ClinVar Miner

List of variants in gene POLE reported as uncertain significance for Colorectal cancer, susceptibility to, 12

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 1771
Download table as spreadsheet
HGVS dbSNP
NC_000012.11:g.(?_133201273)_(133202913_?)del
NC_000012.11:g.(?_133201273)_(133263911_?)dup
NC_000012.11:g.(?_133201277)_(133263907_?)dup
NC_000012.11:g.(?_133208891)_(133209391_?)del
NC_000012.11:g.(?_133208895)_(133212616_?)del
NC_000012.11:g.(?_133210817)_(133211013_?)dup
NC_000012.11:g.(?_133225505)_(133226485_?)del
NC_000012.11:g.(?_133225509)_(133256814_?)dup
NC_000012.11:g.(?_133233712)_(133263911_?)del
NC_000012.11:g.(?_133233722)_(133263945_?)dup
NC_000012.11:g.(?_133237545)_(133237760_?)del
NC_000012.11:g.(?_133237549)_(133263907_?)dup
NC_000012.11:g.(?_133240580)_(133263911_?)dup
NC_000012.11:g.(?_133248791)_(133257875_?)del
NC_000012.11:g.(?_133252670)_(133254315_?)del
NC_000012.11:g.(?_133263830)_(133263911_?)del
NC_000012.11:g.(?_133263830)_(133263911_?)dup
NC_000012.11:g.(?_133263834)_(133263907_?)del
NM_006231.3(POLE):c.1012C>A (p.Pro338Thr) rs1565976008
NM_006231.3(POLE):c.1016A>T (p.Asp339Val) rs1060500865
NM_006231.3(POLE):c.101G>T (p.Arg34Leu) rs747005851
NM_006231.3(POLE):c.1020+1G>T rs1064794748
NM_006231.3(POLE):c.1021-1G>C
NM_006231.3(POLE):c.1021-26_1045delinsGTTCTACACC rs1555229232
NM_006231.3(POLE):c.1021G>C (p.Ala341Pro) rs137860861
NM_006231.3(POLE):c.1036A>G (p.Arg346Gly) rs1565975682
NM_006231.3(POLE):c.1037G>A (p.Arg346Lys) rs1565975676
NM_006231.3(POLE):c.1051G>A (p.Val351Ile) rs759414746
NM_006231.3(POLE):c.1051G>T (p.Val351Phe) rs759414746
NM_006231.3(POLE):c.1055A>C (p.Gln352Pro) rs766094330
NM_006231.3(POLE):c.1059G>C (p.Glu353Asp)
NM_006231.3(POLE):c.1064A>G (p.Lys355Arg) rs141396559
NM_006231.3(POLE):c.1067C>T (p.Pro356Leu)
NM_006231.3(POLE):c.1069A>G (p.Thr357Ala)
NM_006231.3(POLE):c.106G>C (p.Glu36Gln) rs370268888
NM_006231.3(POLE):c.1073T>C (p.Ile358Thr)
NM_006231.3(POLE):c.1081A>C (p.Thr361Pro) rs201315364
NM_006231.3(POLE):c.1082_1086dup (p.Asn363fs) rs878854838
NM_006231.3(POLE):c.109C>T (p.Arg37Trp) rs753101641
NM_006231.3(POLE):c.10A>G (p.Arg4Gly) rs1010746038
NM_006231.3(POLE):c.1106+2T>G
NM_006231.3(POLE):c.1107-2A>G rs1565975328
NM_006231.3(POLE):c.1107-3C>T rs369572563
NM_006231.3(POLE):c.1107-6A>G rs1565975340
NM_006231.3(POLE):c.1108C>A (p.Pro370Thr) rs576578672
NM_006231.3(POLE):c.110G>A (p.Arg37Gln)
NM_006231.3(POLE):c.1111T>C (p.Phe371Leu) rs1565975308
NM_006231.3(POLE):c.1120G>A (p.Ala374Thr)
NM_006231.3(POLE):c.1123C>G (p.Arg375Gly) rs556789278
NM_006231.3(POLE):c.1123C>T (p.Arg375Trp)
NM_006231.3(POLE):c.1124G>A (p.Arg375Gln) rs778572159
NM_006231.3(POLE):c.1127C>A (p.Ala376Glu)
NM_006231.3(POLE):c.1129G>A (p.Ala377Thr) rs754508108
NM_006231.3(POLE):c.112A>T (p.Ser38Cys) rs879254247
NM_006231.3(POLE):c.1138G>A (p.Gly380Ser) rs199746481
NM_006231.3(POLE):c.1138G>C (p.Gly380Arg) rs199746481
NM_006231.3(POLE):c.1138G>T (p.Gly380Cys) rs199746481
NM_006231.3(POLE):c.113G>A (p.Ser38Asn) rs141424313
NM_006231.3(POLE):c.1147A>G (p.Met383Val) rs879254238
NM_006231.3(POLE):c.1148T>C (p.Met383Thr) rs1060500787
NM_006231.3(POLE):c.1151A>G (p.Gln384Arg) rs1565975180
NM_006231.3(POLE):c.1156G>A (p.Glu386Lys) rs893340262
NM_006231.3(POLE):c.1160T>C (p.Ile387Thr) rs1060500833
NM_006231.3(POLE):c.1166T>A (p.Phe389Tyr) rs1565975150
NM_006231.3(POLE):c.1171_1173del (p.Lys391del) rs753999122
NM_006231.3(POLE):c.1175A>G (p.Asp392Gly) rs878854840
NM_006231.3(POLE):c.1176C>G (p.Asp392Glu) rs752873913
NM_006231.3(POLE):c.1181del (p.Gln394fs) rs764289504
NM_006231.3(POLE):c.1183G>A (p.Gly395Arg)
NM_006231.3(POLE):c.1184G>A (p.Gly395Glu) rs546499094
NM_006231.3(POLE):c.1184G>T (p.Gly395Val)
NM_006231.3(POLE):c.1191C>G (p.Tyr397Ter) rs1208085896
NM_006231.3(POLE):c.1193A>G (p.Lys398Arg) rs1402549512
NM_006231.3(POLE):c.1196C>T (p.Ala399Val) rs1060500853
NM_006231.3(POLE):c.119G>A (p.Trp40Ter) rs1565981653
NM_006231.3(POLE):c.1203G>C (p.Gln401His) rs1060500810
NM_006231.3(POLE):c.1211A>G (p.His404Arg) rs1565975006
NM_006231.3(POLE):c.1213A>G (p.Met405Val)
NM_006231.3(POLE):c.1214T>G (p.Met405Arg)
NM_006231.3(POLE):c.1215G>C (p.Met405Ile) rs1060500847
NM_006231.3(POLE):c.1222C>G (p.Leu408Val)
NM_006231.3(POLE):c.1226+2_1226+5delTAGG
NM_006231.3(POLE):c.1226+6G>A
NM_006231.3(POLE):c.1227-2A>T rs1057517609
NM_006231.3(POLE):c.1228T>C (p.Trp410Arg)
NM_006231.3(POLE):c.122C>T (p.Thr41Met) rs148269473
NM_006231.3(POLE):c.1232T>C (p.Val411Ala) rs1031999052
NM_006231.3(POLE):c.1252C>A (p.Pro418Thr) rs1555228651
NM_006231.3(POLE):c.1257G>A (p.Val419=) rs1565973352
NM_006231.3(POLE):c.125A>C (p.Asp42Ala)
NM_006231.3(POLE):c.125A>T (p.Asp42Val) rs749886101
NM_006231.3(POLE):c.1264C>G (p.His422Asp) rs745356467
NM_006231.3(POLE):c.1264C>T (p.His422Tyr) rs745356467
NM_006231.3(POLE):c.1274A>G (p.Lys425Arg) rs757186755
NM_006231.3(POLE):c.1280C>T (p.Ala427Val) rs878854841
NM_006231.3(POLE):c.1282G>A (p.Ala428Thr) rs150032060
NM_006231.3(POLE):c.1284del (p.Lys429fs) rs1057517613
NM_006231.3(POLE):c.1291_1311dup (p.Lys431_Val437dup)
NM_006231.3(POLE):c.1294C>G (p.Leu432Val) rs750475909
NM_006231.3(POLE):c.1297G>A (p.Gly433Ser) rs1190891892
NM_006231.3(POLE):c.1297G>T (p.Gly433Cys) rs1190891892
NM_006231.3(POLE):c.1298G>A (p.Gly433Asp) rs1465684132
NM_006231.3(POLE):c.1298G>T (p.Gly433Val)
NM_006231.3(POLE):c.1306C>A (p.Pro436Thr) rs1565973210
NM_006231.3(POLE):c.1307C>G (p.Pro436Arg) rs864622766
NM_006231.3(POLE):c.1309G>A (p.Val437Met) rs115047349
NM_006231.3(POLE):c.1309G>T (p.Val437Leu)
NM_006231.3(POLE):c.1320C>G (p.Asp440Glu) rs763350226
NM_006231.3(POLE):c.1322C>T (p.Pro441Leu) rs775340163
NM_006231.3(POLE):c.1328A>G (p.Asp443Gly) rs1555228601
NM_006231.3(POLE):c.1330A>G (p.Met444Val)
NM_006231.3(POLE):c.1336C>T (p.Arg446Trp) rs200403177
NM_006231.3(POLE):c.1337G>A (p.Arg446Gln) rs151273553
NM_006231.3(POLE):c.1339A>C (p.Met447Leu) rs376095661
NM_006231.3(POLE):c.1339A>G (p.Met447Val) rs376095661
NM_006231.3(POLE):c.1341G>A (p.Met447Ile) rs1565973097
NM_006231.3(POLE):c.1345A>G (p.Thr449Ala) rs747935432
NM_006231.3(POLE):c.1346C>T (p.Thr449Met) rs780299012
NM_006231.3(POLE):c.1349_1359delAGCAGCCCCAG rs1565973030
NM_006231.3(POLE):c.1351C>T (p.Gln451Ter)
NM_006231.3(POLE):c.1354C>A (p.Pro452Thr) rs1555228573
NM_006231.3(POLE):c.1357C>G (p.Gln453Glu) rs781360770
NM_006231.3(POLE):c.1359+2C>T
NM_006231.3(POLE):c.1359+4C>T rs752118019
NM_006231.3(POLE):c.1359+5G>A rs761564635
NM_006231.3(POLE):c.1359+6T>A rs1555228569
NM_006231.3(POLE):c.1360-6C>A
NM_006231.3(POLE):c.1361_1362CT[1] (p.Leu455fs) rs1347535436
NM_006231.3(POLE):c.1366G>C (p.Ala456Pro) rs1565972665
NM_006231.3(POLE):c.1370C>T (p.Thr457Met) rs878854842
NM_006231.3(POLE):c.1378G>A (p.Val460Met) rs753586583
NM_006231.3(POLE):c.1384G>A (p.Asp462Asn)
NM_006231.3(POLE):c.138del (p.Leu46fs) rs1555230420
NM_006231.3(POLE):c.1393G>A (p.Ala465Thr) rs771526654
NM_006231.3(POLE):c.1405C>G (p.Leu469Val) rs368303888
NM_006231.3(POLE):c.140G>A (p.Arg47Gln) rs1161199196
NM_006231.3(POLE):c.1411A>G (p.Met471Val) rs749021187
NM_006231.3(POLE):c.1414A>G (p.Lys472Glu) rs1565972540
NM_006231.3(POLE):c.1420G>A (p.Val474Ile) rs980578884
NM_006231.3(POLE):c.1423C>A (p.His475Asn) rs952195021
NM_006231.3(POLE):c.1426C>T (p.Pro476Ser) rs1555228469
NM_006231.3(POLE):c.1447A>G (p.Thr483Ala) rs777736640
NM_006231.3(POLE):c.1447A>T (p.Thr483Ser) rs777736640
NM_006231.3(POLE):c.1453A>G (p.Ile485Val)
NM_006231.3(POLE):c.1455T>G (p.Ile485Met) rs878854843
NM_006231.3(POLE):c.1456C>T (p.Pro486Ser) rs1565972431
NM_006231.3(POLE):c.145G>A (p.Gly49Ser) rs1555230418
NM_006231.3(POLE):c.1462G>A (p.Glu488Lys) rs375615461
NM_006231.3(POLE):c.1467_1468del (p.Asp490fs) rs1060500792
NM_006231.3(POLE):c.1468G>A (p.Asp490Asn) rs755463796
NM_006231.3(POLE):c.1471G>A (p.Glu491Lys) rs776770625
NM_006231.3(POLE):c.1474-1G>C rs1565972026
NM_006231.3(POLE):c.1478del (p.Leu493fs) rs760070332
NM_006231.3(POLE):c.1480C>T (p.Arg494Trp) rs756829894
NM_006231.3(POLE):c.1487G>T (p.Gly496Val) rs1485752650
NM_006231.3(POLE):c.1489T>C (p.Ser497Pro) rs764069224
NM_006231.3(POLE):c.1492G>C (p.Gly498Arg)
NM_006231.3(POLE):c.1499T>C (p.Leu500Pro) rs775457973
NM_006231.3(POLE):c.1499_1500TG[2] (p.Cys501_Glu502delinsTer) rs762636894
NM_006231.3(POLE):c.1504G>C (p.Glu502Gln)
NM_006231.3(POLE):c.1516A>G (p.Met506Val) rs773634913
NM_006231.3(POLE):c.1520T>C (p.Val507Ala)
NM_006231.3(POLE):c.1523A>G (p.Gln508Arg)
NM_006231.3(POLE):c.1524G>T (p.Gln508His) rs762030811
NM_006231.3(POLE):c.1537A>G (p.Asn513Asp) rs200136603
NM_006231.3(POLE):c.1543A>G (p.Ile515Val) rs1060500815
NM_006231.3(POLE):c.154C>T (p.Arg52Trp) rs115452881
NM_006231.3(POLE):c.1550C>T (p.Pro517Leu) rs780556141
NM_006231.3(POLE):c.1553A>G (p.Asn518Ser)
NM_006231.3(POLE):c.1554C>A (p.Asn518Lys) rs1251796496
NM_006231.3(POLE):c.1559A>C (p.Gln520Pro)
NM_006231.3(POLE):c.1559A>G (p.Gln520Arg) rs780865223
NM_006231.3(POLE):c.1565A>G (p.Gln522Arg) rs1555228312
NM_006231.3(POLE):c.1567G>A (p.Glu523Lys) rs1275423655
NM_006231.3(POLE):c.1570T>G (p.Phe524Val)
NM_006231.3(POLE):c.1571T>A (p.Phe524Tyr)
NM_006231.3(POLE):c.1573A>C (p.Asn525His) rs751164982
NM_006231.3(POLE):c.1574A>G (p.Asn525Ser) rs74878897
NM_006231.3(POLE):c.1576A>G (p.Lys526Glu) rs1444399170
NM_006231.3(POLE):c.1581_1587GACGGAC[1] (p.Asp530fs) rs1555228293
NM_006231.3(POLE):c.1583C>T (p.Thr528Met) rs116263919
NM_006231.3(POLE):c.1586A>G (p.Asp529Gly) rs1565971720
NM_006231.3(POLE):c.1588G>A (p.Asp530Asn) rs753660907
NM_006231.3(POLE):c.1591G>A (p.Gly531Arg) rs748489355
NM_006231.3(POLE):c.1597G>A (p.Val533Met) rs374140892
NM_006231.3(POLE):c.15C>A (p.Ser5Arg) rs1361332747
NM_006231.3(POLE):c.1613C>T (p.Thr538Ile) rs1565971628
NM_006231.3(POLE):c.1614C>G (p.Thr538=)
NM_006231.3(POLE):c.1618G>A (p.Val540Ile) rs770307281
NM_006231.3(POLE):c.1621G>A (p.Gly541Arg) rs1555228286
NM_006231.3(POLE):c.1623_1633del (p.His543fs)
NM_006231.3(POLE):c.1625dup (p.His543fs) rs1565971583
NM_006231.3(POLE):c.1627C>T (p.His543Tyr) rs1555228285
NM_006231.3(POLE):c.1628A>C (p.His543Pro) rs1555228282
NM_006231.3(POLE):c.1639C>T (p.Leu547Phe) rs1327695331
NM_006231.3(POLE):c.1642G>A (p.Glu548Lys) rs908638591
NM_006231.3(POLE):c.1642G>T (p.Glu548Ter) rs908638591
NM_006231.3(POLE):c.1645T>C (p.Ser549Pro) rs115558715
NM_006231.3(POLE):c.1649G>A (p.Gly550Glu) rs1555228272
NM_006231.3(POLE):c.1657C>T (p.Arg553Cys) rs878854844
NM_006231.3(POLE):c.1663G>A (p.Asp555Asn) rs778763440
NM_006231.3(POLE):c.1673del (p.Cys558fs) rs1060500859
NM_006231.3(POLE):c.1676G>A (p.Arg559Gln) rs766276875
NM_006231.3(POLE):c.167C>T (p.Pro56Leu) rs1555230404
NM_006231.3(POLE):c.1684A>G (p.Met562Val)
NM_006231.3(POLE):c.1686+1G>C rs1555228250
NM_006231.3(POLE):c.1686+3G>A rs1060500868
NM_006231.3(POLE):c.1687-3T>G rs148115738
NM_006231.3(POLE):c.1691C>T (p.Pro564Leu)
NM_006231.3(POLE):c.1693G>C (p.Ala565Pro)
NM_006231.3(POLE):c.1693G>T (p.Ala565Ser)
NM_006231.3(POLE):c.1696G>A (p.Ala566Thr) rs773813430
NM_006231.3(POLE):c.1702G>A (p.Asp568Asn)
NM_006231.3(POLE):c.1704C>G (p.Asp568Glu)
NM_006231.3(POLE):c.1707C>G (p.Phe569Leu) rs147438050
NM_006231.3(POLE):c.1708C>A (p.Leu570Met) rs748807227
NM_006231.3(POLE):c.1715A>T (p.Gln572Leu) rs1555228139
NM_006231.3(POLE):c.1717C>G (p.Arg573Gly)
NM_006231.3(POLE):c.1717C>T (p.Arg573Trp) rs373000452
NM_006231.3(POLE):c.1718G>A (p.Arg573Gln)
NM_006231.3(POLE):c.1726A>G (p.Lys576Glu)
NM_006231.3(POLE):c.172G>A (p.Glu58Lys)
NM_006231.3(POLE):c.1735C>T (p.Arg579Cys) rs116260568
NM_006231.3(POLE):c.1736G>A (p.Arg579His) rs149296223
NM_006231.3(POLE):c.1738C>A (p.His580Asn) rs371149234
NM_006231.3(POLE):c.1741G>A (p.Ala581Thr) rs755090755
NM_006231.3(POLE):c.1741G>T (p.Ala581Ser)
NM_006231.3(POLE):c.1756G>A (p.Glu586Lys) rs878854845
NM_006231.3(POLE):c.1759A>C (p.Lys587Gln) rs1060500781
NM_006231.3(POLE):c.1759A>G (p.Lys587Glu)
NM_006231.3(POLE):c.1760A>G (p.Lys587Arg)
NM_006231.3(POLE):c.1769T>A (p.Val590Glu)
NM_006231.3(POLE):c.1772A>G (p.Glu591Gly) rs1555228119
NM_006231.3(POLE):c.177G>C (p.Lys59Asn) rs753360358
NM_006231.3(POLE):c.1780A>G (p.Thr594Ala) rs762067222
NM_006231.3(POLE):c.1783A>G (p.Asn595Asp)
NM_006231.3(POLE):c.1784A>G (p.Asn595Ser) rs969500436
NM_006231.3(POLE):c.1789G>A (p.Glu597Lys) rs768396766
NM_006231.3(POLE):c.1791A>C (p.Glu597Asp)
NM_006231.3(POLE):c.1794+4A>G rs1555228110
NM_006231.3(POLE):c.1794+4dup
NM_006231.3(POLE):c.1794+6C>T rs769389800
NM_006231.3(POLE):c.1794G>A (p.Glu598=) rs1379550837
NM_006231.3(POLE):c.1795-6C>G rs1555227428
NM_006231.3(POLE):c.1795G>A (p.Val599Met) rs1555227427
NM_006231.3(POLE):c.1798T>A (p.Cys600Ser) rs1555227426
NM_006231.3(POLE):c.1799G>A (p.Cys600Tyr) rs1565966836
NM_006231.3(POLE):c.17G>A (p.Gly6Asp) rs772972882
NM_006231.3(POLE):c.1806G>C (p.Glu602Asp)
NM_006231.3(POLE):c.1836C>G (p.Asp612Glu)
NM_006231.3(POLE):c.1836dup (p.Val613fs) rs1555227419
NM_006231.3(POLE):c.1837G>A (p.Val613Ile) rs200471266
NM_006231.3(POLE):c.1843A>G (p.Ser615Gly)
NM_006231.3(POLE):c.1846C>T (p.Arg616Cys) rs752076074
NM_006231.3(POLE):c.1847G>A (p.Arg616His) rs764558974
NM_006231.3(POLE):c.1847G>T (p.Arg616Leu)
NM_006231.3(POLE):c.1852G>A (p.Glu618Lys)
NM_006231.3(POLE):c.1855T>C (p.Cys619Arg) rs758779896
NM_006231.3(POLE):c.1856G>A (p.Cys619Tyr) rs752456199
NM_006231.3(POLE):c.1858C>G (p.Pro620Ala)
NM_006231.3(POLE):c.185G>A (p.Trp62Ter) rs1565981538
NM_006231.3(POLE):c.1861C>T (p.Leu621Phe) rs945099471
NM_006231.3(POLE):c.1868A>G (p.Tyr623Cys) rs150564856
NM_006231.3(POLE):c.1879G>A (p.Val627Met) rs747929590
NM_006231.3(POLE):c.1883G>T (p.Gly628Val)
NM_006231.3(POLE):c.1885G>A (p.Ala629Thr)
NM_006231.3(POLE):c.1888A>G (p.Met630Val) rs1555227390
NM_006231.3(POLE):c.1894C>T (p.Pro632Ser) rs1565966599
NM_006231.3(POLE):c.1895C>G (p.Pro632Arg) rs1218293194
NM_006231.3(POLE):c.1897A>C (p.Asn633His) rs141657198
NM_006231.3(POLE):c.1897A>G (p.Asn633Asp)
NM_006231.3(POLE):c.1900A>G (p.Ile634Val) rs757296864
NM_006231.3(POLE):c.1916G>A (p.Arg639His)
NM_006231.3(POLE):c.1921C>T (p.Gln641Ter) rs1060500777
NM_006231.3(POLE):c.1923+6A>G
NM_006231.3(POLE):c.1924-23_1927del rs1064795679
NM_006231.3(POLE):c.1924C>A (p.Pro642Thr) rs1178412345
NM_006231.3(POLE):c.1930G>A (p.Ala644Thr) rs1060500885
NM_006231.3(POLE):c.1935G>A (p.Met645Ile) rs561707898
NM_006231.3(POLE):c.1940A>G (p.Asp647Gly)
NM_006231.3(POLE):c.1940A>T (p.Asp647Val) rs1060500884
NM_006231.3(POLE):c.1942G>A (p.Glu648Lys)
NM_006231.3(POLE):c.1949C>T (p.Thr650Ile)
NM_006231.3(POLE):c.1952G>A (p.Cys651Tyr) rs1060500877
NM_006231.3(POLE):c.1957G>T (p.Ala653Ser) rs751451482
NM_006231.3(POLE):c.1958C>T (p.Ala653Val) rs1555227357
NM_006231.3(POLE):c.1964A>G (p.Asp655Gly)
NM_006231.3(POLE):c.196A>G (p.Met66Val) rs534552358
NM_006231.3(POLE):c.1970A>G (p.Asn657Ser) rs763809781
NM_006231.3(POLE):c.198G>A (p.Met66Ile) rs764962999
NM_006231.3(POLE):c.1993C>T (p.Arg665Trp) rs367902268
NM_006231.3(POLE):c.1994G>A (p.Arg665Gln)
NM_006231.3(POLE):c.1997A>C (p.Lys666Thr) rs1060500796
NM_006231.3(POLE):c.1999A>C (p.Met667Leu) rs1418383181
NM_006231.3(POLE):c.199C>A (p.His67Asn) rs1555230392
NM_006231.3(POLE):c.19G>A (p.Gly7Arg) rs771930571
NM_006231.3(POLE):c.19G>C (p.Gly7Arg)
NM_006231.3(POLE):c.1A>C (p.Met1Leu) rs878854847
NM_006231.3(POLE):c.1A>G (p.Met1Val) rs878854847
NM_006231.3(POLE):c.1A>T (p.Met1Leu) rs878854847
NM_006231.3(POLE):c.2000T>C (p.Met667Thr)
NM_006231.3(POLE):c.2002G>A (p.Ala668Thr)
NM_006231.3(POLE):c.2014A>G (p.Arg672Gly)
NM_006231.3(POLE):c.2019C>T (p.Gly673=) rs748614767
NM_006231.3(POLE):c.2020G>A (p.Glu674Lys) rs779458859
NM_006231.3(POLE):c.2026+1G>C
NM_006231.3(POLE):c.2026A>G (p.Met676Val) rs1447713785
NM_006231.3(POLE):c.202C>A (p.Pro68Thr) rs1408600144
NM_006231.3(POLE):c.202C>G (p.Pro68Ala) rs1408600144
NM_006231.3(POLE):c.2038C>T (p.Arg680Cys) rs764044031
NM_006231.3(POLE):c.2039G>A (p.Arg680His) rs763522976
NM_006231.3(POLE):c.2039G>T (p.Arg680Leu) rs763522976
NM_006231.3(POLE):c.204+3A>G rs962416286
NM_006231.3(POLE):c.204+6C>T rs1555230386
NM_006231.3(POLE):c.2044G>A (p.Glu682Lys) rs878854848
NM_006231.3(POLE):c.2048A>G (p.Tyr683Cys)
NM_006231.3(POLE):c.2049C>G (p.Tyr683Ter) rs1196356920
NM_006231.3(POLE):c.2051A>G (p.His684Arg)
NM_006231.3(POLE):c.2051A>T (p.His684Leu)
NM_006231.3(POLE):c.2053C>T (p.Arg685Trp) rs116326665
NM_006231.3(POLE):c.2054G>A (p.Arg685Gln) rs770597683
NM_006231.3(POLE):c.2059C>A (p.Gln687Lys)
NM_006231.3(POLE):c.2064C>G (p.His688Gln) rs1555227275
NM_006231.3(POLE):c.2068C>G (p.Leu690Val) rs1565965882
NM_006231.3(POLE):c.206_211delCCGAGA rs1555230325
NM_006231.3(POLE):c.2075C>T (p.Ser692Leu) rs1060500776
NM_006231.3(POLE):c.2083T>C (p.Phe695Leu) rs5744799
NM_006231.3(POLE):c.2083T>G (p.Phe695Val)
NM_006231.3(POLE):c.2085C>A (p.Phe695Leu) rs1060500837
NM_006231.3(POLE):c.2087C>T (p.Pro696Leu) rs766037063
NM_006231.3(POLE):c.2089C>A (p.Pro697Thr) rs5744800
NM_006231.3(POLE):c.208G>A (p.Glu70Lys)
NM_006231.3(POLE):c.2090C>A (p.Pro697His) rs36120395
NM_006231.3(POLE):c.2090C>T (p.Pro697Leu) rs36120395
NM_006231.3(POLE):c.2091del (p.Leu698fs) rs752846614
NM_006231.3(POLE):c.2091dup (p.Phe699fs) rs752846614
NM_006231.3(POLE):c.2098C>T (p.Pro700Ser) rs145793634
NM_006231.3(POLE):c.2099C>T (p.Pro700Leu) rs777002868
NM_006231.3(POLE):c.2110G>C (p.Ala704Pro)
NM_006231.3(POLE):c.2113C>T (p.Arg705Trp) rs200621883
NM_006231.3(POLE):c.2114G>A (p.Arg705Gln) rs773738016
NM_006231.3(POLE):c.2122C>T (p.His708Tyr)
NM_006231.3(POLE):c.2125G>T (p.Glu709Ter)
NM_006231.3(POLE):c.2129T>C (p.Leu710Pro)
NM_006231.3(POLE):c.2131T>C (p.Ser711Pro) rs374800058
NM_006231.3(POLE):c.2134C>G (p.Arg712Gly) rs749194160
NM_006231.3(POLE):c.2134C>T (p.Arg712Cys) rs749194160
NM_006231.3(POLE):c.2135G>A (p.Arg712His) rs115225325
NM_006231.3(POLE):c.2135G>T (p.Arg712Leu)
NM_006231.3(POLE):c.2137G>A (p.Glu713Lys) rs751870998
NM_006231.3(POLE):c.2146G>A (p.Ala716Thr) rs1379490235
NM_006231.3(POLE):c.2147C>T (p.Ala716Val) rs567031389
NM_006231.3(POLE):c.214T>G (p.Leu72Val)
NM_006231.3(POLE):c.2152T>C (p.Tyr718His) rs1267528399
NM_006231.3(POLE):c.2155G>A (p.Glu719Lys) rs765254190
NM_006231.3(POLE):c.2158A>T (p.Lys720Ter) rs1565965603
NM_006231.3(POLE):c.2164del (p.Arg722fs) rs1555227234
NM_006231.3(POLE):c.2170G>A (p.Ala724Thr)
NM_006231.3(POLE):c.2171C>T (p.Ala724Val) rs61734163
NM_006231.3(POLE):c.2172G>A (p.Ala724=) rs372240734
NM_006231.3(POLE):c.2173+5G>A rs878854849
NM_006231.3(POLE):c.2173G>T (p.Asp725Tyr) rs760942391
NM_006231.3(POLE):c.2174-11G>A rs111570840
NM_006231.3(POLE):c.2174-12C>G rs192222479
NM_006231.3(POLE):c.2179T>A (p.Cys727Ser) rs1060500832
NM_006231.3(POLE):c.2182C>T (p.Arg728Trp)
NM_006231.3(POLE):c.2183G>A (p.Arg728Gln) rs762552065
NM_006231.3(POLE):c.2189_2199delinsT (p.Ala730fs) rs1064792921
NM_006231.3(POLE):c.218A>G (p.Asp73Gly) rs1060500786
NM_006231.3(POLE):c.2198A>G (p.Lys733Arg)
NM_006231.3(POLE):c.2204A>T (p.His735Leu)
NM_006231.3(POLE):c.2207T>G (p.Ile736Ser) rs1060500850
NM_006231.3(POLE):c.2209A>G (p.Thr737Ala) rs779102091
NM_006231.3(POLE):c.2210C>A (p.Thr737Asn)
NM_006231.3(POLE):c.2214G>C (p.Lys738Asn) rs749305408
NM_006231.3(POLE):c.2222A>G (p.Glu741Gly) rs1060500807
NM_006231.3(POLE):c.2223G>C (p.Glu741Asp) rs750872591
NM_006231.3(POLE):c.2224C>T (p.Arg742Cys)
NM_006231.3(POLE):c.2225G>A (p.Arg742His) rs116360781
NM_006231.3(POLE):c.2227C>T (p.Leu743Phe)
NM_006231.3(POLE):c.2236A>G (p.Ile746Val) rs1480527153
NM_006231.3(POLE):c.2245C>T (p.Arg749Trp) rs751326135
NM_006231.3(POLE):c.2245del (p.Arg749fs) rs1565964707
NM_006231.3(POLE):c.2246G>A (p.Arg749Gln) rs1010159851
NM_006231.3(POLE):c.2251A>G (p.Asn751Asp) rs1565964683
NM_006231.3(POLE):c.2255_2257del (p.Ser752del) rs878854850
NM_006231.3(POLE):c.2258_2260del (p.Phe753del) rs1060500779
NM_006231.3(POLE):c.2263G>A (p.Val755Met) rs1222472060
NM_006231.3(POLE):c.2269A>G (p.Thr757Ala) rs1060500880
NM_006231.3(POLE):c.226A>T (p.Lys76Ter) rs1468404698
NM_006231.3(POLE):c.2272G>A (p.Val758Met) rs1210448190
NM_006231.3(POLE):c.2275C>T (p.Arg759Cys) rs759398253
NM_006231.3(POLE):c.2276G>A (p.Arg759His) rs746774432
NM_006231.3(POLE):c.2276G>T (p.Arg759Leu)
NM_006231.3(POLE):c.2285G>A (p.Arg762Gln) rs1023692053
NM_006231.3(POLE):c.2294G>A (p.Arg765His) rs1555227096
NM_006231.3(POLE):c.2299G>A (p.Glu767Lys) rs1565964543
NM_006231.3(POLE):c.229C>T (p.Arg77Cys) rs1060500889
NM_006231.3(POLE):c.22C>G (p.Arg8Gly)
NM_006231.3(POLE):c.22C>T (p.Arg8Trp) rs1196946399
NM_006231.3(POLE):c.2308G>C (p.Gly770Arg) rs1565964535
NM_006231.3(POLE):c.2309G>T (p.Gly770Val) rs1555227087
NM_006231.3(POLE):c.2317A>G (p.Lys773Glu) rs1324963603
NM_006231.3(POLE):c.2319+5G>T
NM_006231.3(POLE):c.2319G>A (p.Lys773=) rs1565964510
NM_006231.3(POLE):c.2320-9G>T rs769834031
NM_006231.3(POLE):c.2321T>C (p.Val774Ala) rs771591846
NM_006231.3(POLE):c.2327A>G (p.Lys776Arg) rs375791061
NM_006231.3(POLE):c.2332A>C (p.Lys778Gln) rs1263904781
NM_006231.3(POLE):c.2339C>T (p.Ser780Leu) rs778288256
NM_006231.3(POLE):c.233T>C (p.Leu78Ser)
NM_006231.3(POLE):c.2340_2342GGC[1] (p.Ala782del) rs1064796065
NM_006231.3(POLE):c.2342C>T (p.Ala781Val) rs1060500855
NM_006231.3(POLE):c.2347G>A (p.Val783Met) rs371085002
NM_006231.3(POLE):c.2348T>C (p.Val783Ala) rs1269621526
NM_006231.3(POLE):c.2350G>A (p.Glu784Lys)
NM_006231.3(POLE):c.2358C>T (p.Gly786=) rs1278181584
NM_006231.3(POLE):c.2359G>A (p.Asp787Asn) rs878854851
NM_006231.3(POLE):c.235G>A (p.Gly79Ser)
NM_006231.3(POLE):c.2362G>A (p.Ala788Thr) rs896350761
NM_006231.3(POLE):c.2363C>T (p.Ala788Val) rs1060500813
NM_006231.3(POLE):c.2374A>G (p.Lys792Glu) rs1565962393
NM_006231.3(POLE):c.2377C>T (p.Arg793Cys) rs376624527
NM_006231.3(POLE):c.2378G>A (p.Arg793His) rs1422986795
NM_006231.3(POLE):c.2378G>T (p.Arg793Leu) rs1422986795
NM_006231.3(POLE):c.2382C>T (p.Cys794=)
NM_006231.3(POLE):c.2384A>G (p.Lys795Arg) rs867677414
NM_006231.3(POLE):c.2389A>G (p.Met797Val)
NM_006231.3(POLE):c.2389A>T (p.Met797Leu)
NM_006231.3(POLE):c.2402A>G (p.Tyr801Cys) rs1060500825
NM_006231.3(POLE):c.2408C>T (p.Ser803Leu) rs1565962323
NM_006231.3(POLE):c.2411T>G (p.Leu804Arg)
NM_006231.3(POLE):c.241G>A (p.Ala81Thr) rs749720207
NM_006231.3(POLE):c.2423A>G (p.His808Arg) rs1060500854
NM_006231.3(POLE):c.2428T>C (p.Cys810Arg) rs753421179
NM_006231.3(POLE):c.2429G>A (p.Cys810Tyr) rs1565962279
NM_006231.3(POLE):c.242C>T (p.Ala81Val) rs780246896
NM_006231.3(POLE):c.2432T>C (p.Ile811Thr)
NM_006231.3(POLE):c.2439C>A (p.Asn813Lys)
NM_006231.3(POLE):c.2453A>G (p.Tyr818Cys) rs148691442
NM_006231.3(POLE):c.2459T>C (p.Met820Thr)
NM_006231.3(POLE):c.2462G>A (p.Arg821His)
NM_006231.3(POLE):c.2462G>T (p.Arg821Leu) rs757051826
NM_006231.3(POLE):c.2463C>T (p.Arg821=) rs751392565
NM_006231.3(POLE):c.2465_2467dup (p.Gly823_Ala824insGlu) rs1237046519
NM_006231.3(POLE):c.2468+1G>A rs1060500806
NM_006231.3(POLE):c.2468+2dup rs1555226665
NM_006231.3(POLE):c.2468+4G>C rs1555226663
NM_006231.3(POLE):c.2468G>C (p.Gly823Ala)
NM_006231.3(POLE):c.2469-10G>A rs1060500870
NM_006231.3(POLE):c.2473C>T (p.Arg825Cys) rs200283666
NM_006231.3(POLE):c.2473_2492del (p.Arg825fs)
NM_006231.3(POLE):c.2474G>A (p.Arg825His)
NM_006231.3(POLE):c.2474G>T (p.Arg825Leu) rs1555226511
NM_006231.3(POLE):c.2477G>T (p.Trp826Leu) rs1565961348
NM_006231.3(POLE):c.2485A>G (p.Met829Val) rs762395135
NM_006231.3(POLE):c.2486T>C (p.Met829Thr) rs1060500860
NM_006231.3(POLE):c.2487G>A (p.Met829Ile) rs372109189
NM_006231.3(POLE):c.2492T>G (p.Met831Arg) rs749619971
NM_006231.3(POLE):c.2499C>T (p.Gly833=)
NM_006231.3(POLE):c.2503G>A (p.Val835Ile) rs1013082648
NM_006231.3(POLE):c.2513C>T (p.Thr838Ile)
NM_006231.3(POLE):c.2527A>G (p.Ile843Val) rs780758461
NM_006231.3(POLE):c.2536G>T (p.Ala846Ser) rs1555226498
NM_006231.3(POLE):c.2537C>T (p.Ala846Val) rs1060500798
NM_006231.3(POLE):c.2544G>C (p.Glu848Asp) rs374905660
NM_006231.3(POLE):c.254A>G (p.Tyr85Cys) rs1565981016
NM_006231.3(POLE):c.2550C>G (p.Ile850Met) rs5744834
NM_006231.3(POLE):c.2551G>T (p.Glu851Ter)
NM_006231.3(POLE):c.255_257del (p.Phe86del) rs1565981011
NM_006231.3(POLE):c.2561+1G>A rs1565961210
NM_006231.3(POLE):c.2561+5G>A rs1555226494
NM_006231.3(POLE):c.2562-2A>C rs751662353
NM_006231.3(POLE):c.2562-5T>G rs1461925348
NM_006231.3(POLE):c.2566C>T (p.Pro856Ser) rs1555226454
NM_006231.3(POLE):c.2587G>C (p.Gly863Arg)
NM_006231.3(POLE):c.2590A>G (p.Ile864Val)
NM_006231.3(POLE):c.2592A>G (p.Ile864Met)
NM_006231.3(POLE):c.2599G>A (p.Val867Ile) rs374200895
NM_006231.3(POLE):c.259A>G (p.Ile87Val) rs1223305093
NM_006231.3(POLE):c.25C>T (p.Arg9Trp) rs1480510431
NM_006231.3(POLE):c.2609A>G (p.Asn870Ser) rs1060500875
NM_006231.3(POLE):c.260T>C (p.Ile87Thr) rs1565980997
NM_006231.3(POLE):c.2610C>G (p.Asn870Lys) rs1057524008
NM_006231.3(POLE):c.2612G>C (p.Ser871Thr) rs770470552
NM_006231.3(POLE):c.2626T>C (p.Phe876Leu) rs1208731306
NM_006231.3(POLE):c.2630T>C (p.Val877Ala) rs1565960854
NM_006231.3(POLE):c.2635A>G (p.Lys879Glu) rs760333190
NM_006231.3(POLE):c.2636A>G (p.Lys879Arg) rs1555226439
NM_006231.3(POLE):c.2638A>G (p.Thr880Ala) rs138548494
NM_006231.3(POLE):c.2638_2639delinsCT (p.Thr880Leu) rs1555226437
NM_006231.3(POLE):c.2639C>T (p.Thr880Met) rs1337524033
NM_006231.3(POLE):c.2644A>C (p.Asn882His) rs1455015315
NM_006231.3(POLE):c.2645A>G (p.Asn882Ser) rs539312991
NM_006231.3(POLE):c.2648T>C (p.Val883Ala) rs1555226430
NM_006231.3(POLE):c.2659A>T (p.Lys887Ter) rs1060500878
NM_006231.3(POLE):c.2660A>G (p.Lys887Arg)
NM_006231.3(POLE):c.2662G>A (p.Val888Met)
NM_006231.3(POLE):c.2666C>A (p.Thr889Asn)
NM_006231.3(POLE):c.2666C>T (p.Thr889Ile) rs768534409
NM_006231.3(POLE):c.2668A>G (p.Ile890Val) rs749012938
NM_006231.3(POLE):c.266A>C (p.Asp89Ala) rs756843283
NM_006231.3(POLE):c.2678C>T (p.Pro893Leu) rs1555226423
NM_006231.3(POLE):c.2682C>T (p.Gly894=) rs757453683
NM_006231.3(POLE):c.2683G>A (p.Ala895Thr) rs201115064
NM_006231.3(POLE):c.2684C>T (p.Ala895Val) rs1458833255
NM_006231.3(POLE):c.268G>A (p.Asp90Asn)
NM_006231.3(POLE):c.2695A>G (p.Ile899Val) rs1555226418
NM_006231.3(POLE):c.2701G>A (p.Val901Ile) rs1565960706
NM_006231.3(POLE):c.2706+1_2706+5delGTGAG rs779830137
NM_006231.3(POLE):c.2706+2T>C rs1555226411
NM_006231.3(POLE):c.2706+5G>A rs375931088
NM_006231.3(POLE):c.2707-2A>G
NM_006231.3(POLE):c.2707-3C>T rs1555226069
NM_006231.3(POLE):c.270C>G (p.Asp90Glu)
NM_006231.3(POLE):c.270del (p.Asp90fs) rs878854854
NM_006231.3(POLE):c.2711G>C (p.Gly904Ala) rs1332965505
NM_006231.3(POLE):c.2711G>T (p.Gly904Val) rs1332965505
NM_006231.3(POLE):c.2716A>G (p.Thr906Ala)
NM_006231.3(POLE):c.271G>A (p.Gly91Arg) rs1316316435
NM_006231.3(POLE):c.2720A>G (p.Asn907Ser)
NM_006231.3(POLE):c.2722G>A (p.Asp908Asn) rs1565958703
NM_006231.3(POLE):c.272G>A (p.Gly91Glu) rs376348304
NM_006231.3(POLE):c.2731del (p.Gln911fs) rs1555226051
NM_006231.3(POLE):c.2732A>C (p.Gln911Pro)
NM_006231.3(POLE):c.274A>C (p.Ser92Arg) rs758382516
NM_006231.3(POLE):c.2759C>G (p.Thr920Ser)
NM_006231.3(POLE):c.2764G>A (p.Val922Ile) rs551966935
NM_006231.3(POLE):c.2770C>A (p.Arg924Ser) rs369751686
NM_006231.3(POLE):c.2770C>T (p.Arg924Cys) rs369751686
NM_006231.3(POLE):c.2771G>A (p.Arg924His) rs763594644
NM_006231.3(POLE):c.2773T>C (p.Ser925Pro) rs141552148
NM_006231.3(POLE):c.2774C>T (p.Ser925Leu)
NM_006231.3(POLE):c.2785A>G (p.Ile929Val)
NM_006231.3(POLE):c.2792T>C (p.Phe931Ser) rs376546593
NM_006231.3(POLE):c.2801A>G (p.Asp934Gly) rs1242503528
NM_006231.3(POLE):c.2811C>A (p.Tyr937Ter)
NM_006231.3(POLE):c.2812C>T (p.Leu938Phe)
NM_006231.3(POLE):c.2818A>G (p.Met940Val) rs148382941
NM_006231.3(POLE):c.2820G>A (p.Met940Ile)
NM_006231.3(POLE):c.2821A>G (p.Ile941Val) rs1060500887
NM_006231.3(POLE):c.2824C>T (p.Leu942Phe) rs1555226025
NM_006231.3(POLE):c.2830G>T (p.Ala944Ser)
NM_006231.3(POLE):c.2847C>T (p.Gly949=) rs1555226021
NM_006231.3(POLE):c.2852A>C (p.Lys951Thr) rs1555226017
NM_006231.3(POLE):c.285G>A (p.Lys95=) rs1060500794
NM_006231.3(POLE):c.286-3C>A rs1555230255
NM_006231.3(POLE):c.286-3C>T rs1555230255
NM_006231.3(POLE):c.286-4delA rs1555230256
NM_006231.3(POLE):c.286-7T>G
NM_006231.3(POLE):c.2864+3G>A rs1060500856
NM_006231.3(POLE):c.2865-2A>G rs867360056
NM_006231.3(POLE):c.2865-3C>T rs1203095918
NM_006231.3(POLE):c.2865-3del rs1555225973
NM_006231.3(POLE):c.2865-4T>C rs1060500840
NM_006231.3(POLE):c.2872G>A (p.Val958Met)
NM_006231.3(POLE):c.2879A>G (p.Asn960Ser) rs746311547
NM_006231.3(POLE):c.2880T>G (p.Asn960Lys) rs1555225966
NM_006231.3(POLE):c.2887G>A (p.Gly963Ser) rs751237672
NM_006231.3(POLE):c.2888G>A (p.Gly963Asp) rs777454763
NM_006231.3(POLE):c.28C>T (p.Arg10Cys) rs1245695191
NM_006231.3(POLE):c.2908G>A (p.Gly970Ser) rs1480250083
NM_006231.3(POLE):c.2917G>T (p.Val973Phe)
NM_006231.3(POLE):c.2919C>A (p.Val973=) rs1060500819
NM_006231.3(POLE):c.2923C>T (p.Arg975Cys)
NM_006231.3(POLE):c.2924G>A (p.Arg975His)
NM_006231.3(POLE):c.2926C>T (p.Arg976Cys) rs1060500820
NM_006231.3(POLE):c.2927G>A (p.Arg976His) rs878854857
NM_006231.3(POLE):c.292T>G (p.Leu98Val)
NM_006231.3(POLE):c.2932dup (p.Glu978fs) rs1032311596
NM_006231.3(POLE):c.2956del (p.Gln986fs)
NM_006231.3(POLE):c.295C>G (p.Pro99Ala) rs1060500863
NM_006231.3(POLE):c.295C>T (p.Pro99Ser)
NM_006231.3(POLE):c.2960C>A (p.Ser987Tyr)
NM_006231.3(POLE):c.2960C>T (p.Ser987Phe)
NM_006231.3(POLE):c.2963C>T (p.Ser988Leu) rs138391248
NM_006231.3(POLE):c.2964G>A (p.Ser988=) rs200080353
NM_006231.3(POLE):c.2965G>T (p.Val989Leu)
NM_006231.3(POLE):c.2993C>T (p.Thr998Met) rs989886155
NM_006231.3(POLE):c.2T>A (p.Met1Lys) rs879254126
NM_006231.3(POLE):c.2T>C (p.Met1Thr) rs879254126
NM_006231.3(POLE):c.2T>G (p.Met1Arg) rs879254126
NM_006231.3(POLE):c.3014C>T (p.Ser1005Phe) rs550579850
NM_006231.3(POLE):c.3019G>C (p.Ala1007Pro) rs747692201
NM_006231.3(POLE):c.301A>G (p.Lys101Glu) rs560654523
NM_006231.3(POLE):c.302A>G (p.Lys101Arg) rs1016258970
NM_006231.3(POLE):c.3031G>A (p.Asp1011Asn)
NM_006231.3(POLE):c.3039G>A (p.Trp1013Ter)
NM_006231.3(POLE):c.3060+1_3060+2dup
NM_006231.3(POLE):c.3060+2T>G rs775843286
NM_006231.3(POLE):c.3060G>A (p.Lys1020=) rs878854858
NM_006231.3(POLE):c.3071T>C (p.Met1024Thr) rs1565956324
NM_006231.3(POLE):c.3071del (p.Met1024fs)
NM_006231.3(POLE):c.3072G>T (p.Met1024Ile) rs1060500791
NM_006231.3(POLE):c.3074dup (p.Pro1025_Asp1026insTer) rs1565956310
NM_006231.3(POLE):c.3076_3096dup (p.Asp1026_Leu1032dup) rs1555225690
NM_006231.3(POLE):c.307T>C (p.Tyr103His) rs1292121980
NM_006231.3(POLE):c.3086T>C (p.Leu1029Pro) rs1228020822
NM_006231.3(POLE):c.3089T>A (p.Phe1030Tyr) rs1565956275
NM_006231.3(POLE):c.3090C>A (p.Phe1030Leu)
NM_006231.3(POLE):c.3094C>T (p.Leu1032Phe) rs1555225694
NM_006231.3(POLE):c.3109C>T (p.Arg1037Cys) rs948001596
NM_006231.3(POLE):c.3121C>T (p.Arg1041Trp) rs762140272
NM_006231.3(POLE):c.3122G>A (p.Arg1041Gln) rs774645622
NM_006231.3(POLE):c.3125A>G (p.Lys1042Arg)
NM_006231.3(POLE):c.3130G>A (p.Glu1044Lys)
NM_006231.3(POLE):c.3130G>C (p.Glu1044Gln) rs1060500869
NM_006231.3(POLE):c.3139G>A (p.Gly1047Arg) rs1555225676
NM_006231.3(POLE):c.3140G>A (p.Gly1047Glu)
NM_006231.3(POLE):c.314A>T (p.Tyr105Phe) rs1451750169
NM_006231.3(POLE):c.3154A>G (p.Thr1052Ala)
NM_006231.3(POLE):c.3155_3156delinsTA (p.Thr1052Ile)
NM_006231.3(POLE):c.3170C>T (p.Ala1057Val) rs975893534
NM_006231.3(POLE):c.3175C>T (p.Arg1059Cys) rs1555225670
NM_006231.3(POLE):c.3176G>T (p.Arg1059Leu)
NM_006231.3(POLE):c.317T>C (p.Ile106Thr)
NM_006231.3(POLE):c.3196G>A (p.Asp1066Asn) rs1060500851
NM_006231.3(POLE):c.3198C>A (p.Asp1066Glu) rs1555225663
NM_006231.3(POLE):c.31G>A (p.Ala11Thr)
NM_006231.3(POLE):c.3203T>C (p.Met1068Thr)
NM_006231.3(POLE):c.320C>T (p.Ala107Val) rs878854860
NM_006231.3(POLE):c.3214G>A (p.Ala1072Thr) rs1555225652
NM_006231.3(POLE):c.3219G>T (p.Gly1073=) rs760636704
NM_006231.3(POLE):c.3223A>T (p.Ser1075Cys) rs145680387
NM_006231.3(POLE):c.3229C>G (p.Arg1077Gly)
NM_006231.3(POLE):c.3229C>T (p.Arg1077Cys) rs149777592
NM_006231.3(POLE):c.3229_3241delinsGG (p.Arg1077fs) rs1064792919
NM_006231.3(POLE):c.322A>T (p.Thr108Ser) rs1565980550
NM_006231.3(POLE):c.3230G>A (p.Arg1077His) rs768950975
NM_006231.3(POLE):c.3235A>G (p.Ile1079Val) rs775002004
NM_006231.3(POLE):c.3240C>G (p.Ile1080Met) rs769386598
NM_006231.3(POLE):c.3244C>T (p.Arg1082Cys)
NM_006231.3(POLE):c.3245G>A (p.Arg1082His) rs201744227
NM_006231.3(POLE):c.3247A>C (p.Lys1083Gln) rs1260941612
NM_006231.3(POLE):c.3257G>A (p.Gly1086Asp) rs1060500778
NM_006231.3(POLE):c.3264_3275+13delTGTCACGGAGAGGTGAGGGCTCCCC rs761516512
NM_006231.3(POLE):c.3269C>T (p.Thr1090Met) rs1030360914
NM_006231.3(POLE):c.326G>A (p.Arg109Lys) rs1555230239
NM_006231.3(POLE):c.3270G>A (p.Thr1090=) rs758258927
NM_006231.3(POLE):c.3275+1G>A rs1402672053
NM_006231.3(POLE):c.3275+4A>T
NM_006231.3(POLE):c.3275+6G>T rs1060500874
NM_006231.3(POLE):c.3275G>C (p.Arg1092Thr) rs1060500857
NM_006231.3(POLE):c.3276-2A>G rs1060500838
NM_006231.3(POLE):c.3276-3C>G
NM_006231.3(POLE):c.3278C>G (p.Ala1093Gly) rs1565954149
NM_006231.3(POLE):c.3292A>G (p.Ile1098Val)
NM_006231.3(POLE):c.32C>T (p.Ala11Val) rs1060500821
NM_006231.3(POLE):c.330+3G>A rs369152225
NM_006231.3(POLE):c.3305A>C (p.Glu1102Ala) rs1555225324
NM_006231.3(POLE):c.3308C>A (p.Pro1103His) rs759126051
NM_006231.3(POLE):c.331-1G>A rs1555230196
NM_006231.3(POLE):c.331-2A>G rs1565980363
NM_006231.3(POLE):c.331-3T>C rs1269825866
NM_006231.3(POLE):c.3311C>T (p.Thr1104Met) rs531705054
NM_006231.3(POLE):c.3320A>G (p.Lys1107Arg) rs1060500800
NM_006231.3(POLE):c.3328C>A (p.Leu1110Ile) rs1555225317
NM_006231.3(POLE):c.3328C>G (p.Leu1110Val) rs1555225317
NM_006231.3(POLE):c.3331C>T (p.Arg1111Trp) rs774028311
NM_006231.3(POLE):c.3332G>A (p.Arg1111Gln) rs114315196
NM_006231.3(POLE):c.3335A>C (p.Lys1112Thr) rs1555225311
NM_006231.3(POLE):c.3338G>A (p.Trp1113Ter) rs1461016090
NM_006231.3(POLE):c.3338G>C (p.Trp1113Ser) rs1461016090
NM_006231.3(POLE):c.3347_3350delinsTT (p.Ser1116fs) rs1555225303
NM_006231.3(POLE):c.3348C>G (p.Ser1116Arg)
NM_006231.3(POLE):c.3349T>C (p.Ser1117Pro) rs777793030
NM_006231.3(POLE):c.3350C>T (p.Ser1117Phe) rs1555225302
NM_006231.3(POLE):c.3355C>T (p.Leu1119Phe)
NM_006231.3(POLE):c.3359A>C (p.Gln1120Pro) rs1565953982
NM_006231.3(POLE):c.3373C>T (p.Arg1125Ter) rs139603739
NM_006231.3(POLE):c.3374G>A (p.Arg1125Gln) rs1565953956
NM_006231.3(POLE):c.3376G>T (p.Ala1126Ser) rs1555225288
NM_006231.3(POLE):c.3377C>T (p.Ala1126Val) rs373707446
NM_006231.3(POLE):c.3382C>G (p.Leu1128Val)
NM_006231.3(POLE):c.3388T>C (p.Trp1130Arg)
NM_006231.3(POLE):c.3392A>G (p.Asp1131Gly)
NM_006231.3(POLE):c.3393C>G (p.Asp1131Glu) rs750084800
NM_006231.3(POLE):c.3400A>C (p.Ile1134Leu) rs1060500888
NM_006231.3(POLE):c.3401T>C (p.Ile1134Thr) rs1054915845
NM_006231.3(POLE):c.3406C>T (p.Arg1136Trp) rs531475854
NM_006231.3(POLE):c.3407G>A (p.Arg1136Gln) rs761355093
NM_006231.3(POLE):c.340C>T (p.Arg114Ter) rs1555230189
NM_006231.3(POLE):c.3415_3420delinsTG (p.Gly1138_Ser1139insTer) rs1555225201
NM_006231.3(POLE):c.3418G>A (p.Ala1140Thr) rs775271152
NM_006231.3(POLE):c.341G>A (p.Arg114Gln) rs375785166
NM_006231.3(POLE):c.3431_3433TCA[1] (p.Ile1145del) rs976070874
NM_006231.3(POLE):c.3432C>G (p.Ile1144Met)
NM_006231.3(POLE):c.3437C>G (p.Thr1146Ser) rs1555225192
NM_006231.3(POLE):c.343G>A (p.Glu115Lys) rs1565980334
NM_006231.3(POLE):c.3443C>G (p.Pro1148Arg) rs1060500886
NM_006231.3(POLE):c.3446C>T (p.Ala1149Val) rs778212434
NM_006231.3(POLE):c.3447G>A (p.Ala1149=)
NM_006231.3(POLE):c.3459+1G>A rs1555225184
NM_006231.3(POLE):c.3459+2T>C rs1057517634
NM_006231.3(POLE):c.3459+3A>C rs1555225183
NM_006231.3(POLE):c.3459+8C>T rs375852759
NM_006231.3(POLE):c.3459G>A (p.Gln1153=) rs1060500818
NM_006231.3(POLE):c.3465G>T (p.Lys1155Asn) rs1449239461
NM_006231.3(POLE):c.3469C>G (p.Pro1157Ala)
NM_006231.3(POLE):c.346G>A (p.Val116Ile)
NM_006231.3(POLE):c.3478C>T (p.Arg1160Cys)
NM_006231.3(POLE):c.347T>C (p.Val116Ala) rs771744496
NM_006231.3(POLE):c.3481G>A (p.Val1161Ile) rs1555225160
NM_006231.3(POLE):c.3485A>G (p.Lys1162Arg) rs1565953154
NM_006231.3(POLE):c.3493G>A (p.Asp1165Asn) rs575738148
NM_006231.3(POLE):c.34G>A (p.Asp12Asn) rs1355767159
NM_006231.3(POLE):c.3500T>G (p.Leu1167Arg)
NM_006231.3(POLE):c.3501_3502insGGTCAAA (p.His1168fs) rs1060500814
NM_006231.3(POLE):c.3506A>G (p.Lys1169Arg) rs374456899
NM_006231.3(POLE):c.3510dup (p.Leu1171fs) rs1555225149
NM_006231.3(POLE):c.3518A>G (p.Glu1173Gly) rs762150108
NM_006231.3(POLE):c.3527A>G (p.Asp1176Gly) rs1060500785
NM_006231.3(POLE):c.3534C>A (p.Tyr1178Ter) rs370133842
NM_006231.3(POLE):c.3539A>G (p.Gln1180Arg) rs1311314922
NM_006231.3(POLE):c.3539_3541AGA[2] (p.Lys1182del) rs1555225139
NM_006231.3(POLE):c.355T>A (p.Phe119Ile) rs879254235
NM_006231.3(POLE):c.355T>C (p.Phe119Leu) rs879254235
NM_006231.3(POLE):c.3563C>A (p.Thr1188Asn) rs1565952926
NM_006231.3(POLE):c.3572G>T (p.Gly1191Val) rs1429556469
NM_006231.3(POLE):c.3582+5C>T rs775661457
NM_006231.3(POLE):c.3582+6G>A rs113307290
NM_006231.3(POLE):c.358C>G (p.Leu120Val) rs888631588
NM_006231.3(POLE):c.3590delinsGGTCTGA (p.Met1197delinsArgSerGlu) rs1555224131
NM_006231.3(POLE):c.3593C>A (p.Ala1198Asp) rs1024652254
NM_006231.3(POLE):c.3595G>A (p.Glu1199Lys) rs1012418859
NM_006231.3(POLE):c.3598G>A (p.Ala1200Thr) rs1555224126
NM_006231.3(POLE):c.3604G>A (p.Glu1202Lys) rs1565946881
NM_006231.3(POLE):c.3605A>G (p.Glu1202Gly)
NM_006231.3(POLE):c.3611G>A (p.Ser1204Asn) rs1555224124
NM_006231.3(POLE):c.3612T>G (p.Ser1204Arg)
NM_006231.3(POLE):c.3614C>T (p.Pro1205Leu) rs772686048
NM_006231.3(POLE):c.3617G>T (p.Arg1206Met) rs1060500839
NM_006231.3(POLE):c.3619C>T (p.Pro1207Ser) rs878854861
NM_006231.3(POLE):c.3620C>T (p.Pro1207Leu) rs144086049
NM_006231.3(POLE):c.3622A>C (p.Ser1208Arg) rs1207616449
NM_006231.3(POLE):c.3623G>A (p.Ser1208Asn) rs781094608
NM_006231.3(POLE):c.3626C>T (p.Ala1209Val)
NM_006231.3(POLE):c.3629C>T (p.Pro1210Leu)
NM_006231.3(POLE):c.3629dup (p.Pro1210_Asp1211insTer) rs1555224111
NM_006231.3(POLE):c.3632A>C (p.Asp1211Ala) rs1555224110
NM_006231.3(POLE):c.3634A>G (p.Met1212Val) rs1565946789
NM_006231.3(POLE):c.3635T>C (p.Met1212Thr) rs1565946781
NM_006231.3(POLE):c.3652G>A (p.Val1218Ile) rs756246229
NM_006231.3(POLE):c.3664C>T (p.His1222Tyr) rs1555224105
NM_006231.3(POLE):c.3668C>G (p.Pro1223Arg)
NM_006231.3(POLE):c.3670G>T (p.Ala1224Ser) rs369338222
NM_006231.3(POLE):c.3670_3671delinsTT (p.Ala1224Leu) rs864622698
NM_006231.3(POLE):c.3671C>T (p.Ala1224Val) rs375208564
NM_006231.3(POLE):c.3672_3674dupAGC rs750939989
NM_006231.3(POLE):c.3677C>T (p.Pro1226Leu) rs1390451656
NM_006231.3(POLE):c.3677_3678del (p.Pro1226fs) rs765645032
NM_006231.3(POLE):c.3685G>A (p.Val1229Met) rs1565946654
NM_006231.3(POLE):c.3692G>A (p.Arg1231Lys) rs1271903915
NM_006231.3(POLE):c.3694A>G (p.Lys1232Glu) rs748763589
NM_006231.3(POLE):c.3695A>C (p.Lys1232Thr) rs774999422
NM_006231.3(POLE):c.3695A>G (p.Lys1232Arg) rs774999422
NM_006231.3(POLE):c.3696G>T (p.Lys1232Asn)
NM_006231.3(POLE):c.3698G>A (p.Arg1233Gln) rs201738371
NM_006231.3(POLE):c.3713G>A (p.Ser1238Asn) rs879255392
NM_006231.3(POLE):c.3716A>G (p.Gln1239Arg) rs146210785
NM_006231.3(POLE):c.3720G>T (p.Glu1240Asp) rs1565946565
NM_006231.3(POLE):c.3721_3722inv (p.Glu1241Ser)
NM_006231.3(POLE):c.3725C>G (p.Ser1242Cys) rs373213156
NM_006231.3(POLE):c.3725C>T (p.Ser1242Phe) rs373213156
NM_006231.3(POLE):c.3727C>T (p.Gln1243Ter) rs949436167
NM_006231.3(POLE):c.3733C>T (p.Leu1245Phe) rs1431438300
NM_006231.3(POLE):c.3737C>G (p.Thr1246Arg) rs750902578
NM_006231.3(POLE):c.3737C>T (p.Thr1246Met) rs750902578
NM_006231.3(POLE):c.3740C>T (p.Pro1247Leu) rs572986717
NM_006231.3(POLE):c.3745G>A (p.Val1249Met) rs762626359
NM_006231.3(POLE):c.3757G>C (p.Glu1253Gln)
NM_006231.3(POLE):c.3758A>G (p.Glu1253Gly) rs1483605737
NM_006231.3(POLE):c.3778G>A (p.Ala1260Thr) rs143858927
NM_006231.3(POLE):c.3788C>T (p.Thr1263Ile) rs1555224039
NM_006231.3(POLE):c.3795+5G>A
NM_006231.3(POLE):c.3795+8_3795+13delinsTGGTGATA
NM_006231.3(POLE):c.3796G>A (p.Glu1266Lys)
NM_006231.3(POLE):c.3808G>A (p.Val1270Ile) rs199574832
NM_006231.3(POLE):c.3812G>C (p.Trp1271Ser)
NM_006231.3(POLE):c.3813G>A (p.Trp1271Ter) rs1274554341
NM_006231.3(POLE):c.3817C>T (p.Arg1273Trp) rs758784435
NM_006231.3(POLE):c.3818G>A (p.Arg1273Gln)
NM_006231.3(POLE):c.3818G>T (p.Arg1273Leu) rs377324348
NM_006231.3(POLE):c.3833A>G (p.Lys1278Arg)
NM_006231.3(POLE):c.3850C>T (p.Arg1284Trp) rs753426630
NM_006231.3(POLE):c.3856C>T (p.Arg1286Cys) rs373170535
NM_006231.3(POLE):c.3857G>A (p.Arg1286His) rs771823596
NM_006231.3(POLE):c.3858_3881del (p.Ala1288_Leu1295del) rs759449495
NM_006231.3(POLE):c.3863C>T (p.Ala1288Val) rs1467975024
NM_006231.3(POLE):c.3865C>A (p.Arg1289Ser) rs770036124
NM_006231.3(POLE):c.3865C>T (p.Arg1289Cys) rs770036124
NM_006231.3(POLE):c.3866G>A (p.Arg1289His) rs781298285
NM_006231.3(POLE):c.3867C>T (p.Arg1289=)
NM_006231.3(POLE):c.3870G>C (p.Arg1290Ser) rs1206673155
NM_006231.3(POLE):c.3872A>G (p.Lys1291Arg) rs878854864
NM_006231.3(POLE):c.3880C>T (p.Arg1294Cys) rs770966534
NM_006231.3(POLE):c.3881G>T (p.Arg1294Leu) rs115455318
NM_006231.3(POLE):c.3883C>A (p.Leu1295Met) rs1184724406
NM_006231.3(POLE):c.3890C>T (p.Ser1297Leu) rs746585658
NM_006231.3(POLE):c.3892G>A (p.Ala1298Thr)
NM_006231.3(POLE):c.38C>T (p.Pro13Leu) rs878854865
NM_006231.3(POLE):c.3904C>T (p.Leu1302Phe) rs1555223949
NM_006231.3(POLE):c.3905T>C (p.Leu1302Pro) rs766058852
NM_006231.3(POLE):c.3914G>A (p.Gly1305Glu) rs761617609
NM_006231.3(POLE):c.3914G>C (p.Gly1305Ala) rs761617609
NM_006231.3(POLE):c.3916G>A (p.Ala1306Thr) rs774219559
NM_006231.3(POLE):c.3919A>G (p.Ile1307Val) rs1000912264
NM_006231.3(POLE):c.3922C>T (p.Arg1308Trp) rs763854815
NM_006231.3(POLE):c.3923G>A (p.Arg1308Gln) rs759793243
NM_006231.3(POLE):c.3925G>A (p.Asp1309Asn) rs1555223943
NM_006231.3(POLE):c.3925G>T (p.Asp1309Tyr) rs1555223943
NM_006231.3(POLE):c.3926A>G (p.Asp1309Gly) rs776828609
NM_006231.3(POLE):c.3932C>T (p.Pro1311Leu) rs1042198717
NM_006231.3(POLE):c.3934G>A (p.Ala1312Thr) rs1565945759
NM_006231.3(POLE):c.3937A>G (p.Thr1313Ala) rs878854866
NM_006231.3(POLE):c.3938C>T (p.Thr1313Met)
NM_006231.3(POLE):c.3939G>A (p.Thr1313=) rs150282789
NM_006231.3(POLE):c.3942G>T (p.Gly1314=) rs1177628476
NM_006231.3(POLE):c.3946G>A (p.Gly1316Arg)
NM_006231.3(POLE):c.3949A>G (p.Ser1317Gly)
NM_006231.3(POLE):c.3958C>T (p.Arg1320Ter) rs754411056
NM_006231.3(POLE):c.3959G>A (p.Arg1320Gln) rs772663586
NM_006231.3(POLE):c.3968C>T (p.Ala1323Val)
NM_006231.3(POLE):c.3970C>T (p.Arg1324Cys) rs779464847
NM_006231.3(POLE):c.3971G>A (p.Arg1324His) rs143981093
NM_006231.3(POLE):c.3971G>T (p.Arg1324Leu) rs143981093
NM_006231.3(POLE):c.3976A>G (p.Ile1326Val) rs557996561
NM_006231.3(POLE):c.3989C>T (p.Pro1330Leu) rs1409584745
NM_006231.3(POLE):c.3997A>G (p.Ile1333Val) rs751467689
NM_006231.3(POLE):c.3G>A (p.Met1Ile) rs1555231433
NM_006231.3(POLE):c.4006-1G>T rs1057519256
NM_006231.3(POLE):c.4006-2A>T
NM_006231.3(POLE):c.4006-3C>A
NM_006231.3(POLE):c.4006-3C>T
NM_006231.3(POLE):c.4006-8C>A rs745486661
NM_006231.3(POLE):c.4012G>A (p.Glu1338Lys) rs751555395
NM_006231.3(POLE):c.4015A>G (p.Thr1339Ala) rs1555223881
NM_006231.3(POLE):c.4018A>G (p.Ser1340Gly)
NM_006231.3(POLE):c.4024G>A (p.Ala1342Thr) rs1301501264
NM_006231.3(POLE):c.4027G>A (p.Gly1343Ser) rs556821288
NM_006231.3(POLE):c.4031T>C (p.Leu1344Pro) rs368111350
NM_006231.3(POLE):c.403C>T (p.Pro135Ser) rs1060500817
NM_006231.3(POLE):c.4045G>C (p.Ala1349Pro) rs1555223876
NM_006231.3(POLE):c.4046C>T (p.Ala1349Val) rs536988344
NM_006231.3(POLE):c.4051G>A (p.Val1351Ile) rs138443282
NM_006231.3(POLE):c.4055G>C (p.Gly1352Ala) rs147088333
NM_006231.3(POLE):c.4059T>G (p.Ser1353Arg) rs1555223871
NM_006231.3(POLE):c.4062C>A (p.Asp1354Glu) rs762002242
NM_006231.3(POLE):c.4069T>C (p.Cys1357Arg) rs1565945381
NM_006231.3(POLE):c.4077G>T (p.Arg1359Ser) rs1064796047
NM_006231.3(POLE):c.4079T>C (p.Leu1360Pro) rs1565945357
NM_006231.3(POLE):c.407A>G (p.Lys136Arg) rs752771738
NM_006231.3(POLE):c.4088C>T (p.Pro1363Leu) rs1399456425
NM_006231.3(POLE):c.4090C>T (p.Arg1364Cys) rs770024304
NM_006231.3(POLE):c.4091G>A (p.Arg1364His) rs369171111
NM_006231.3(POLE):c.4100A>G (p.Tyr1367Cys) rs1365073969
NM_006231.3(POLE):c.4102G>A (p.Val1368Met) rs770558983
NM_006231.3(POLE):c.4106A>G (p.Asn1369Ser) rs746524982
NM_006231.3(POLE):c.4111C>T (p.Arg1371Ter) rs151278283
NM_006231.3(POLE):c.4112G>A (p.Arg1371Gln) rs535074635
NM_006231.3(POLE):c.4114G>A (p.Val1372Ile)
NM_006231.3(POLE):c.4122A>T (p.Lys1374Asn) rs878854867
NM_006231.3(POLE):c.4123G>A (p.Ala1375Thr) rs1390398091
NM_006231.3(POLE):c.4123G>T (p.Ala1375Ser) rs1390398091
NM_006231.3(POLE):c.4124C>T (p.Ala1375Val) rs766168647
NM_006231.3(POLE):c.412G>C (p.Asp138His)
NM_006231.3(POLE):c.4133G>T (p.Gly1378Val)
NM_006231.3(POLE):c.4135G>A (p.Ala1379Thr) rs1565945249
NM_006231.3(POLE):c.4139C>T (p.Ser1380Leu) rs762090058
NM_006231.3(POLE):c.4142A>G (p.Tyr1381Cys)
NM_006231.3(POLE):c.4144C>G (p.Arg1382Gly) rs5744904
NM_006231.3(POLE):c.4144C>T (p.Arg1382Cys) rs5744904
NM_006231.3(POLE):c.4145G>A (p.Arg1382His) rs143229302
NM_006231.3(POLE):c.4149+2T>C rs1064796760
NM_006231.3(POLE):c.4149+3A>C rs1358505756
NM_006231.3(POLE):c.4149+3A>G rs1358505756
NM_006231.3(POLE):c.4149+4G>A
NM_006231.3(POLE):c.414T>G (p.Asp138Glu)
NM_006231.3(POLE):c.4150-1G>C rs1372928198
NM_006231.3(POLE):c.4150-8C>A rs760355462
NM_006231.3(POLE):c.4150-8C>G
NM_006231.3(POLE):c.4156C>T (p.Arg1386Trp)
NM_006231.3(POLE):c.4157G>A (p.Arg1386Gln) rs969355093
NM_006231.3(POLE):c.4157G>C (p.Arg1386Pro) rs969355093
NM_006231.3(POLE):c.4168C>T (p.Arg1390Cys) rs768504121
NM_006231.3(POLE):c.4169G>A (p.Arg1390His) rs200776293
NM_006231.3(POLE):c.4172C>G (p.Ser1391Cys) rs149145495
NM_006231.3(POLE):c.4177A>G (p.Met1393Val)
NM_006231.3(POLE):c.4179G>T (p.Met1393Ile) rs778153462
NM_006231.3(POLE):c.4183T>C (p.Tyr1395His)
NM_006231.3(POLE):c.4188_4195delinsA (p.Asn1396fs) rs1555223097
NM_006231.3(POLE):c.4193A>G (p.Tyr1398Cys) rs878854868
NM_006231.3(POLE):c.4193_4194del (p.Leu1397_Tyr1398insTer) rs1323151304
NM_006231.3(POLE):c.4195G>A (p.Glu1399Lys)
NM_006231.3(POLE):c.4195G>C (p.Glu1399Gln) rs5744935
NM_006231.3(POLE):c.4198T>C (p.Tyr1400His) rs761011442
NM_006231.3(POLE):c.4199A>G (p.Tyr1400Cys) rs370971579
NM_006231.3(POLE):c.4213G>A (p.Asp1405Asn)
NM_006231.3(POLE):c.4216A>G (p.Met1406Val) rs1452685600
NM_006231.3(POLE):c.4217T>C (p.Met1406Thr) rs749250454
NM_006231.3(POLE):c.4218G>A (p.Met1406Ile) rs1060500841
NM_006231.3(POLE):c.4220A>T (p.Tyr1407Phe) rs775556994
NM_006231.3(POLE):c.4225G>A (p.Glu1409Lys) rs1060500845
NM_006231.3(POLE):c.4229A>C (p.His1410Pro) rs1313711311
NM_006231.3(POLE):c.4231A>G (p.Ile1411Val) rs1233033042
NM_006231.3(POLE):c.4231_4232del (p.Ile1411fs)
NM_006231.3(POLE):c.4233C>G (p.Ile1411Met) rs1555223081
NM_006231.3(POLE):c.424-2A>G rs1555230117
NM_006231.3(POLE):c.4244A>G (p.Asn1415Ser) rs748378612
NM_006231.3(POLE):c.4246G>A (p.Ala1416Thr) rs146711942
NM_006231.3(POLE):c.4247C>T (p.Ala1416Val)
NM_006231.3(POLE):c.4249G>C (p.Glu1417Gln)
NM_006231.3(POLE):c.4249_4251delinsCT (p.Glu1417fs) rs1555223073
NM_006231.3(POLE):c.4267A>G (p.Ile1423Val) rs139498590
NM_006231.3(POLE):c.4270G>A (p.Glu1424Lys) rs575419120
NM_006231.3(POLE):c.4276G>A (p.Val1426Ile) rs775072147
NM_006231.3(POLE):c.427A>C (p.Asn143His) rs889470853
NM_006231.3(POLE):c.427A>G (p.Asn143Asp)
NM_006231.3(POLE):c.4285A>T (p.Thr1429Ser) rs759497382
NM_006231.3(POLE):c.4289A>G (p.Gln1430Arg) rs1060500836
NM_006231.3(POLE):c.4290+1G>A rs1565940214
NM_006231.3(POLE):c.4290+1G>C rs1565940214
NM_006231.3(POLE):c.4291-3delC rs1060500805
NM_006231.3(POLE):c.4291G>C (p.Val1431Leu)
NM_006231.3(POLE):c.4295C>A (p.Pro1432Gln) rs371712284
NM_006231.3(POLE):c.4295C>T (p.Pro1432Leu)
NM_006231.3(POLE):c.42C>T (p.Gly14=)
NM_006231.3(POLE):c.4306C>G (p.Arg1436Gly)
NM_006231.3(POLE):c.4306C>T (p.Arg1436Trp) rs764904030
NM_006231.3(POLE):c.4307G>A (p.Arg1436Gln) rs754518522
NM_006231.3(POLE):c.4307G>C (p.Arg1436Pro)
NM_006231.3(POLE):c.4318C>T (p.His1440Tyr) rs373785842
NM_006231.3(POLE):c.4319A>G (p.His1440Arg) rs1555223013
NM_006231.3(POLE):c.431A>G (p.His144Arg) rs755709875
NM_006231.3(POLE):c.4327_4328TG[5] (p.Val1446fs) rs758487568
NM_006231.3(POLE):c.4329T>G (p.Cys1443Trp) rs1565939772
NM_006231.3(POLE):c.4331T>C (p.Val1444Ala) rs767189495
NM_006231.3(POLE):c.4336G>C (p.Val1446Leu) rs878854869
NM_006231.3(POLE):c.4339G>A (p.Val1447Ile) rs1565939714
NM_006231.3(POLE):c.4343A>G (p.Asn1448Ser) rs150545516
NM_006231.3(POLE):c.434T>C (p.Leu145Ser)
NM_006231.3(POLE):c.4352T>G (p.Leu1451Arg)
NM_006231.3(POLE):c.4354G>A (p.Val1452Met)
NM_006231.3(POLE):c.4357A>T (p.Arg1453Trp) rs1057524305
NM_006231.3(POLE):c.4360C>T (p.His1454Tyr) rs1060500842
NM_006231.3(POLE):c.4370G>T (p.Gly1457Val) rs776534749
NM_006231.3(POLE):c.4371C>T (p.Gly1457=) rs771489059
NM_006231.3(POLE):c.4385C>T (p.Thr1462Ile)
NM_006231.3(POLE):c.4388T>G (p.Phe1463Cys) rs1565939600
NM_006231.3(POLE):c.4390G>C (p.Ala1464Pro) rs778717624
NM_006231.3(POLE):c.4396G>A (p.Glu1466Lys) rs1258004616
NM_006231.3(POLE):c.4396G>C (p.Glu1466Gln) rs1258004616
NM_006231.3(POLE):c.4399C>A (p.His1467Asn)
NM_006231.3(POLE):c.43G>A (p.Ala15Thr) rs1060500788
NM_006231.3(POLE):c.43G>C (p.Ala15Pro)
NM_006231.3(POLE):c.4403T>G (p.Leu1468Arg) rs1555222979
NM_006231.3(POLE):c.4404G>A (p.Leu1468=) rs1565939532
NM_006231.3(POLE):c.4411C>G (p.Arg1471Gly)
NM_006231.3(POLE):c.4411C>T (p.Arg1471Cys) rs528264567
NM_006231.3(POLE):c.4420del (p.Ala1474fs) rs1555222974
NM_006231.3(POLE):c.4427T>G (p.Phe1476Cys) rs985504177
NM_006231.3(POLE):c.4433A>G (p.Tyr1478Cys) rs1162335715
NM_006231.3(POLE):c.4441C>T (p.Pro1481Ser)
NM_006231.3(POLE):c.4444G>C (p.Gly1482Arg) rs759703428
NM_006231.3(POLE):c.4445-2A>C
NM_006231.3(POLE):c.4445-3C>T rs1555222948
NM_006231.3(POLE):c.444G>C (p.Leu148Phe) rs1060500797
NM_006231.3(POLE):c.4450A>C (p.Ile1484Leu) rs772734618
NM_006231.3(POLE):c.4450A>G (p.Ile1484Val) rs772734618
NM_006231.3(POLE):c.4453C>T (p.Arg1485Cys) rs969429633
NM_006231.3(POLE):c.4454G>A (p.Arg1485His)
NM_006231.3(POLE):c.4457A>T (p.His1486Leu) rs1555222928
NM_006231.3(POLE):c.4459A>C (p.Ile1487Leu) rs1555222924
NM_006231.3(POLE):c.4459A>G (p.Ile1487Val) rs1555222924
NM_006231.3(POLE):c.446A>G (p.Lys149Arg) rs374428362
NM_006231.3(POLE):c.4476C>A (p.His1492Gln) rs5744943
NM_006231.3(POLE):c.4477G>A (p.Ala1493Thr) rs748522633
NM_006231.3(POLE):c.4477G>T (p.Ala1493Ser)
NM_006231.3(POLE):c.4480C>G (p.Gln1494Glu) rs1443837551
NM_006231.3(POLE):c.448C>T (p.Arg150Ter) rs775815329
NM_006231.3(POLE):c.4490A>G (p.Lys1497Arg) rs557957962
NM_006231.3(POLE):c.4493C>T (p.Ala1498Val) rs751465593
NM_006231.3(POLE):c.4495C>T (p.Leu1499Phe) rs1555222907
NM_006231.3(POLE):c.449G>A (p.Arg150Gln) rs780775837
NM_006231.3(POLE):c.44C>T (p.Ala15Val) rs1565986587
NM_006231.3(POLE):c.4500C>G (p.Phe1500Leu) rs370543622
NM_006231.3(POLE):c.4501G>A (p.Gly1501Arg) rs758114596
NM_006231.3(POLE):c.4510A>T (p.Ile1504Phe) rs1555222899
NM_006231.3(POLE):c.4513C>G (p.Pro1505Ala) rs878854873
NM_006231.3(POLE):c.4514C>T (p.Pro1505Leu) rs1060500822
NM_006231.3(POLE):c.4522C>G (p.Arg1508Gly) rs766511597
NM_006231.3(POLE):c.4522C>T (p.Arg1508Cys) rs766511597
NM_006231.3(POLE):c.4525A>G (p.Arg1509Gly) rs1060500816
NM_006231.3(POLE):c.4529_4530inv (p.Ala1510Val)
NM_006231.3(POLE):c.452A>G (p.Asn151Ser) rs969812647
NM_006231.3(POLE):c.4532C>T (p.Ser1511Phe) rs1565939011
NM_006231.3(POLE):c.4542del (p.Leu1515fs) rs878854874
NM_006231.3(POLE):c.4544T>G (p.Leu1515Arg)
NM_006231.3(POLE):c.4547A>G (p.Asp1516Gly)
NM_006231.3(POLE):c.4551+2_4551+3delTG rs1251654299
NM_006231.3(POLE):c.4551+3G>A rs1565938943
NM_006231.3(POLE):c.4551T>G (p.Thr1517=) rs1033333357
NM_006231.3(POLE):c.4552-1dup
NM_006231.3(POLE):c.4552-5T>A rs1064795991
NM_006231.3(POLE):c.4552-9T>G
NM_006231.3(POLE):c.4556G>A (p.Arg1519His) rs376530977
NM_006231.3(POLE):c.4558A>G (p.Ser1520Gly) rs1021500357
NM_006231.3(POLE):c.4559G>A (p.Ser1520Asn)
NM_006231.3(POLE):c.4559G>T (p.Ser1520Ile)
NM_006231.3(POLE):c.4562A>G (p.Asn1521Ser) rs1565938621
NM_006231.3(POLE):c.4568T>C (p.Met1523Thr)
NM_006231.3(POLE):c.4574G>C (p.Ser1525Thr)
NM_006231.3(POLE):c.4582G>A (p.Ala1528Thr) rs373468985
NM_006231.3(POLE):c.4582G>T (p.Ala1528Ser)
NM_006231.3(POLE):c.4583C>T (p.Ala1528Val) rs1292909825
NM_006231.3(POLE):c.4589A>G (p.Tyr1530Cys)
NM_006231.3(POLE):c.4592C>T (p.Ser1531Leu) rs1555222764
NM_006231.3(POLE):c.4593_4611del (p.Ala1532fs)
NM_006231.3(POLE):c.4599G>C (p.Glu1533Asp)
NM_006231.3(POLE):c.459C>G (p.Ile153Met) rs371147799
NM_006231.3(POLE):c.4600C>T (p.His1534Tyr)
NM_006231.3(POLE):c.4603G>A (p.Gly1535Ser) rs138564205
NM_006231.3(POLE):c.4605_4607CCT[2] (p.Leu1538del) rs1555222739
NM_006231.3(POLE):c.4607T>G (p.Leu1536Arg)
NM_006231.3(POLE):c.4609C>T (p.Leu1537Phe)
NM_006231.3(POLE):c.4610T>A (p.Leu1537His) rs1555222743
NM_006231.3(POLE):c.4615G>A (p.Glu1539Lys)
NM_006231.3(POLE):c.4616A>G (p.Glu1539Gly)
NM_006231.3(POLE):c.461G>A (p.Arg154Lys) rs769882912
NM_006231.3(POLE):c.462G>C (p.Arg154Ser) rs555774342
NM_006231.3(POLE):c.462G>T (p.Arg154Ser)
NM_006231.3(POLE):c.4630G>C (p.Glu1544Gln) rs1555222735
NM_006231.3(POLE):c.4631dup (p.Leu1545fs) rs1555222731
NM_006231.3(POLE):c.4637T>G (p.Leu1546Arg) rs1565938434
NM_006231.3(POLE):c.4642C>A (p.Pro1548Thr) rs1555222725
NM_006231.3(POLE):c.4642C>T (p.Pro1548Ser) rs1555222725
NM_006231.3(POLE):c.4643C>T (p.Pro1548Leu)
NM_006231.3(POLE):c.4645C>A (p.Pro1549Thr) rs147500308
NM_006231.3(POLE):c.4645C>T (p.Pro1549Ser) rs147500308
NM_006231.3(POLE):c.4646C>G (p.Pro1549Arg) rs577952179
NM_006231.3(POLE):c.4646C>T (p.Pro1549Leu) rs577952179
NM_006231.3(POLE):c.4647dup (p.Lys1550fs) rs754220952
NM_006231.3(POLE):c.4649A>G (p.Lys1550Arg) rs5744947
NM_006231.3(POLE):c.4650_4651AC[2] (p.Thr1552fs) rs1555222708
NM_006231.3(POLE):c.4651C>T (p.His1551Tyr)
NM_006231.3(POLE):c.4657T>C (p.Phe1553Leu) rs1565938308
NM_006231.3(POLE):c.4660G>A (p.Glu1554Lys) rs143247306
NM_006231.3(POLE):c.4663G>A (p.Val1555Ile) rs1060500799
NM_006231.3(POLE):c.4666C>G (p.Arg1556Gly)
NM_006231.3(POLE):c.4666C>T (p.Arg1556Trp) rs768741587
NM_006231.3(POLE):c.4667G>A (p.Arg1556Gln) rs762965148
NM_006231.3(POLE):c.467C>G (p.Ser156Cys) rs1565979877
NM_006231.3(POLE):c.4680C>G (p.Asp1560Glu) rs774425403
NM_006231.3(POLE):c.4689del (p.Ile1564fs) rs1555222696
NM_006231.3(POLE):c.4689dup (p.Ile1564fs) rs1555222696
NM_006231.3(POLE):c.4691T>C (p.Ile1564Thr) rs1555222691
NM_006231.3(POLE):c.4696A>G (p.Arg1566Gly) rs1365206650
NM_006231.3(POLE):c.46G>A (p.Asp16Asn) rs1241114520
NM_006231.3(POLE):c.46G>C (p.Asp16His) rs1241114520
NM_006231.3(POLE):c.4708C>T (p.Arg1570Ter) rs1037592848
NM_006231.3(POLE):c.4709G>A (p.Arg1570Gln)
NM_006231.3(POLE):c.4720G>A (p.Ala1574Thr) rs878854876
NM_006231.3(POLE):c.4724A>G (p.Tyr1575Cys)
NM_006231.3(POLE):c.4728G>A (p.Lys1576=) rs1555222662
NM_006231.3(POLE):c.4731G>C (p.Glu1577Asp) rs772361606
NM_006231.3(POLE):c.4735C>G (p.Arg1579Gly) rs1060500802
NM_006231.3(POLE):c.4735C>T (p.Arg1579Cys) rs1060500802
NM_006231.3(POLE):c.4736G>A (p.Arg1579His) rs375590443
NM_006231.3(POLE):c.4738C>T (p.Arg1580Trp) rs192908615
NM_006231.3(POLE):c.4739G>A (p.Arg1580Gln) rs201950040
NM_006231.3(POLE):c.4745C>A (p.Pro1582His) rs1555222617
NM_006231.3(POLE):c.4756G>A (p.Ala1586Thr) rs746266857
NM_006231.3(POLE):c.4757C>T (p.Ala1586Val)
NM_006231.3(POLE):c.4759G>A (p.Val1587Ile) rs372388555
NM_006231.3(POLE):c.4759G>C (p.Val1587Leu)
NM_006231.3(POLE):c.4784G>T (p.Arg1595Met) rs1565937889
NM_006231.3(POLE):c.4785G>C (p.Arg1595Ser)
NM_006231.3(POLE):c.4789G>A (p.Ala1597Thr) rs752184541
NM_006231.3(POLE):c.4792A>C (p.Ser1598Arg) rs776538943
NM_006231.3(POLE):c.4796A>G (p.Glu1599Gly) rs762160282
NM_006231.3(POLE):c.4799T>C (p.Ile1600Thr)
NM_006231.3(POLE):c.47A>G (p.Asp16Gly)
NM_006231.3(POLE):c.47A>T (p.Asp16Val)
NM_006231.3(POLE):c.4801C>G (p.Pro1601Ala)
NM_006231.3(POLE):c.4802C>G (p.Pro1601Arg)
NM_006231.3(POLE):c.4809G>A (p.Leu1603=) rs75378940
NM_006231.3(POLE):c.4812G>C (p.Glu1604Asp) rs1064794898
NM_006231.3(POLE):c.4813G>A (p.Glu1605Lys) rs768801696
NM_006231.3(POLE):c.4822C>G (p.Leu1608Val) rs1555222593
NM_006231.3(POLE):c.4823T>G (p.Leu1608Arg) rs1255478620
NM_006231.3(POLE):c.4831A>G (p.Ile1611Val)
NM_006231.3(POLE):c.4835G>C (p.Cys1612Ser) rs1411134935
NM_006231.3(POLE):c.4841C>T (p.Ala1614Val) rs1565937687
NM_006231.3(POLE):c.4843G>A (p.Asp1615Asn) rs1565937674
NM_006231.3(POLE):c.4847A>G (p.Lys1616Arg)
NM_006231.3(POLE):c.484G>C (p.Asp162His) rs759492756
NM_006231.3(POLE):c.4852A>G (p.Asn1618Asp) rs377406943
NM_006231.3(POLE):c.4855T>C (p.Tyr1619His) rs1060500849
NM_006231.3(POLE):c.4856A>G (p.Tyr1619Cys)
NM_006231.3(POLE):c.4872G>A (p.Trp1624Ter) rs754982151
NM_006231.3(POLE):c.4876C>T (p.Arg1626Cys) rs753713315
NM_006231.3(POLE):c.4877G>A (p.Arg1626His) rs766252708
NM_006231.3(POLE):c.4880A>C (p.His1627Pro) rs1274894982
NM_006231.3(POLE):c.4880A>G (p.His1627Arg) rs1274894982
NM_006231.3(POLE):c.4886C>T (p.Ala1629Val) rs1555222573
NM_006231.3(POLE):c.4888C>T (p.Arg1630Trp) rs148076304
NM_006231.3(POLE):c.4889G>A (p.Arg1630Gln) rs750180239
NM_006231.3(POLE):c.4892G>A (p.Arg1631His) rs775590365
NM_006231.3(POLE):c.4894A>G (p.Met1632Val) rs1565937490
NM_006231.3(POLE):c.4900C>T (p.Arg1634Cys) rs769762523
NM_006231.3(POLE):c.4900del (p.Arg1634fs) rs1555222567
NM_006231.3(POLE):c.4901G>A (p.Arg1634His) rs760149463
NM_006231.3(POLE):c.4907A>C (p.Tyr1636Ser) rs1555222562
NM_006231.3(POLE):c.4913A>G (p.Asn1638Ser)
NM_006231.3(POLE):c.4913A>T (p.Asn1638Ile) rs771399151
NM_006231.3(POLE):c.4916T>C (p.Leu1639Pro) rs878854878
NM_006231.3(POLE):c.4917G>A (p.Leu1639=) rs1565937426
NM_006231.3(POLE):c.4924T>C (p.Cys1642Arg)
NM_006231.3(POLE):c.4927C>G (p.Leu1643Val) rs1418072475
NM_006231.3(POLE):c.4931C>T (p.Ser1644Leu) rs771896231
NM_006231.3(POLE):c.4934A>G (p.Gln1645Arg) rs878854879
NM_006231.3(POLE):c.4936G>C (p.Ala1646Pro) rs1555222550
NM_006231.3(POLE):c.4936G>T (p.Ala1646Ser)
NM_006231.3(POLE):c.4942G>A (p.Glu1648Lys) rs532781183
NM_006231.3(POLE):c.4945A>G (p.Met1649Val) rs1565937350
NM_006231.3(POLE):c.4948A>G (p.Ser1650Gly) rs1060500881
NM_006231.3(POLE):c.4949G>A (p.Ser1650Asn)
NM_006231.3(POLE):c.494A>C (p.Lys165Thr) rs1060500782
NM_006231.3(POLE):c.4952+4A>G rs962068207
NM_006231.3(POLE):c.4959del (p.His1654fs)
NM_006231.3(POLE):c.4959dup (p.His1654fs) rs1555222526
NM_006231.3(POLE):c.4963A>G (p.Ile1655Val) rs1060500876
NM_006231.3(POLE):c.4970T>C (p.Ile1657Thr) rs1060500827
NM_006231.3(POLE):c.4985A>C (p.Glu1662Ala)
NM_006231.3(POLE):c.4987G>C (p.Asp1663His) rs753910068
NM_006231.3(POLE):c.4991T>C (p.Ile1664Thr)
NM_006231.3(POLE):c.4994C>T (p.Ser1665Phe) rs1565937052
NM_006231.3(POLE):c.49G>A (p.Gly17Ser) rs1243827536
NM_006231.3(POLE):c.5002G>A (p.Gly1668Ser) rs371348453
NM_006231.3(POLE):c.5003G>T (p.Gly1668Val) rs368735471
NM_006231.3(POLE):c.5008G>A (p.Asp1670Asn) rs1060500823
NM_006231.3(POLE):c.5016_5018delCTT rs1555222501
NM_006231.3(POLE):c.5020G>A (p.Ala1674Thr)
NM_006231.3(POLE):c.5023C>T (p.Arg1675Cys) rs1027297469
NM_006231.3(POLE):c.5035C>T (p.Arg1679Cys) rs768244569
NM_006231.3(POLE):c.5044C>T (p.His1682Tyr)
NM_006231.3(POLE):c.5056C>G (p.Leu1686Val) rs1476020004
NM_006231.3(POLE):c.5060C>A (p.Ser1687Tyr) rs1565936909
NM_006231.3(POLE):c.5060C>T (p.Ser1687Phe)
NM_006231.3(POLE):c.5062C>T (p.Pro1688Ser) rs781114688
NM_006231.3(POLE):c.5068G>A (p.Ala1690Thr)
NM_006231.3(POLE):c.5071C>T (p.Arg1691Cys) rs777599909
NM_006231.3(POLE):c.5081T>C (p.Leu1694Pro) rs1555222481
NM_006231.3(POLE):c.5084G>A (p.Gly1695Asp) rs920535000
NM_006231.3(POLE):c.5084G>T (p.Gly1695Val) rs920535000
NM_006231.3(POLE):c.508A>C (p.Ile170Leu) rs1331686551
NM_006231.3(POLE):c.5090A>G (p.Lys1697Arg) rs879254207
NM_006231.3(POLE):c.5093_5095delAGG rs1555222471
NM_006231.3(POLE):c.5095G>A (p.Ala1699Thr) rs1256635297
NM_006231.3(POLE):c.5102A>T (p.Asp1701Val) rs1565936830
NM_006231.3(POLE):c.5103_5173+29delCAACTGTCTTGTCATGGAGTTCGATGACCAAGCCACTGTTGAGATCAACAGTTCAGGCTGTTACTCCACAGGTAAGTGGGCGGGAGGACGAGGCCCATGA rs1565936576
NM_006231.3(POLE):c.5105A>G (p.Asn1702Ser) rs754086131
NM_006231.3(POLE):c.5108G>C (p.Cys1703Ser) rs961736994
NM_006231.3(POLE):c.5116A>T (p.Met1706Leu) rs1478959461
NM_006231.3(POLE):c.5118G>T (p.Met1706Ile)
NM_006231.3(POLE):c.5121G>T (p.Glu1707Asp) rs750460626
NM_006231.3(POLE):c.5125G>A (p.Asp1709Asn) rs572502366
NM_006231.3(POLE):c.5131C>A (p.Gln1711Lys)
NM_006231.3(POLE):c.5140G>T (p.Val1714Phe)
NM_006231.3(POLE):c.5143G>C (p.Glu1715Gln)
NM_006231.3(POLE):c.5149A>G (p.Asn1717Asp)
NM_006231.3(POLE):c.5150A>G (p.Asn1717Ser)
NM_006231.3(POLE):c.5151del (p.Asn1717fs) rs1565936691
NM_006231.3(POLE):c.5152A>G (p.Ser1718Gly) rs374381852
NM_006231.3(POLE):c.5153G>A (p.Ser1718Asn) rs1555222434
NM_006231.3(POLE):c.5168C>T (p.Ser1723Phe) rs996998835
NM_006231.3(POLE):c.5173+1G>T rs1060500866
NM_006231.3(POLE):c.5173+4A>G rs1565936629
NM_006231.3(POLE):c.5173+5del
NM_006231.3(POLE):c.5174-1G>T rs5744954
NM_006231.3(POLE):c.5174-2A>C
NM_006231.3(POLE):c.5174-3C>T rs878854881
NM_006231.3(POLE):c.5174-6G>C rs770466844
NM_006231.3(POLE):c.5174T>C (p.Val1725Ala) rs1064796427
NM_006231.3(POLE):c.5176T>A (p.Cys1726Ser)
NM_006231.3(POLE):c.5180T>A (p.Val1727Glu) rs1384842148
NM_006231.3(POLE):c.5180_5181delTG rs1555222376
NM_006231.3(POLE):c.5189A>G (p.Asp1730Gly) rs1565936260
NM_006231.3(POLE):c.5206G>A (p.Val1736Ile) rs770181299
NM_006231.3(POLE):c.5210A>G (p.Asn1737Ser) rs1565936216
NM_006231.3(POLE):c.5215A>G (p.Ile1739Val) rs1064794641
NM_006231.3(POLE):c.5227C>T (p.His1743Tyr) rs1565936182
NM_006231.3(POLE):c.5229C>A (p.His1743Gln) rs1170880797
NM_006231.3(POLE):c.522_524GAA[2] (p.Lys176del) rs1060500793
NM_006231.3(POLE):c.5233G>A (p.Val1745Ile)
NM_006231.3(POLE):c.5237A>G (p.Asn1746Ser) rs377461656
NM_006231.3(POLE):c.5237A>T (p.Asn1746Ile) rs377461656
NM_006231.3(POLE):c.5240A>G (p.Asp1747Gly) rs1555222355
NM_006231.3(POLE):c.5245G>T (p.Glu1749Ter)
NM_006231.3(POLE):c.524A>G (p.Lys175Arg) rs1555230082
NM_006231.3(POLE):c.5252C>T (p.Ala1751Val) rs1555222349
NM_006231.3(POLE):c.5260A>C (p.Met1754Leu)
NM_006231.3(POLE):c.5264G>A (p.Gly1755Glu) rs760235113
NM_006231.3(POLE):c.5265del (p.Ile1756fs) rs1555222342
NM_006231.3(POLE):c.5266A>G (p.Ile1756Val)
NM_006231.3(POLE):c.5267T>A (p.Ile1756Asn) rs199535980
NM_006231.3(POLE):c.5270G>T (p.Ser1757Ile) rs878854882
NM_006231.3(POLE):c.5275G>A (p.Asp1759Asn) rs768559928
NM_006231.3(POLE):c.5275G>T (p.Asp1759Tyr)
NM_006231.3(POLE):c.5278del (p.Asp1759_Val1760insTer) rs1565935966
NM_006231.3(POLE):c.5288A>G (p.Gln1763Arg) rs1565935906
NM_006231.3(POLE):c.5290G>A (p.Ala1764Thr)
NM_006231.3(POLE):c.5290G>C (p.Ala1764Pro) rs1315730296
NM_006231.3(POLE):c.5291C>T (p.Ala1764Val) rs1285538355
NM_006231.3(POLE):c.5293T>C (p.Ser1765Pro)
NM_006231.3(POLE):c.52G>C (p.Glu18Gln)
NM_006231.3(POLE):c.52G>T (p.Glu18Ter) rs1555231403
NM_006231.3(POLE):c.5305A>G (p.Met1769Val) rs1449742140
NM_006231.3(POLE):c.5312C>T (p.Thr1771Met) rs777695766
NM_006231.3(POLE):c.5317G>A (p.Gly1773Ser) rs1565935798
NM_006231.3(POLE):c.5326G>T (p.Ala1776Ser) rs748644914
NM_006231.3(POLE):c.5327C>A (p.Ala1776Asp) rs779305242
NM_006231.3(POLE):c.5332G>A (p.Ala1778Thr) rs755346486
NM_006231.3(POLE):c.5335C>T (p.Pro1779Ser)
NM_006231.3(POLE):c.5336C>T (p.Pro1779Leu)
NM_006231.3(POLE):c.5336del (p.Pro1779fs)
NM_006231.3(POLE):c.5339C>G (p.Ala1780Gly) rs1024088828
NM_006231.3(POLE):c.5341A>G (p.Ser1781Gly)
NM_006231.3(POLE):c.5342G>C (p.Ser1781Thr)
NM_006231.3(POLE):c.5345A>G (p.Tyr1782Cys)
NM_006231.3(POLE):c.5347G>A (p.Asp1783Asn) rs149893630
NM_006231.3(POLE):c.5347G>C (p.Asp1783His) rs149893630
NM_006231.3(POLE):c.5350G>A (p.Glu1784Lys) rs1555222266
NM_006231.3(POLE):c.5352G>C (p.Glu1784Asp) rs1555222265
NM_006231.3(POLE):c.5361del (p.Cys1788fs) rs752558475
NM_006231.3(POLE):c.5363G>A (p.Cys1788Tyr) rs1565935614
NM_006231.3(POLE):c.5367dup (p.Asn1790Ter) rs959133191
NM_006231.3(POLE):c.5378+5C>T rs1171630569
NM_006231.3(POLE):c.5378+6A>G rs1380872711
NM_006231.3(POLE):c.5379-3C>A rs1415497701
NM_006231.3(POLE):c.5379-3C>G rs1415497701
NM_006231.3(POLE):c.5379-5T>C rs761910924
NM_006231.3(POLE):c.5382C>G (p.Ile1794Met) rs368364666
NM_006231.3(POLE):c.538C>T (p.Gln180Ter) rs1565979764
NM_006231.3(POLE):c.5390G>A (p.Ser1797Asn) rs749755939
NM_006231.3(POLE):c.5392A>G (p.Met1798Val) rs1555221940
NM_006231.3(POLE):c.5395G>A (p.Val1799Ile) rs780525568
NM_006231.3(POLE):c.5395G>T (p.Val1799Phe)
NM_006231.3(POLE):c.5398G>A (p.Val1800Met) rs199777048
NM_006231.3(POLE):c.5401G>T (p.Gly1801Cys) rs1447287662
NM_006231.3(POLE):c.5402G>A (p.Gly1801Asp) rs1060500803
NM_006231.3(POLE):c.5407G>A (p.Val1803Met) rs1555221935
NM_006231.3(POLE):c.5420C>G (p.Thr1807Ser) rs1565933242
NM_006231.3(POLE):c.5420C>T (p.Thr1807Ile)
NM_006231.3(POLE):c.5422C>G (p.Gln1808Glu) rs1167794021
NM_006231.3(POLE):c.5423A>G (p.Gln1808Arg) rs1060500811
NM_006231.3(POLE):c.5423del (p.Gln1808fs) rs1565933220
NM_006231.3(POLE):c.5424G>C (p.Gln1808His) rs1555221929
NM_006231.3(POLE):c.5429A>T (p.His1810Leu) rs777390504
NM_006231.3(POLE):c.542A>T (p.Asp181Val) rs1555230076
NM_006231.3(POLE):c.5432A>G (p.Asn1811Ser) rs1565933181
NM_006231.3(POLE):c.5434A>G (p.Ile1812Val)
NM_006231.3(POLE):c.5438A>G (p.Tyr1813Cys)
NM_006231.3(POLE):c.5438A>T (p.Tyr1813Phe) rs752559134
NM_006231.3(POLE):c.5464_5466dup (p.Tyr1822dup) rs773960177
NM_006231.3(POLE):c.5467C>T (p.Arg1823Cys) rs753627422
NM_006231.3(POLE):c.5468G>A (p.Arg1823His) rs767747669
NM_006231.3(POLE):c.5468G>C (p.Arg1823Pro)
NM_006231.3(POLE):c.5476C>T (p.Arg1826Trp) rs762000608
NM_006231.3(POLE):c.5477G>A (p.Arg1826Gln) rs1555221919
NM_006231.3(POLE):c.547G>A (p.Ala183Thr) rs993340577
NM_006231.3(POLE):c.5480C>T (p.Ser1827Leu) rs763031537
NM_006231.3(POLE):c.5484del (p.Ser1829fs) rs1555221914
NM_006231.3(POLE):c.5487_5488CT[2] (p.Leu1831fs) rs878854883
NM_006231.3(POLE):c.5492T>C (p.Leu1831Pro) rs781674901
NM_006231.3(POLE):c.5494C>T (p.Leu1832Phe) rs1456049352
NM_006231.3(POLE):c.5498A>G (p.His1833Arg)
NM_006231.3(POLE):c.54G>C (p.Glu18Asp) rs1311350422
NM_006231.3(POLE):c.5507C>T (p.Ala1836Val) rs780776704
NM_006231.3(POLE):c.550A>C (p.Ser184Arg) rs1060500790
NM_006231.3(POLE):c.5515C>T (p.Arg1839Cys) rs141519273
NM_006231.3(POLE):c.5516G>A (p.Arg1839His) rs370512955
NM_006231.3(POLE):c.5525A>G (p.His1842Arg) rs1060500795
NM_006231.3(POLE):c.5525_5527ACA[1] (p.Asn1843del) rs868246375
NM_006231.3(POLE):c.5527A>C (p.Asn1843His)
NM_006231.3(POLE):c.5528A>G (p.Asn1843Ser) rs753680242
NM_006231.3(POLE):c.5536_5538AAG[1] (p.Lys1847del) rs1060500844
NM_006231.3(POLE):c.5539A>C (p.Lys1847Gln)
NM_006231.3(POLE):c.553G>A (p.Asp185Asn) rs369506007
NM_006231.3(POLE):c.5542C>T (p.Leu1848Phe) rs201001790
NM_006231.3(POLE):c.5549T>A (p.Leu1850Gln) rs1565932919
NM_006231.3(POLE):c.5553-1G>A rs1064796152
NM_006231.3(POLE):c.5558T>C (p.Ile1853Thr) rs1057519257
NM_006231.3(POLE):c.5560G>A (p.Ala1854Thr) rs557167678
NM_006231.3(POLE):c.5560G>T (p.Ala1854Ser) rs557167678
NM_006231.3(POLE):c.5566T>C (p.Phe1856Leu) rs1060500846
NM_006231.3(POLE):c.5569A>G (p.Lys1857Glu) rs773659817
NM_006231.3(POLE):c.556G>A (p.Ala186Thr) rs375213599
NM_006231.3(POLE):c.5570A>T (p.Lys1857Met) rs5744971
NM_006231.3(POLE):c.5572C>T (p.Arg1858Cys) rs1193081581
NM_006231.3(POLE):c.5573G>A (p.Arg1858His) rs1445288473
NM_006231.3(POLE):c.5575C>G (p.Leu1859Val) rs184253572
NM_006231.3(POLE):c.5578G>C (p.Gly1860Arg) rs144343630
NM_006231.3(POLE):c.557C>T (p.Ala186Val) rs151325267
NM_006231.3(POLE):c.5591T>C (p.Ile1864Thr) rs896266569
NM_006231.3(POLE):c.5596G>A (p.Ala1866Thr) rs377662540
NM_006231.3(POLE):c.5608C>T (p.Arg1870Cys) rs138231414
NM_006231.3(POLE):c.5609G>A (p.Arg1870His) rs758619238
NM_006231.3(POLE):c.5611A>G (p.Ile1871Val) rs752955761
NM_006231.3(POLE):c.5617C>A (p.Leu1873Ile)
NM_006231.3(POLE):c.5632C>G (p.Arg1878Gly)
NM_006231.3(POLE):c.5632C>T (p.Arg1878Cys) rs199979862
NM_006231.3(POLE):c.5633G>A (p.Arg1878His) rs374022997
NM_006231.3(POLE):c.5635C>T (p.Arg1879Cys) rs767012802
NM_006231.3(POLE):c.5636G>C (p.Arg1879Pro)
NM_006231.3(POLE):c.5638G>T (p.Val1880Leu)
NM_006231.3(POLE):c.5639T>C (p.Val1880Ala)
NM_006231.3(POLE):c.563C>T (p.Thr188Ile) rs1565979672
NM_006231.3(POLE):c.5653G>A (p.Ala1885Thr) rs748008084
NM_006231.3(POLE):c.5653G>T (p.Ala1885Ser) rs748008084
NM_006231.3(POLE):c.5658C>A (p.Tyr1886Ter)
NM_006231.3(POLE):c.565G>C (p.Ala189Pro) rs1555230056
NM_006231.3(POLE):c.5662G>A (p.Glu1888Lys) rs368363850
NM_006231.3(POLE):c.5668A>G (p.Ile1890Val) rs745804149
NM_006231.3(POLE):c.566C>G (p.Ala189Gly)
NM_006231.3(POLE):c.5670C>G (p.Ile1890Met)
NM_006231.3(POLE):c.5672_5674del (p.Thr1891del) rs769630098
NM_006231.3(POLE):c.5678+1G>A
NM_006231.3(POLE):c.5678+3G>A rs1060500826
NM_006231.3(POLE):c.5678+5G>A rs779223088
NM_006231.3(POLE):c.5678+6G>C
NM_006231.3(POLE):c.5678+6G>T
NM_006231.3(POLE):c.5679-3C>T rs1555221512
NM_006231.3(POLE):c.5691G>C (p.Lys1897Asn)
NM_006231.3(POLE):c.5694G>T (p.Glu1898Asp) rs1555221506
NM_006231.3(POLE):c.569T>C (p.Leu190Pro) rs1565979656
NM_006231.3(POLE):c.5703T>A (p.His1901Gln)
NM_006231.3(POLE):c.5726G>A (p.Arg1909Gln) rs201455049
NM_006231.3(POLE):c.5730C>G (p.Cys1910Trp)
NM_006231.3(POLE):c.5739_5741TCT[1] (p.Leu1915del) rs1565930056
NM_006231.3(POLE):c.5744T>C (p.Leu1915Pro)
NM_006231.3(POLE):c.574T>C (p.Ser192Pro) rs1555230047
NM_006231.3(POLE):c.5756C>T (p.Pro1919Leu) rs1235640927
NM_006231.3(POLE):c.5758T>C (p.Ser1920Pro) rs1565930031
NM_006231.3(POLE):c.575C>T (p.Ser192Phe) rs1060500891
NM_006231.3(POLE):c.5761A>G (p.Asn1921Asp) rs771980261
NM_006231.3(POLE):c.5763C>G (p.Asn1921Lys) rs113976595
NM_006231.3(POLE):c.5770G>A (p.Gly1924Arg) rs371862779
NM_006231.3(POLE):c.5777A>G (p.Lys1926Arg) rs757847276
NM_006231.3(POLE):c.577A>G (p.Ser193Gly) rs760588718
NM_006231.3(POLE):c.578+1G>A rs1565979631
NM_006231.3(POLE):c.5783_5784del (p.Lys1928fs)
NM_006231.3(POLE):c.5792C>G (p.Ser1931Cys)
NM_006231.3(POLE):c.5792C>T (p.Ser1931Phe) rs879254232
NM_006231.3(POLE):c.5794C>T (p.Arg1932Cys) rs879254168
NM_006231.3(POLE):c.5795G>A (p.Arg1932His) rs778190944
NM_006231.3(POLE):c.5797A>G (p.Ile1933Val) rs758762868
NM_006231.3(POLE):c.5809C>G (p.Leu1937Val) rs1555221482
NM_006231.3(POLE):c.5811+3_5811+4dup rs1565929922
NM_006231.3(POLE):c.5811+5G>A rs562946055
NM_006231.3(POLE):c.5811+6C>T
NM_006231.3(POLE):c.5811G>A (p.Leu1937=) rs368174082
NM_006231.3(POLE):c.5813A>C (p.Gln1938Pro)
NM_006231.3(POLE):c.5829_5830del (p.Gly1945fs) rs878854885
NM_006231.3(POLE):c.5834G>A (p.Gly1945Glu)
NM_006231.3(POLE):c.5836G>A (p.Ala1946Thr) rs772611021
NM_006231.3(POLE):c.5838_5839AG[1] (p.Glu1947fs) rs1565928712
NM_006231.3(POLE):c.5839G>A (p.Glu1947Lys) rs1382652919
NM_006231.3(POLE):c.5843A>G (p.Asp1948Gly)
NM_006231.3(POLE):c.5845G>A (p.Glu1949Lys) rs779394509
NM_006231.3(POLE):c.5848_5868dup (p.Gln1950_Glu1956dup) rs1302016488
NM_006231.3(POLE):c.5851G>A (p.Glu1951Lys)
NM_006231.3(POLE):c.5860_5861delinsTT (p.Asp1954Phe) rs1555221216
NM_006231.3(POLE):c.5863G>A (p.Asp1955Asn)
NM_006231.3(POLE):c.5863G>T (p.Asp1955Tyr)
NM_006231.3(POLE):c.5865_5885dup (p.Asp1955_Gly1961dup)
NM_006231.3(POLE):c.5866G>A (p.Glu1956Lys) rs749992643
NM_006231.3(POLE):c.5869G>C (p.Glu1957Gln)
NM_006231.3(POLE):c.5878G>T (p.Asp1960Tyr) rs1565928596
NM_006231.3(POLE):c.587A>G (p.Gln196Arg) rs770126315
NM_006231.3(POLE):c.5883_5885GGA[2] (p.Glu1965_Glu1966del) rs757774039
NM_006231.3(POLE):c.5888_5914dup (p.Glu1963_Asn1971dup) rs778066364
NM_006231.3(POLE):c.588G>T (p.Gln196His) rs878854886
NM_006231.3(POLE):c.58A>C (p.Ser20Arg)
NM_006231.3(POLE):c.58A>G (p.Ser20Gly)
NM_006231.3(POLE):c.5900C>T (p.Ala1967Val) rs201273415
NM_006231.3(POLE):c.5909C>T (p.Ser1970Phe)
NM_006231.3(POLE):c.590G>C (p.Arg197Thr) rs528361482
NM_006231.3(POLE):c.5912A>G (p.Asn1971Ser) rs772127913
NM_006231.3(POLE):c.5912_5913insAGTGGAGGAATCCAA (p.Asn1971_Val1972insLysValGluGluSer) rs878854887
NM_006231.3(POLE):c.5914G>A (p.Val1972Met)
NM_006231.3(POLE):c.5920G>T (p.Asp1974Tyr) rs1555221203
NM_006231.3(POLE):c.5926C>A (p.Leu1976Met) rs1555221202
NM_006231.3(POLE):c.5926_5929delinsA (p.Leu1976_Glu1977delinsLys) rs1565928471
NM_006231.3(POLE):c.592G>A (p.Gly198Ser) rs1565978171
NM_006231.3(POLE):c.5932_5942del (p.Asn1978fs) rs1555221197
NM_006231.3(POLE):c.5936A>C (p.Asn1979Thr) rs775893052
NM_006231.3(POLE):c.5936A>G (p.Asn1979Ser)
NM_006231.3(POLE):c.5940G>A (p.Trp1980Ter) rs1470483579
NM_006231.3(POLE):c.5941A>G (p.Asn1981Asp)
NM_006231.3(POLE):c.5942A>G (p.Asn1981Ser) rs1565928438
NM_006231.3(POLE):c.5957T>C (p.Leu1986Ser)
NM_006231.3(POLE):c.595G>A (p.Gly199Ser) rs776540681
NM_006231.3(POLE):c.5965del (p.Ala1989fs) rs1555221193
NM_006231.3(POLE):c.5968G>C (p.Ala1990Pro) rs1313175914
NM_006231.3(POLE):c.596G>T (p.Gly199Val)
NM_006231.3(POLE):c.5972C>G (p.Ser1991Cys)
NM_006231.3(POLE):c.5975G>T (p.Cys1992Phe)
NM_006231.3(POLE):c.5989C>T (p.Leu1997Phe)
NM_006231.3(POLE):c.5C>T (p.Ser2Phe) rs1060500890
NM_006231.3(POLE):c.6002C>G (p.Ser2001Ter) rs1565928374
NM_006231.3(POLE):c.6004+5G>T rs372169366
NM_006231.3(POLE):c.6005C>T (p.Ala2002Val) rs1247397969
NM_006231.3(POLE):c.6013G>A (p.Val2005Met) rs1060500812
NM_006231.3(POLE):c.6013G>T (p.Val2005Leu) rs1060500812
NM_006231.3(POLE):c.6016G>T (p.Ala2006Ser) rs1328375671
NM_006231.3(POLE):c.6017C>T (p.Ala2006Val) rs746545942
NM_006231.3(POLE):c.6019G>A (p.Val2007Met) rs748106601
NM_006231.3(POLE):c.6019G>C (p.Val2007Leu) rs748106601
NM_006231.3(POLE):c.6023del (p.Tyr2008fs)
NM_006231.3(POLE):c.6026A>G (p.His2009Arg)
NM_006231.3(POLE):c.6026del (p.His2009fs) rs1565927314
NM_006231.3(POLE):c.6029G>A (p.Cys2010Tyr) rs1471000462
NM_006231.3(POLE):c.6030C>T (p.Cys2010=) rs1555220994
NM_006231.3(POLE):c.6033G>A (p.Met2011Ile) rs754773239
NM_006231.3(POLE):c.6040G>A (p.Gly2014Arg) rs767749736
NM_006231.3(POLE):c.6040G>T (p.Gly2014Trp) rs767749736
NM_006231.3(POLE):c.6041G>A (p.Gly2014Glu)
NM_006231.3(POLE):c.6049C>T (p.Arg2017Cys) rs115452769
NM_006231.3(POLE):c.604A>G (p.Thr202Ala)
NM_006231.3(POLE):c.6050G>A (p.Arg2017His) rs144178150
NM_006231.3(POLE):c.6053G>A (p.Ser2018Asn)
NM_006231.3(POLE):c.605_606delinsTC (p.Thr202Ile)
NM_006231.3(POLE):c.6065G>A (p.Ser2022Asn) rs905858506
NM_006231.3(POLE):c.6067A>G (p.Thr2023Ala)
NM_006231.3(POLE):c.6068C>A (p.Thr2023Asn) rs771628123
NM_006231.3(POLE):c.6068C>T (p.Thr2023Ile) rs771628123
NM_006231.3(POLE):c.6072del (p.Pro2024_Val2025insTer) rs754630848
NM_006231.3(POLE):c.6073G>A (p.Val2025Met) rs995579204
NM_006231.3(POLE):c.6082A>G (p.Arg2028Gly)
NM_006231.3(POLE):c.6083G>C (p.Arg2028Thr) rs749132017
NM_006231.3(POLE):c.6086G>A (p.Gly2029Glu) rs879254239
NM_006231.3(POLE):c.6088del (p.Ala2030fs) rs1060500809
NM_006231.3(POLE):c.6097C>G (p.Leu2033Val)
NM_006231.3(POLE):c.6098_6099TC[3] (p.Gln2035fs)
NM_006231.3(POLE):c.6101C>T (p.Ser2034Phe) rs1060500834
NM_006231.3(POLE):c.6103C>T (p.Gln2035Ter)
NM_006231.3(POLE):c.6106G>A (p.Glu2036Lys) rs1565927123
NM_006231.3(POLE):c.6107A>G (p.Glu2036Gly) rs751818136
NM_006231.3(POLE):c.6107A>T (p.Glu2036Val) rs751818136
NM_006231.3(POLE):c.6112G>A (p.Glu2038Lys) rs181570274
NM_006231.3(POLE):c.6116G>A (p.Gly2039Glu) rs1555220961
NM_006231.3(POLE):c.6119C>T (p.Ala2040Val) rs5745021
NM_006231.3(POLE):c.6124G>A (p.Gly2042Arg) rs147954675
NM_006231.3(POLE):c.6130C>T (p.Leu2044Phe) rs1060500801
NM_006231.3(POLE):c.6133C>G (p.Pro2045Ala) rs910631094
NM_006231.3(POLE):c.6134C>G (p.Pro2045Arg) rs1555220951
NM_006231.3(POLE):c.6135C>T (p.Pro2045=) rs368662693
NM_006231.3(POLE):c.6136+1G>T
NM_006231.3(POLE):c.6136+5G>A rs1555220949
NM_006231.3(POLE):c.6136+6C>T
NM_006231.3(POLE):c.6136G>A (p.Gly2046Arg) rs1462887616
NM_006231.3(POLE):c.6140T>G (p.Met2047Arg) rs1060500829
NM_006231.3(POLE):c.6145A>G (p.Thr2049Ala)
NM_006231.3(POLE):c.6146C>A (p.Thr2049Asn) rs1315503524
NM_006231.3(POLE):c.6148T>C (p.Phe2050Leu)
NM_006231.3(POLE):c.6156G>A (p.Gln2052=) rs149841283
NM_006231.3(POLE):c.6161A>C (p.Tyr2054Ser)
NM_006231.3(POLE):c.6166G>A (p.Ala2056Thr) rs58916399
NM_006231.3(POLE):c.6166G>T (p.Ala2056Ser)
NM_006231.3(POLE):c.6173A>G (p.Glu2058Gly)
NM_006231.3(POLE):c.6179C>A (p.Thr2060Asn) rs761423995
NM_006231.3(POLE):c.6179C>G (p.Thr2060Ser)
NM_006231.3(POLE):c.6188T>G (p.Phe2063Cys) rs1410600023
NM_006231.3(POLE):c.62+1G>C rs1565986506
NM_006231.3(POLE):c.62+3G>A
NM_006231.3(POLE):c.62+5G>A rs1037695225
NM_006231.3(POLE):c.62+6G>A rs1060500861
NM_006231.3(POLE):c.6205A>G (p.Lys2069Glu) rs1555220903
NM_006231.3(POLE):c.6207G>T (p.Lys2069Asn)
NM_006231.3(POLE):c.6208A>G (p.Ile2070Val) rs763607284
NM_006231.3(POLE):c.620C>G (p.Thr207Ser) rs748503586
NM_006231.3(POLE):c.6223A>G (p.Thr2075Ala) rs1326812680
NM_006231.3(POLE):c.6224C>T (p.Thr2075Ile)
NM_006231.3(POLE):c.6232C>T (p.Arg2078Trp) rs1060500867
NM_006231.3(POLE):c.6233G>A (p.Arg2078Gln) rs745721448
NM_006231.3(POLE):c.6236_6254del (p.Asn2079fs) rs765923256
NM_006231.3(POLE):c.6244G>A (p.Glu2082Lys) rs1285938402
NM_006231.3(POLE):c.6247C>T (p.Leu2083Phe)
NM_006231.3(POLE):c.6251_6252inv (p.Ser2084Leu)
NM_006231.3(POLE):c.6257T>C (p.Met2086Thr) rs528752399
NM_006231.3(POLE):c.6258G>A (p.Met2086Ile) rs1565926679
NM_006231.3(POLE):c.625A>C (p.Lys209Gln) rs1555229720
NM_006231.3(POLE):c.6262C>T (p.Pro2088Ser) rs749342382
NM_006231.3(POLE):c.6271C>T (p.Pro2091Ser) rs572252265
NM_006231.3(POLE):c.6272C>T (p.Pro2091Leu) rs376093362
NM_006231.3(POLE):c.6273_6280del (p.Gly2092fs)
NM_006231.3(POLE):c.6274G>A (p.Gly2092Ser) rs757559474
NM_006231.3(POLE):c.6278C>T (p.Ser2093Phe)
NM_006231.3(POLE):c.6280C>G (p.His2094Asp)
NM_006231.3(POLE):c.6286C>G (p.Leu2096Val) rs1049603207
NM_006231.3(POLE):c.6287T>G (p.Leu2096Arg)
NM_006231.3(POLE):c.6290T>C (p.Leu2097Pro) rs932532496
NM_006231.3(POLE):c.6298C>G (p.Pro2100Ala) rs562071800
NM_006231.3(POLE):c.6299C>G (p.Pro2100Arg) rs1060500780
NM_006231.3(POLE):c.629A>G (p.Lys210Arg) rs765826619
NM_006231.3(POLE):c.63-?_1794+?dup1732
NM_006231.3(POLE):c.6301G>A (p.Ala2101Thr) rs1395533975
NM_006231.3(POLE):c.6301G>T (p.Ala2101Ser) rs1395533975
NM_006231.3(POLE):c.6308A>C (p.Glu2103Ala) rs1555220870
NM_006231.3(POLE):c.6312C>A (p.Phe2104Leu)
NM_006231.3(POLE):c.6312C>G (p.Phe2104Leu) rs1555220869
NM_006231.3(POLE):c.6313A>G (p.Ile2105Val) rs1555220868
NM_006231.3(POLE):c.6315C>G (p.Ile2105Met)
NM_006231.3(POLE):c.6317A>G (p.Lys2106Arg) rs762471347
NM_006231.3(POLE):c.631A>T (p.Ile211Leu) rs1064796126
NM_006231.3(POLE):c.6322G>A (p.Val2108Met) rs776551240
NM_006231.3(POLE):c.6322G>T (p.Val2108Leu) rs776551240
NM_006231.3(POLE):c.6327C>T (p.Cys2109=) rs371146029
NM_006231.3(POLE):c.6328A>C (p.Lys2110Gln)
NM_006231.3(POLE):c.6328A>G (p.Lys2110Glu) rs746736600
NM_006231.3(POLE):c.632T>C (p.Ile211Thr) rs1555229716
NM_006231.3(POLE):c.6330+1G>A
NM_006231.3(POLE):c.6331-3C>T rs1332510248
NM_006231.3(POLE):c.6334C>G (p.Leu2112Val) rs373443211
NM_006231.3(POLE):c.6335T>C (p.Leu2112Pro)
NM_006231.3(POLE):c.6344A>G (p.Asp2115Gly) rs1555301272
NM_006231.3(POLE):c.6346A>C (p.Thr2116Pro) rs1035102321
NM_006231.3(POLE):c.6349A>G (p.Asn2117Asp) rs1555301269
NM_006231.3(POLE):c.6350A>G (p.Asn2117Ser)
NM_006231.3(POLE):c.6361C>G (p.Gln2121Glu) rs1555301259
NM_006231.3(POLE):c.6372G>T (p.Lys2124Asn) rs1555301255
NM_006231.3(POLE):c.6379C>G (p.Arg2127Gly)
NM_006231.3(POLE):c.6379C>T (p.Arg2127Ter) rs1057517583
NM_006231.3(POLE):c.6380G>A (p.Arg2127Gln)
NM_006231.3(POLE):c.6382G>T (p.Asp2128Tyr)
NM_006231.3(POLE):c.6384C>A (p.Asp2128Glu) rs758101414
NM_006231.3(POLE):c.6391C>T (p.Arg2131Cys) rs369748519
NM_006231.3(POLE):c.6392G>A (p.Arg2131His) rs141954509
NM_006231.3(POLE):c.6392G>T (p.Arg2131Leu) rs141954509
NM_006231.3(POLE):c.6403G>T (p.Val2135Phe) rs878854891
NM_006231.3(POLE):c.6406G>A (p.Gly2136Ser) rs1368640639
NM_006231.3(POLE):c.6408C>T (p.Gly2136=) rs1057524549
NM_006231.3(POLE):c.6409G>A (p.Glu2137Lys) rs879783561
NM_006231.3(POLE):c.6411G>T (p.Glu2137Asp)
NM_006231.3(POLE):c.6414C>G (p.Phe2138Leu) rs969557653
NM_006231.3(POLE):c.641A>G (p.Gln214Arg) rs1555229713
NM_006231.3(POLE):c.6422_6423delinsCC (p.Glu2141Ala) rs878854892
NM_006231.3(POLE):c.6424G>A (p.Ala2142Thr)
NM_006231.3(POLE):c.6428A>G (p.Gln2143Arg)
NM_006231.3(POLE):c.6434G>A (p.Arg2145Gln) rs770009143
NM_006231.3(POLE):c.6434_6438del (p.Arg2145fs) rs1555301223
NM_006231.3(POLE):c.6439C>G (p.Pro2147Ala)
NM_006231.3(POLE):c.6440C>T (p.Pro2147Leu) rs1555301218
NM_006231.3(POLE):c.6445C>T (p.Arg2149Cys) rs771490182
NM_006231.3(POLE):c.6446G>A (p.Arg2149His) rs201165149
NM_006231.3(POLE):c.6448T>C (p.Ser2150Pro)
NM_006231.3(POLE):c.6449C>A (p.Ser2150Tyr)
NM_006231.3(POLE):c.6451T>A (p.Tyr2151Asn)
NM_006231.3(POLE):c.6454G>A (p.Val2152Met) rs138789360
NM_006231.3(POLE):c.6454G>T (p.Val2152Leu) rs138789360
NM_006231.3(POLE):c.6460C>T (p.Pro2154Ser)
NM_006231.3(POLE):c.6470T>C (p.Ile2157Thr) rs1566309064
NM_006231.3(POLE):c.6475C>T (p.Arg2159Cys) rs5745067
NM_006231.3(POLE):c.6476G>A (p.Arg2159His) rs373092830
NM_006231.3(POLE):c.6489C>G (p.Phe2163Leu) rs1566309041
NM_006231.3(POLE):c.6491G>A (p.Cys2164Tyr) rs750401329
NM_006231.3(POLE):c.6493C>T (p.Arg2165Cys) rs369549727
NM_006231.3(POLE):c.6496G>A (p.Asp2166Asn)
NM_006231.3(POLE):c.6498C>A (p.Asp2166Glu)
NM_006231.3(POLE):c.6508T>C (p.Cys2170Arg) rs138094751
NM_006231.3(POLE):c.6511A>G (p.Lys2171Glu)
NM_006231.3(POLE):c.6518C>T (p.Ser2173Phe) rs1555301181
NM_006231.3(POLE):c.6518_6519delCT rs774417192
NM_006231.3(POLE):c.6521C>T (p.Ser2174Phe) rs1555301177
NM_006231.3(POLE):c.652A>G (p.Ile218Val) rs1319446692
NM_006231.3(POLE):c.6531+4C>T rs772586175
NM_006231.3(POLE):c.6531+5G>A rs368538240
NM_006231.3(POLE):c.6531+6G>T rs774747998
NM_006231.3(POLE):c.6536_6537delinsCT (p.Gly2179Ala) rs1060500789
NM_006231.3(POLE):c.6547C>T (p.Pro2183Ser) rs777503236
NM_006231.3(POLE):c.6551A>G (p.Gln2184Arg) rs878854894
NM_006231.3(POLE):c.6553T>C (p.Trp2185Arg)
NM_006231.3(POLE):c.6555G>T (p.Trp2185Cys)
NM_006231.3(POLE):c.6563C>G (p.Ser2188Cys) rs780307061
NM_006231.3(POLE):c.6563C>T (p.Ser2188Phe)
NM_006231.3(POLE):c.6565A>T (p.Asn2189Tyr) rs150345709
NM_006231.3(POLE):c.6575C>T (p.Ala2192Val) rs756301031
NM_006231.3(POLE):c.6581A>G (p.Tyr2194Cys) rs1060500872
NM_006231.3(POLE):c.6581A>T (p.Tyr2194Phe)
NM_006231.3(POLE):c.6583G>A (p.Asp2195Asn) rs1472336573
NM_006231.3(POLE):c.6585_6587CTC[1] (p.Ser2197del) rs1188033351
NM_006231.3(POLE):c.658G>A (p.Asp220Asn) rs1060500824
NM_006231.3(POLE):c.6593C>A (p.Ala2198Asp) rs1555301083
NM_006231.3(POLE):c.6597C>A (p.Ile2199=) rs147611144
NM_006231.3(POLE):c.6598G>A (p.Glu2200Lys) rs752113614
NM_006231.3(POLE):c.65A>T (p.Asp22Val) rs1060500864
NM_006231.3(POLE):c.6601A>G (p.Met2201Val) rs878854895
NM_006231.3(POLE):c.6605C>T (p.Thr2202Met) rs764457707
NM_006231.3(POLE):c.6610G>A (p.Val2204Met)
NM_006231.3(POLE):c.6610G>T (p.Val2204Leu) rs1060500871
NM_006231.3(POLE):c.6613G>A (p.Glu2205Lys)
NM_006231.3(POLE):c.6628A>C (p.Lys2210Gln) rs1284697545
NM_006231.3(POLE):c.662T>C (p.Met221Thr) rs755607944
NM_006231.3(POLE):c.6632T>C (p.Leu2211Pro) rs1060500848
NM_006231.3(POLE):c.663G>T (p.Met221Ile)
NM_006231.3(POLE):c.663dup (p.Arg222fs) rs1555229694
NM_006231.3(POLE):c.664C>A (p.Arg222Ser)
NM_006231.3(POLE):c.664C>T (p.Arg222Cys)
NM_006231.3(POLE):c.6651G>A (p.Gln2217=)
NM_006231.3(POLE):c.6651_6657+6delinsTGC rs1566308356
NM_006231.3(POLE):c.6655C>G (p.Leu2219Val)
NM_006231.3(POLE):c.6658-1G>A rs1555300846
NM_006231.3(POLE):c.6658-2A>G
NM_006231.3(POLE):c.6658G>A (p.Val2220Ile)
NM_006231.3(POLE):c.6658G>T (p.Val2220Phe) rs1060500804
NM_006231.3(POLE):c.665G>A (p.Arg222His) rs1060500862
NM_006231.3(POLE):c.6664C>G (p.Leu2222Val)
NM_006231.3(POLE):c.6665T>C (p.Leu2222Pro) rs1566307264
NM_006231.3(POLE):c.6668A>G (p.Lys2223Arg) rs367970442
NM_006231.3(POLE):c.666C>T (p.Arg222=) rs1357052511
NM_006231.3(POLE):c.6673C>T (p.Arg2225Cys) rs765125852
NM_006231.3(POLE):c.6674G>A (p.Arg2225His) rs538875477
NM_006231.3(POLE):c.6676G>A (p.Gly2226Arg) rs766291093
NM_006231.3(POLE):c.6679G>T (p.Val2227Leu) rs1060500843
NM_006231.3(POLE):c.667G>A (p.Glu223Lys) rs761757009
NM_006231.3(POLE):c.667_693del (p.Glu223_Arg231del) rs1272503308
NM_006231.3(POLE):c.6682_6684del (p.Lys2228del) rs878854896
NM_006231.3(POLE):c.6694A>G (p.Met2232Val)
NM_006231.3(POLE):c.6707G>C (p.Cys2236Ser)
NM_006231.3(POLE):c.6713G>A (p.Cys2238Tyr) rs1555300810
NM_006231.3(POLE):c.6714C>G (p.Cys2238Trp)
NM_006231.3(POLE):c.6716C>T (p.Ala2239Val) rs190813054
NM_006231.3(POLE):c.6727G>A (p.Ala2243Thr) rs747349009
NM_006231.3(POLE):c.6730C>T (p.Leu2244Phe) rs375741031
NM_006231.3(POLE):c.6734C>G (p.Thr2245Ser) rs747676884
NM_006231.3(POLE):c.673G>A (p.Asp225Asn) rs1166189035
NM_006231.3(POLE):c.6747+2T>G rs1566307058
NM_006231.3(POLE):c.6747+4G>C
NM_006231.3(POLE):c.6747+5G>A rs1555300791
NM_006231.3(POLE):c.6748G>C (p.Val2250Leu) rs756931710
NM_006231.3(POLE):c.6751T>C (p.Phe2251Leu) rs373768478
NM_006231.3(POLE):c.6754A>G (p.Met2252Val) rs759660507
NM_006231.3(POLE):c.6757G>A (p.Glu2253Lys)
NM_006231.3(POLE):c.6761A>C (p.Gln2254Pro) rs1555300757
NM_006231.3(POLE):c.6762G>T (p.Gln2254His)
NM_006231.3(POLE):c.6763A>G (p.Ile2255Val) rs73155056
NM_006231.3(POLE):c.6765C>G (p.Ile2255Met)
NM_006231.3(POLE):c.6767G>C (p.Gly2256Ala) rs749707316
NM_006231.3(POLE):c.6769A>C (p.Ile2257Leu) rs1566306858
NM_006231.3(POLE):c.6775C>T (p.Arg2259Trp) rs866548835
NM_006231.3(POLE):c.6776G>A (p.Arg2259Gln) rs762044635
NM_006231.3(POLE):c.6787C>T (p.Gln2263Ter) rs1060500830
NM_006231.3(POLE):c.6790C>A (p.His2264Asn) rs1555300733
NM_006231.3(POLE):c.6792C>G (p.His2264Gln)
NM_006231.3(POLE):c.6796G>A (p.Gly2266Ser) rs200911338
NM_006231.3(POLE):c.6801G>C (p.Met2267Ile) rs1555300726
NM_006231.3(POLE):c.6803C>T (p.Ser2268Leu) rs373791036
NM_006231.3(POLE):c.680C>T (p.Pro227Leu) rs1060500784
NM_006231.3(POLE):c.6818C>T (p.Thr2273Ile) rs779145729
NM_006231.3(POLE):c.6835C>T (p.Gln2279Ter) rs1555300713
NM_006231.3(POLE):c.683A>G (p.Tyr228Cys) rs1555229669
NM_006231.3(POLE):c.6842A>C (p.Asn2281Thr)
NM_006231.3(POLE):c.6844C>A (p.Pro2282Thr) rs760606145
NM_006231.3(POLE):c.6845C>T (p.Pro2282Leu) rs1555300711
NM_006231.3(POLE):c.6847C>G (p.Gln2283Glu) rs1267521228
NM_006231.3(POLE):c.6850C>A (p.Leu2284Met) rs1566306728
NM_006231.3(POLE):c.6851T>A (p.Leu2284Gln) rs1555300706
NM_006231.3(POLE):c.6853G>T (p.Gly2285Cys)
NM_006231.3(POLE):c.6854G>A (p.Gly2285Asp) rs1060500879
NM_006231.3(POLE):c.688A>G (p.Ile230Val) rs1555229662
NM_006231.3(POLE):c.689T>G (p.Ile230Ser) rs1401947646
NM_006231.3(POLE):c.68A>G (p.Asp23Gly) rs765898876
NM_006231.3(POLE):c.691C>T (p.Arg231Cys) rs146592584
NM_006231.3(POLE):c.692G>A (p.Arg231His) rs1060500835
NM_006231.3(POLE):c.692G>T (p.Arg231Leu)
NM_006231.3(POLE):c.695T>C (p.Leu232Pro) rs748554882
NM_006231.3(POLE):c.706C>G (p.Leu236Val)
NM_006231.3(POLE):c.710A>C (p.Lys237Thr)
NM_006231.3(POLE):c.710A>G (p.Lys237Arg) rs879762286
NM_006231.3(POLE):c.712A>T (p.Ile238Phe) rs536684123
NM_006231.3(POLE):c.718G>A (p.Val240Met) rs371882716
NM_006231.3(POLE):c.720+1G>A rs1060500808
NM_006231.3(POLE):c.720+4A>C
NM_006231.3(POLE):c.720+6T>C rs751448342
NM_006231.3(POLE):c.720G>A (p.Val240=)
NM_006231.3(POLE):c.721-3C>T
NM_006231.3(POLE):c.721-9_721-8delGT rs752682384
NM_006231.3(POLE):c.724C>T (p.His242Tyr) rs148525573
NM_006231.3(POLE):c.725A>G (p.His242Arg) rs767612904
NM_006231.3(POLE):c.729G>A (p.Trp243Ter) rs1565977663
NM_006231.3(POLE):c.734A>G (p.Asn245Ser)
NM_006231.3(POLE):c.737_753delinsA (p.Val246fs) rs1064792920
NM_006231.3(POLE):c.73G>A (p.Ala25Thr) rs773204331
NM_006231.3(POLE):c.73G>T (p.Ala25Ser) rs773204331
NM_006231.3(POLE):c.745C>T (p.Arg249Ter)
NM_006231.3(POLE):c.746G>A (p.Arg249Gln) rs1331349861
NM_006231.3(POLE):c.74C>T (p.Ala25Val) rs561834381
NM_006231.3(POLE):c.751A>T (p.Asn251Tyr) rs1392954149
NM_006231.3(POLE):c.758T>C (p.Phe253Ser) rs1555229581
NM_006231.3(POLE):c.763G>A (p.Val255Ile)
NM_006231.3(POLE):c.769A>G (p.Ile257Val)
NM_006231.3(POLE):c.76A>G (p.Thr26Ala) rs182282150
NM_006231.3(POLE):c.773C>T (p.Thr258Ile)
NM_006231.3(POLE):c.775C>T (p.Arg259Cys) rs777638541
NM_006231.3(POLE):c.776G>T (p.Arg259Leu)
NM_006231.3(POLE):c.778C>T (p.Arg260Ter) rs747946229
NM_006231.3(POLE):c.781G>C (p.Asp261His)
NM_006231.3(POLE):c.785A>C (p.Asp262Ala) rs1060500852
NM_006231.3(POLE):c.793G>C (p.Glu265Gln) rs1565977511
NM_006231.3(POLE):c.796C>T (p.Arg266Ter) rs767666219
NM_006231.3(POLE):c.797G>A (p.Arg266Gln) rs115786159
NM_006231.3(POLE):c.797G>T (p.Arg266Leu) rs115786159
NM_006231.3(POLE):c.7C>G (p.Leu3Val) rs1018143132
NM_006231.3(POLE):c.801+4A>G rs1565977480
NM_006231.3(POLE):c.802-1G>C rs1555229470
NM_006231.3(POLE):c.802-3C>T
NM_006231.3(POLE):c.802-8C>A rs1429750584
NM_006231.3(POLE):c.805C>G (p.Pro269Ala)
NM_006231.3(POLE):c.806del (p.Pro269fs) rs1435794183
NM_006231.3(POLE):c.808G>A (p.Val270Met) rs374237142
NM_006231.3(POLE):c.80C>T (p.Ser27Phe)
NM_006231.3(POLE):c.823G>C (p.Asp275His) rs879254218
NM_006231.3(POLE):c.824A>G (p.Asp275Gly) rs1565976801
NM_006231.3(POLE):c.826A>G (p.Ile276Val) rs1280169933
NM_006231.3(POLE):c.833C>T (p.Thr278Met) rs764254754
NM_006231.3(POLE):c.836C>T (p.Thr279Ile)
NM_006231.3(POLE):c.840A>C (p.Lys280Asn) rs908089476
NM_006231.3(POLE):c.842T>C (p.Leu281Pro) rs1555229430
NM_006231.3(POLE):c.844C>T (p.Pro282Ser) rs138207610
NM_006231.3(POLE):c.847C>T (p.Leu283Phe) rs878854898
NM_006231.3(POLE):c.850A>G (p.Lys284Glu) rs568483856
NM_006231.3(POLE):c.857C>G (p.Pro286Arg) rs1057519943
NM_006231.3(POLE):c.861T>A (p.Asp287Glu) rs139075637
NM_006231.3(POLE):c.863C>G (p.Ala288Gly) rs771619667
NM_006231.3(POLE):c.876G>T (p.Gln292His)
NM_006231.3(POLE):c.882G>A (p.Met294Ile) rs774328855
NM_006231.3(POLE):c.882G>T (p.Met294Ile) rs774328855
NM_006231.3(POLE):c.886A>G (p.Ile296Val) rs1555229409
NM_006231.3(POLE):c.895A>G (p.Met299Val) rs370727992
NM_006231.3(POLE):c.89C>T (p.Ser30Leu) rs997586826
NM_006231.3(POLE):c.900C>A (p.Ile300=)
NM_006231.3(POLE):c.900C>G (p.Ile300Met) rs1161210567
NM_006231.3(POLE):c.901G>A (p.Asp301Asn) rs1060500882
NM_006231.3(POLE):c.902A>G (p.Asp301Gly) rs1060500828
NM_006231.3(POLE):c.905del (p.Gly302fs)
NM_006231.3(POLE):c.907C>T (p.Gln303Ter) rs749117997
NM_006231.3(POLE):c.909G>C (p.Gln303His)
NM_006231.3(POLE):c.90G>A (p.Ser30=) rs369224511
NM_006231.3(POLE):c.916C>T (p.Leu306Phe) rs1343048638
NM_006231.3(POLE):c.926A>G (p.Asn309Ser) rs767060387
NM_006231.3(POLE):c.928A>G (p.Arg310Gly)
NM_006231.3(POLE):c.929_932delinsCCAACT (p.Arg310fs)
NM_006231.3(POLE):c.936T>G (p.Ile312Met) rs1555229316
NM_006231.3(POLE):c.940T>G (p.Ser314Ala) rs770403791
NM_006231.3(POLE):c.941C>G (p.Ser314Ter) rs869312803
NM_006231.3(POLE):c.94C>T (p.Leu32Phe) rs781513537
NM_006231.3(POLE):c.950T>C (p.Ile317Thr) rs1060500783
NM_006231.3(POLE):c.95T>C (p.Leu32Pro) rs878854900
NM_006231.3(POLE):c.95T>G (p.Leu32Arg) rs878854900
NM_006231.3(POLE):c.964T>C (p.Phe322Leu) rs1555229294
NM_006231.3(POLE):c.968C>T (p.Thr323Ile) rs1060500873
NM_006231.3(POLE):c.970C>A (p.Pro324Thr) rs1397733219
NM_006231.3(POLE):c.971C>T (p.Pro324Leu)
NM_006231.3(POLE):c.974A>G (p.Lys325Arg) rs1555229291
NM_006231.3(POLE):c.976C>G (p.Pro326Ala) rs1565976104
NM_006231.3(POLE):c.976C>T (p.Pro326Ser)
NM_006231.3(POLE):c.979G>A (p.Glu327Lys) rs772154998
NM_006231.3(POLE):c.983A>G (p.Tyr328Cys) rs1339375099
NM_006231.3(POLE):c.983A>T (p.Tyr328Phe) rs1339375099
NM_006231.3(POLE):c.988G>A (p.Gly330Ser) rs1555229288

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.