POLD1):c.2951T>C (p.Leu984Pro)
NM_002691.3(POLD1):c.2953+1G>A rs1555793361
NM_002691.3(POLD1):c.2953+4C>T rs1057521166
NM_002691.3(POLD1):c.2953+5G>A rs748082614
NM_002691.3(POLD1):c.2953+6G>T
NM_002691.3(POLD1):c.2953C>G (p.Arg985Gly)
NM_002691.3(POLD1):c.2953C>T (p.Arg985Trp) rs780926432
NM_002691.3(POLD1):c.2954-2A>C
NM_002691.3(POLD1):c.2954-2del rs1555793399
NM_002691.3(POLD1):c.2954-7C>A
NM_002691.3(POLD1):c.2954G>A (p.Arg985Gln) rs749159160
NM_002691.3(POLD1):c.2954G>C (p.Arg985Pro) rs749159160
NM_002691.3(POLD1):c.2959G>A (p.Asp987Asn) rs985679759
NM_002691.3(POLD1):c.2959G>T (p.Asp987Tyr) rs985679759
NM_002691.3(POLD1):c.2960dup (p.Asp987Glufs) rs1555793420
NM_002691.3(POLD1):c.2966C>T (p.Thr989Met) rs866317622
NM_002691.3(POLD1):c.2968C>T (p.Arg990Cys) rs1410415830
NM_002691.3(POLD1):c.2969G>A (p.Arg990His) rs771789997
NM_002691.3(POLD1):c.2972G>A (p.Cys991Tyr) rs775264944
NM_002691.3(POLD1):c.2973C>G (p.Cys991Trp) rs944183404
NM_002691.3(POLD1):c.2978C>T (p.Thr993Met) rs762280958
NM_002691.3(POLD1):c.2979_2980insCAGCTCACGGGCAAG (p.Thr993_Val994insGlnLeuThrGlyLys) rs1064795402
NM_002691.3(POLD1):c.2983C>T (p.Leu995Phe) rs773795511
NM_002691.3(POLD1):c.2987C>T (p.Thr996Met) rs918661445
NM_002691.3(POLD1):c.2989G>A (p.Gly997Ser) rs368319533
NM_002691.3(POLD1):c.2994G>C (p.Lys998Asn) rs878854549
NM_002691.3(POLD1):c.3010G>A (p.Ala1004Thr) rs767795037
NM_002691.3(POLD1):c.3016G>A (p.Ala1006Thr) rs376197467
NM_002691.3(POLD1):c.301A>T (p.Ile101Phe) rs140858857
NM_002691.3(POLD1):c.3022C>T (p.Arg1008Cys) rs1044937882
NM_002691.3(POLD1):c.3023G>A (p.Arg1008His) rs763747258
NM_002691.3(POLD1):c.3025C>T (p.Arg1009Cys) rs753844112
NM_002691.3(POLD1):c.3026G>A (p.Arg1009His) rs757190258
NM_002691.3(POLD1):c.3027C>T (p.Arg1009=)
NM_002691.3(POLD1):c.3038T>C (p.Ile1013Thr) rs368439344
NM_002691.3(POLD1):c.3046C>T (p.Arg1016Cys) rs371667262
NM_002691.3(POLD1):c.3047G>A (p.Arg1016His)
NM_002691.3(POLD1):c.304G>A (p.Asp102Asn)
NM_002691.3(POLD1):c.3050C>T (p.Thr1017Ile) rs1555793499
NM_002691.3(POLD1):c.3052G>A (p.Val1018Met)
NM_002691.3(POLD1):c.3054G>A (p.Val1018=) rs369613619
NM_002691.3(POLD1):c.3059G>A (p.Ser1020Asn) rs1060501819
NM_002691.3(POLD1):c.3062A>C (p.His1021Pro) rs892295785
NM_002691.3(POLD1):c.3067+6C>T rs1057522005
NM_002691.3(POLD1):c.3068-3C>T rs1555793559
NM_002691.3(POLD1):c.3068-5C>T rs759650325
NM_002691.3(POLD1):c.3068-6C>G
NM_002691.3(POLD1):c.3073G>A (p.Val1025Met) rs1060501858
NM_002691.3(POLD1):c.3073G>C (p.Val1025Leu)
NM_002691.3(POLD1):c.307C>T (p.His103Tyr)
NM_002691.3(POLD1):c.3094C>T (p.Arg1032Trp) rs760766848
NM_002691.3(POLD1):c.3095G>A (p.Arg1032Gln) rs763951036
NM_002691.3(POLD1):c.3095G>T (p.Arg1032Leu) rs763951036
NM_002691.3(POLD1):c.3097G>T (p.Glu1033Ter) rs1276328747
NM_002691.3(POLD1):c.3103G>C (p.Glu1035Gln) rs879254134
NM_002691.3(POLD1):c.3115_3117delAAG (p.Lys1039del) rs1555793593
NM_002691.3(POLD1):c.3118G>A (p.Glu1040Lys) rs1057524200
NM_002691.3(POLD1):c.311A>C (p.Tyr104Ser)
NM_002691.3(POLD1):c.311A>T (p.Tyr104Phe) rs968051129
NM_002691.3(POLD1):c.3120+6_3120+21del16 rs1064792944
NM_002691.3(POLD1):c.3120+9G>T rs1060501802
NM_002691.3(POLD1):c.3121-10C>A rs1555793629
NM_002691.3(POLD1):c.3121-2A>G
NM_002691.3(POLD1):c.3121-8G>A rs762920108
NM_002691.3(POLD1):c.3121-9C>A rs149742605
NM_002691.3(POLD1):c.3129T>A (p.His1043Gln)
NM_002691.3(POLD1):c.3136G>T (p.Ala1046Ser) rs751088347
NM_002691.3(POLD1):c.3140T>C (p.Leu1047Pro)
NM_002691.3(POLD1):c.3148C>T (p.Arg1050Cys) rs780749621
NM_002691.3(POLD1):c.3149G>A (p.Arg1050His) rs1060501824
NM_002691.3(POLD1):c.3157C>T (p.Arg1053Cys) rs779208942
NM_002691.3(POLD1):c.3160C>T (p.Leu1054Phe)
NM_002691.3(POLD1):c.3167C>T (p.Thr1056Met) rs772397517
NM_002691.3(POLD1):c.317-2A>G rs761230747
NM_002691.3(POLD1):c.317-5C>T rs768082423
NM_002691.3(POLD1):c.3170A>G (p.Gln1057Arg) rs768747132
NM_002691.3(POLD1):c.3171G>T (p.Gln1057His) rs1060501848
NM_002691.3(POLD1):c.3175C>T (p.Gln1059Ter)
NM_002691.3(POLD1):c.3179G>A (p.Arg1060His) rs762090110
NM_002691.3(POLD1):c.3182G>T (p.Cys1061Phe) rs1555793669
NM_002691.3(POLD1):c.3197A>G (p.His1066Arg) rs762828545
NM_002691.3(POLD1):c.3203A>G (p.Asp1068Gly) rs1060501805
NM_002691.3(POLD1):c.3203_3218+1delACGTCATCTGCACCAGG
NM_002691.3(POLD1):c.3204C>T (p.Asp1068=) rs759019419
NM_002691.3(POLD1):c.3205G>A (p.Val1069Ile) rs1180107064
NM_002691.3(POLD1):c.3208A>T (p.Ile1070Phe) rs1060501801
NM_002691.3(POLD1):c.3217A>G (p.Ser1073Gly)
NM_002691.3(POLD1):c.3218+1G>A rs1484837283
NM_002691.3(POLD1):c.3218+2T>C
NM_002691.3(POLD1):c.3218+3G>A rs755695606
NM_002691.3(POLD1):c.3218+5G>A rs569395274
NM_002691.3(POLD1):c.3219-19C>A rs374168125
NM_002691.3(POLD1):c.3219-5C>T rs748304578
NM_002691.3(POLD1):c.3221G>A (p.Arg1074Gln) rs541931950
NM_002691.3(POLD1):c.3229C>A (p.Pro1077Thr) rs1060501830
NM_002691.3(POLD1):c.3231C>T (p.Pro1077=) rs770660636
NM_002691.3(POLD1):c.3232A>G (p.Ile1078Val) rs1060501852
NM_002691.3(POLD1):c.3237C>A (p.Phe1079Leu)
NM_002691.3(POLD1):c.323C>T (p.Ala108Val) rs577686721
NM_002691.3(POLD1):c.3241A>G (p.Met1081Val) rs1555793868
NM_002691.3(POLD1):c.3242T>A (p.Met1081Lys) rs774127655
NM_002691.3(POLD1):c.3243_3245delGCGinsTGT (p.Met1081_Arg1082delinsIleVal) rs1555793871
NM_002691.3(POLD1):c.3244C>T (p.Arg1082Cys) rs1307047144
NM_002691.3(POLD1):c.3247A>C (p.Lys1083Gln) rs200284426
NM_002691.3(POLD1):c.3256C>T (p.Arg1086Trp) rs963136799
NM_002691.3(POLD1):c.3257G>A (p.Arg1086Gln) rs3219457
NM_002691.3(POLD1):c.3257G>T (p.Arg1086Leu)
NM_002691.3(POLD1):c.3258G>C (p.Arg1086=) rs776167760
NM_002691.3(POLD1):c.325C>G (p.Gln109Glu)
NM_002691.3(POLD1):c.3262G>A (p.Asp1088Asn) rs1555793878
NM_002691.3(POLD1):c.3265C>G (p.Leu1089Val) rs1555793883
NM_002691.3(POLD1):c.3271G>A (p.Asp1091Asn) rs946088822
NM_002691.3(POLD1):c.3277G>A (p.Glu1093Lys) rs878854551
NM_002691.3(POLD1):c.327G>C (p.Gln109His) rs750260438
NM_002691.3(POLD1):c.3289C>T (p.Arg1097Trp) rs755297873
NM_002691.3(POLD1):c.328C>T (p.Pro110Ser) rs531059492
NM_002691.3(POLD1):c.3290G>A (p.Arg1097Gln) rs375328523
NM_002691.3(POLD1):c.3292C>T (p.Arg1098Cys)
NM_002691.3(POLD1):c.3293G>A (p.Arg1098His) rs878854552
NM_002691.3(POLD1):c.3293G>T (p.Arg1098Leu) rs878854552
NM_002691.3(POLD1):c.3295T>C (p.Phe1099Leu) rs756287064
NM_002691.3(POLD1):c.3298G>A (p.Gly1100Arg) rs1060501837
NM_002691.3(POLD1):c.3300_3301delACinsG (p.Pro1102Leufs) rs1555793930
NM_002691.3(POLD1):c.3301C>T (p.Pro1101Ser) rs142223599
NM_002691.3(POLD1):c.3302C>A (p.Pro1101His) rs895709341
NM_002691.3(POLD1):c.3305delC (p.Pro1102Leufs) rs761614971
NM_002691.3(POLD1):c.3308G>A (p.Gly1103Glu) rs1415038504
NM_002691.3(POLD1):c.3314A>G (p.Glu1105Gly) rs1256482040
NM_002691.3(POLD1):c.3316G>A (p.Ala1106Thr) rs778990190
NM_002691.3(POLD1):c.3317C>T (p.Ala1106Val) rs1555793944
NM_002691.3(POLD1):c.3321G>C (p.Trp1107Cys) rs745737815
NM_002691.3(POLD1):c.332T>C (p.Val111Ala) rs1060501800
NM_002691.3(POLD1):c.334C>T (p.Pro112Ser) rs878854553
NM_002691.3(POLD1):c.337G>A (p.Gly113Arg)
NM_002691.3(POLD1):c.338_370delGGGGGCCCCCACCATCCCGCGGCTCCGTGCCTG (p.Gly113_Pro123del) rs1555789763
NM_002691.3(POLD1):c.343C>T (p.Pro115Ser) rs754917939
NM_002691.3(POLD1):c.34G>A (p.Gly12Arg) rs772197667
NM_002691.3(POLD1):c.353C>T (p.Ser118Phe) rs780604625
NM_002691.3(POLD1):c.355C>T (p.Arg119Cys) rs747614571
NM_002691.3(POLD1):c.358G>A (p.Gly120Ser) rs746234949
NM_002691.3(POLD1):c.358G>C (p.Gly120Arg) rs746234949
NM_002691.3(POLD1):c.363C>A (p.Ser121=) rs772384393
NM_002691.3(POLD1):c.364G>A (p.Val122Met)
NM_002691.3(POLD1):c.367C>T (p.Pro123Ser) rs761127022
NM_002691.3(POLD1):c.371T>C (p.Val124Ala) rs199993010
NM_002691.3(POLD1):c.373C>G (p.Leu125Val) rs1060501827
NM_002691.3(POLD1):c.376C>T (p.Arg126Cys) rs864622753
NM_002691.3(POLD1):c.377G>A (p.Arg126His)
NM_002691.3(POLD1):c.379G>T (p.Ala127Ser) rs372299975
NM_002691.3(POLD1):c.37G>A (p.Val13Met) rs760884573
NM_002691.3(POLD1):c.37G>T (p.Val13Leu) rs760884573
NM_002691.3(POLD1):c.393C>A (p.Thr131=) rs532523142
NM_002691.3(POLD1):c.394G>A (p.Asp132Asn) rs781132734
NM_002691.3(POLD1):c.395A>G (p.Asp132Gly) rs1555789791
NM_002691.3(POLD1):c.399G>A (p.Glu133=) rs757940686
NM_002691.3(POLD1):c.405_406delCTinsTC (p.Ser136Pro) rs1555789793
NM_002691.3(POLD1):c.426C>G (p.His142Gln) rs201187429
NM_002691.3(POLD1):c.427G>A (p.Gly143Ser) rs377088357
NM_002691.3(POLD1):c.429C>T (p.Gly143=) rs372244044
NM_002691.3(POLD1):c.439T>G (p.Tyr147Asp)
NM_002691.3(POLD1):c.449C>T (p.Thr150Ile) rs1555789803
NM_002691.3(POLD1):c.454G>C (p.Ala152Pro) rs1555789809
NM_002691.3(POLD1):c.455C>T (p.Ala152Val) rs41563714
NM_002691.3(POLD1):c.457C>T (p.Pro153Ser) rs1555789811
NM_002691.3(POLD1):c.458C>T (p.Pro153Leu) rs1555789813
NM_002691.3(POLD1):c.463+6T>G rs759315897
NM_002691.3(POLD1):c.464-5_466del rs1060501803
NM_002691.3(POLD1):c.464G>C (p.Gly155Ala) rs553279670
NM_002691.3(POLD1):c.469G>A (p.Gly157Arg) rs774568050
NM_002691.3(POLD1):c.470G>A (p.Gly157Glu)
NM_002691.3(POLD1):c.471delG (p.Glu159Serfs) rs764964017
NM_002691.3(POLD1):c.472C>T (p.Pro158Ser)
NM_002691.3(POLD1):c.475G>A (p.Glu159Lys) rs969950434
NM_002691.3(POLD1):c.481A>T (p.Met161Leu) rs763969133
NM_002691.3(POLD1):c.485G>T (p.Gly162Val) rs1060501844
NM_002691.3(POLD1):c.493C>T (p.Gln165Ter) rs1555789891
NM_002691.3(POLD1):c.495A>G (p.Gln165=) rs756717437
NM_002691.3(POLD1):c.496C>T (p.Arg166Trp) rs376236497
NM_002691.3(POLD1):c.497G>A (p.Arg166Gln) rs750144413
NM_002691.3(POLD1):c.49C>T (p.Arg17Trp) rs570461545
NM_002691.3(POLD1):c.501_524delGCTGAACTTGGCCATCAGCCGGGA (p.Glu167_Arg174del) rs1555789893
NM_002691.3(POLD1):c.50G>A (p.Arg17Gln) rs373637566
NM_002691.3(POLD1):c.50G>T (p.Arg17Leu) rs373637566
NM_002691.3(POLD1):c.511G>T (p.Ala171Ser) rs748486492
NM_002691.3(POLD1):c.519C>G (p.Ser173Arg) rs1555789901
NM_002691.3(POLD1):c.520C>T (p.Arg174Trp) rs749334182
NM_002691.3(POLD1):c.521G>A (p.Arg174Gln) rs141976385
NM_002691.3(POLD1):c.525C>T (p.Asp175=) rs775285603
NM_002691.3(POLD1):c.529C>T (p.Arg177Cys) rs760402496
NM_002691.3(POLD1):c.52G>A (p.Ala18Thr)
NM_002691.3(POLD1):c.530G>A (p.Arg177His) rs3218750
NM_002691.3(POLD1):c.532G>A (p.Gly178Arg) rs140707092
NM_002691.3(POLD1):c.532G>C (p.Gly178Arg) rs140707092
NM_002691.3(POLD1):c.532G>T (p.Gly178Trp) rs140707092
NM_002691.3(POLD1):c.534G>T (p.Gly178=) rs376129517
NM_002691.3(POLD1):c.536G>A (p.Gly179Glu) rs1060501831
NM_002691.3(POLD1):c.537G>T (p.Gly179=)
NM_002691.3(POLD1):c.53_61delCCCGTGGGG (p.Ala18_Gly20del) rs1555789043
NM_002691.3(POLD1):c.541G>T (p.Glu181Ter) rs1060501833
NM_002691.3(POLD1):c.544C>A (p.Leu182Met) rs757683193
NM_002691.3(POLD1):c.554C>T (p.Pro185Leu) rs370292497
NM_002691.3(POLD1):c.559G>A (p.Val187Met) rs775620863
NM_002691.3(POLD1):c.55C>T (p.Arg19Cys) rs368033860
NM_002691.3(POLD1):c.563T>G (p.Leu188Arg) rs768494581
NM_002691.3(POLD1):c.565G>T (p.Ala189Ser) rs761846026
NM_002691.3(POLD1):c.566C>T (p.Ala189Val) rs1555789928
NM_002691.3(POLD1):c.568G>A (p.Val190Met) rs1274728448
NM_002691.3(POLD1):c.575T>G (p.Leu192Arg) rs772804822
NM_002691.3(POLD1):c.581C>G (p.Ser194Cys) rs144656348
NM_002691.3(POLD1):c.583C>T (p.Arg195Ter) rs377690809
NM_002691.3(POLD1):c.584G>A (p.Arg195Gln) rs1555789938
NM_002691.3(POLD1):c.589A>C (p.Ser197Arg) rs1040524947
NM_002691.3(POLD1):c.589_589+1delAG rs1060501829
NM_002691.3(POLD1):c.590G>A (p.Ser197Asn) rs780144670
NM_002691.3(POLD1):c.594G>A (p.Met198Ile)
NM_002691.3(POLD1):c.59G>A (p.Gly20Glu) rs778329225
NM_002691.3(POLD1):c.601T>C (p.Tyr201His) rs878854555
NM_002691.3(POLD1):c.606C>A (p.His202Gln) rs200405635
NM_002691.3(POLD1):c.607G>A (p.Gly203Arg) rs369896998
NM_002691.3(POLD1):c.608G>A (p.Gly203Glu)
NM_002691.3(POLD1):c.611A>T (p.His204Leu)
NM_002691.3(POLD1):c.613G>A (p.Gly205Ser) rs914238978
NM_002691.3(POLD1):c.615C>G (p.Gly205=)
NM_002691.3(POLD1):c.61G>T (p.Gly21Cys) rs9282831
NM_002691.3(POLD1):c.623C>T (p.Pro208Leu) rs774030917
NM_002691.3(POLD1):c.62G>T (p.Gly21Val) rs771371900
NM_002691.3(POLD1):c.631C>T (p.Arg211Cys) rs200679966
NM_002691.3(POLD1):c.632G>A (p.Arg211His) rs373192520
NM_002691.3(POLD1):c.637A>G (p.Thr213Ala) rs750753334
NM_002691.3(POLD1):c.639C>T (p.Thr213=) rs139949679
NM_002691.3(POLD1):c.640G>A (p.Val214Met) rs1200514497
NM_002691.3(POLD1):c.649C>G (p.Pro217Ala) rs1060501817
NM_002691.3(POLD1):c.649_666dup18 (p.Pro222_Ala223insProArgLeuValAlaPro) rs1064792946
NM_002691.3(POLD1):c.64C>T (p.Leu22Phe) rs779418268
NM_002691.3(POLD1):c.650C>T (p.Pro217Leu) rs1408031137
NM_002691.3(POLD1):c.652C>T (p.Arg218Cys)
NM_002691.3(POLD1):c.653G>A (p.Arg218His) rs150010804
NM_002691.3(POLD1):c.658G>A (p.Val220Met) rs749052483
NM_002691.3(POLD1):c.661G>C (p.Ala221Pro)
NM_002691.3(POLD1):c.661G>T (p.Ala221Ser) rs1023405690
NM_002691.3(POLD1):c.665C>T (p.Pro222Leu) rs368940099
NM_002691.3(POLD1):c.667G>A (p.Ala223Thr) rs1555790021
NM_002691.3(POLD1):c.670C>T (p.Arg224Cys) rs768253410
NM_002691.3(POLD1):c.671G>A (p.Arg224His) rs373001984
NM_002691.3(POLD1):c.673C>T (p.Arg225Cys) rs763249087
NM_002691.3(POLD1):c.674G>A (p.Arg225His) rs144979965
NM_002691.3(POLD1):c.685C>G (p.Gln229Glu) rs1555790033
NM_002691.3(POLD1):c.686A>G (p.Gln229Arg)
NM_002691.3(POLD1):c.694C>T (p.Arg232Cys) rs774789534
NM_002691.3(POLD1):c.695G>A (p.Arg232His)
NM_002691.3(POLD1):c.713C>T (p.Thr238Met) rs553342844
NM_002691.3(POLD1):c.721T>G (p.Phe241Val)
NM_002691.3(POLD1):c.724G>A (p.Ala242Thr) rs910905700
NM_002691.3(POLD1):c.725C>T (p.Ala242Val) rs753689379
NM_002691.3(POLD1):c.733G>A (p.Glu245Lys) rs878854556
NM_002691.3(POLD1):c.735G>A (p.Glu245=) rs745841154
NM_002691.3(POLD1):c.73G>A (p.Asp25Asn)
NM_002691.3(POLD1):c.742G>A (p.Val248Ile) rs538267691
NM_002691.3(POLD1):c.757C>T (p.Arg253Trp)
NM_002691.3(POLD1):c.758+4C>G rs771346692
NM_002691.3(POLD1):c.758+4C>T rs771346692
NM_002691.3(POLD1):c.758+5G>A rs760003191
NM_002691.3(POLD1):c.758G>A (p.Arg253Gln) rs1366413924
NM_002691.3(POLD1):c.75delT (p.Asp25Glufs) rs772855121
NM_002691.3(POLD1):c.774G>A (p.Thr258=) rs1057522351
NM_002691.3(POLD1):c.77A>G (p.Asp26Gly) rs760939854
NM_002691.3(POLD1):c.780C>G (p.Ile260Met)
NM_002691.3(POLD1):c.781G>A (p.Val261Ile) rs765448811
NM_002691.3(POLD1):c.781G>T (p.Val261Phe) rs765448811
NM_002691.3(POLD1):c.784G>A (p.Gly262Ser) rs571623032
NM_002691.3(POLD1):c.798G>A (p.Leu266=) rs1017934812
NM_002691.3(POLD1):c.801G>T (p.Glu267Asp) rs965047439
NM_002691.3(POLD1):c.80A>T (p.Asp27Val) rs150066950
NM_002691.3(POLD1):c.812G>A (p.Gly271Glu)
NM_002691.3(POLD1):c.819C>G (p.Tyr273Ter) rs777427540
NM_002691.3(POLD1):c.820G>A (p.Ala274Thr) rs878854557
NM_002691.3(POLD1):c.835_837delGAG (p.Glu279del) rs746341854
NM_002691.3(POLD1):c.836A>T (p.Glu279Val) rs1555790176
NM_002691.3(POLD1):c.83C>T (p.Ala28Val) rs765097158
NM_002691.3(POLD1):c.840+10T>C rs1555790184
NM_002691.3(POLD1):c.840+4C>G rs780257283
NM_002691.3(POLD1):c.841-10A>G rs140160345
NM_002691.3(POLD1):c.841-3C>T rs1397759553
NM_002691.3(POLD1):c.841-5C>T rs530091118
NM_002691.3(POLD1):c.845C>T (p.Thr282Met) rs756829126
NM_002691.3(POLD1):c.859G>A (p.Glu287Lys)
NM_002691.3(POLD1):c.85C>T (p.Pro29Ser) rs750303995
NM_002691.3(POLD1):c.862G>A (p.Ala288Thr) rs1060501857
NM_002691.3(POLD1):c.866A>G (p.Asp289Gly) rs878854558
NM_002691.3(POLD1):c.868G>A (p.Val290Met) rs748657880
NM_002691.3(POLD1):c.872T>C (p.Leu291Pro) rs199999050
NM_002691.3(POLD1):c.883G>A (p.Val295Met) rs199545019
NM_002691.3(POLD1):c.885_887delGGT (p.Val296del) rs1060501809
NM_002691.3(POLD1):c.887T>G (p.Val296Gly) rs774155133
NM_002691.3(POLD1):c.890G>T (p.Ser297Ile)
NM_002691.3(POLD1):c.895C>T (p.Pro299Ser) rs759271754
NM_002691.3(POLD1):c.898_899delCCinsTT (p.Pro300Leu) rs1060501821
NM_002691.3(POLD1):c.899C>T (p.Pro300Leu) rs775463372
NM_002691.3(POLD1):c.901delG (p.Glu301Lysfs) rs1555790257
NM_002691.3(POLD1):c.916C>T (p.Arg306Cys) rs755457889
NM_002691.3(POLD1):c.917G>A (p.Arg306His) rs781682472
NM_002691.3(POLD1):c.920T>C (p.Ile307Thr) rs1555790271
NM_002691.3(POLD1):c.923C>T (p.Ala308Val) rs1060501823
NM_002691.3(POLD1):c.930G>C (p.Leu310Phe) rs1290315327
NM_002691.3(POLD1):c.931C>A (p.Arg311Ser) rs201010746
NM_002691.3(POLD1):c.931C>T (p.Arg311Cys) rs201010746
NM_002691.3(POLD1):c.932G>A (p.Arg311His) rs777944185
NM_002691.3(POLD1):c.934G>A (p.Val312Met) rs371612922
NM_002691.3(POLD1):c.940A>G (p.Ser314Gly) rs1254476274
NM_002691.3(POLD1):c.946G>A (p.Asp316Asn) rs746087148
NM_002691.3(POLD1):c.947A>G (p.Asp316Gly) rs1555790301
NM_002691.3(POLD1):c.952G>A (p.Glu318Lys) rs775232133
NM_002691.3(POLD1):c.953A>C (p.Glu318Ala) rs1555790304
NM_002691.3(POLD1):c.953A>G (p.Glu318Gly) rs1555790304
NM_002691.3(POLD1):c.958G>A (p.Ala320Thr) rs1488821062
NM_002691.3(POLD1):c.95C>T (p.Ser32Phe)
NM_002691.3(POLD1):c.961G>A (p.Gly321Ser) rs41554817
NM_002691.3(POLD1):c.962delG (p.Gly321Alafs)
NM_002691.3(POLD1):c.964C>G (p.Arg322Gly)
NM_002691.3(POLD1):c.964C>T (p.Arg322Cys) rs750155990
NM_002691.3(POLD1):c.965G>A (p.Arg322His) rs980303681
NM_002691.3(POLD1):c.965G>T (p.Arg322Leu) rs980303681
NM_002691.3(POLD1):c.968A>G (p.Lys323Arg) rs1060501828
NM_002691.3(POLD1):c.970+1G>A rs1337231648
NM_002691.3(POLD1):c.970G>T (p.Gly324Cys) rs1160832458
NM_002691.3(POLD1):c.971-4G>T rs200144991
NM_002691.3(POLD1):c.971-4dup rs1555790379
NM_002691.3(POLD1):c.971-5C>T rs778993986
NM_002691.3(POLD1):c.973A>G (p.Ile325Val) rs558345043
NM_002691.3(POLD1):c.985C>T (p.Pro329Ser)
NM_002691.3(POLD1):c.988G>T (p.Glu330Ter) rs1060501813
NM_002691.3(POLD1):c.989A>G (p.Glu330Gly)
NM_002691.3(POLD1):c.991C>T (p.Arg331Trp) rs370734242
NM_002691.3(POLD1):c.992G>A (p.Arg331Gln) rs371120096
NM_002691.3(POLD1):c.992G>C (p.Arg331Pro) rs371120096
NM_002691.3(POLD1):c.99A>G (p.Gln33=) rs751090809
NM_002691.3(POLD1):c.9C>T (p.Gly3=) rs1060501826

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.