ClinVar Miner

List of variants in gene POLE

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 2947
Download table as spreadsheet
HGVS dbSNP
NC_000012.11:g.(?_133201273)_(133202913_?)del
NC_000012.11:g.(?_133201273)_(133263911_?)dup
NC_000012.11:g.(?_133201277)_(133263907_?)dup
NC_000012.11:g.(?_133208891)_(133209391_?)del
NC_000012.11:g.(?_133208895)_(133212616_?)del
NC_000012.11:g.(?_133210817)_(133211013_?)dup
NC_000012.11:g.(?_133225505)_(133226485_?)del
NC_000012.11:g.(?_133225509)_(133256814_?)dup
NC_000012.11:g.(?_133233712)_(133263911_?)del
NC_000012.11:g.(?_133233722)_(133263945_?)dup
NC_000012.11:g.(?_133237545)_(133237760_?)del
NC_000012.11:g.(?_133237549)_(133263907_?)dup
NC_000012.11:g.(?_133240580)_(133263911_?)dup
NC_000012.11:g.(?_133248791)_(133257875_?)del
NC_000012.11:g.(?_133252670)_(133254315_?)del
NC_000012.11:g.(?_133263830)_(133263911_?)del
NC_000012.11:g.(?_133263830)_(133263911_?)dup
NC_000012.11:g.(?_133263834)_(133263907_?)del
NC_000012.12:g.132668929_132668931TCA[3]
NC_000012.12:g.132672179_132672180del
NM_006231.3(POLE):c.*18G>T rs573406234
NM_006231.3(POLE):c.*4G>T rs1555300702
NM_006231.3(POLE):c.-15G>A rs554140626
NM_006231.3(POLE):c.-18G>A rs1265970870
NM_006231.3(POLE):c.-25A>G rs1443530379
NM_006231.3(POLE):c.-29C>G rs571026345
NM_006231.3(POLE):c.-29del rs1555231453
NM_006231.3(POLE):c.-30C>T rs763189979
NM_006231.3(POLE):c.-32C>A rs764493951
NM_006231.3(POLE):c.-32C>G rs764493951
NM_006231.3(POLE):c.-38del rs1031310075
NM_006231.3(POLE):c.-44C>A rs754662026
NM_006231.3(POLE):c.-45G>A rs1064795271
NM_006231.3(POLE):c.-47G>T rs1014146082
NM_006231.3(POLE):c.-4C>T rs776115380
NM_006231.3(POLE):c.-6G>A rs534524789
NM_006231.3(POLE):c.-6G>C rs534524789
NM_006231.3(POLE):c.-7C>T rs1064796567
NM_006231.3(POLE):c.-8A>G rs1057521786
NM_006231.3(POLE):c.-9A>G rs1555231441
NM_006231.3(POLE):c.1000G>A (p.Val334Ile) rs1555229285
NM_006231.3(POLE):c.1002C>T (p.Val334=) rs1555229284
NM_006231.3(POLE):c.1007A>G (p.Asn336Ser) rs5744760
NM_006231.3(POLE):c.1008T>C (p.Asn336=) rs754405980
NM_006231.3(POLE):c.1012C>A (p.Pro338Thr) rs1565976008
NM_006231.3(POLE):c.1014C>T (p.Pro338=) rs143102561
NM_006231.3(POLE):c.1015G>A (p.Asp339Asn) rs149029910
NM_006231.3(POLE):c.1016A>T (p.Asp339Val) rs1060500865
NM_006231.3(POLE):c.1019A>T (p.Glu340Val) rs895236041
NM_006231.3(POLE):c.101G>T (p.Arg34Leu) rs747005851
NM_006231.3(POLE):c.1020+124A>G
NM_006231.3(POLE):c.1020+1G>T rs1064794748
NM_006231.3(POLE):c.1020+5_1020+6delinsAA rs1064795707
NM_006231.3(POLE):c.1021-1G>C
NM_006231.3(POLE):c.1021-20C>G rs1064796140
NM_006231.3(POLE):c.1021-26_1045delinsGTTCTACACC rs1555229232
NM_006231.3(POLE):c.1021G>C (p.Ala341Pro) rs137860861
NM_006231.3(POLE):c.1021G>T (p.Ala341Ser) rs137860861
NM_006231.3(POLE):c.1036A>G (p.Arg346Gly) rs1565975682
NM_006231.3(POLE):c.1037G>A (p.Arg346Lys) rs1565975676
NM_006231.3(POLE):c.1038G>T (p.Arg346Ser) rs1193021447
NM_006231.3(POLE):c.1040G>A (p.Trp347Ter) rs1555229236
NM_006231.3(POLE):c.1041G>T (p.Trp347Cys) rs1048183984
NM_006231.3(POLE):c.1046A>G (p.Glu349Gly) rs1555229230
NM_006231.3(POLE):c.1050C>T (p.His350=) rs752171701
NM_006231.3(POLE):c.1051G>A (p.Val351Ile) rs759414746
NM_006231.3(POLE):c.1051G>T (p.Val351Phe) rs759414746
NM_006231.3(POLE):c.1053C>G (p.Val351=) rs1555229224
NM_006231.3(POLE):c.1055A>C (p.Gln352Pro) rs766094330
NM_006231.3(POLE):c.1059G>C (p.Glu353Asp)
NM_006231.3(POLE):c.1062C>G (p.Thr354=) rs145245295
NM_006231.3(POLE):c.1064A>G (p.Lys355Arg) rs141396559
NM_006231.3(POLE):c.1066C>T (p.Pro356Ser) rs1555229220
NM_006231.3(POLE):c.1067C>T (p.Pro356Leu)
NM_006231.3(POLE):c.1069A>G (p.Thr357Ala)
NM_006231.3(POLE):c.106G>C (p.Glu36Gln) rs370268888
NM_006231.3(POLE):c.1073T>C (p.Ile358Thr)
NM_006231.3(POLE):c.1081A>C (p.Thr361Pro) rs201315364
NM_006231.3(POLE):c.1082_1086dup (p.Asn363fs) rs878854838
NM_006231.3(POLE):c.1083C>G (p.Thr361=) rs1555229211
NM_006231.3(POLE):c.1085A>G (p.Tyr362Cys) rs1368897791
NM_006231.3(POLE):c.1086C>T (p.Tyr362=) rs1555229206
NM_006231.3(POLE):c.1088A>G (p.Asn363Ser) rs879254173
NM_006231.3(POLE):c.1089C>G (p.Asn363Lys) rs146639652
NM_006231.3(POLE):c.1089C>T (p.Asn363=) rs146639652
NM_006231.3(POLE):c.1092G>A (p.Gly364=) rs749415346
NM_006231.3(POLE):c.109C>T (p.Arg37Trp) rs753101641
NM_006231.3(POLE):c.10A>G (p.Arg4Gly) rs1010746038
NM_006231.3(POLE):c.1106+12T>C rs781673811
NM_006231.3(POLE):c.1106+20A>G rs200322118
NM_006231.3(POLE):c.1106+2T>G
NM_006231.3(POLE):c.1106+7C>A rs369889926
NM_006231.3(POLE):c.1106+9G>A
NM_006231.3(POLE):c.1106+9G>C rs746392495
NM_006231.3(POLE):c.1107-2A>G rs1565975328
NM_006231.3(POLE):c.1107-3C>T rs369572563
NM_006231.3(POLE):c.1107-5C>T rs1555229152
NM_006231.3(POLE):c.1107-6A>G rs1565975340
NM_006231.3(POLE):c.1107G>A (p.Trp369Ter) rs1171878347
NM_006231.3(POLE):c.1108C>A (p.Pro370Thr) rs576578672
NM_006231.3(POLE):c.110G>A (p.Arg37Gln)
NM_006231.3(POLE):c.1110A>C (p.Pro370=) rs772386963
NM_006231.3(POLE):c.1110A>G (p.Pro370=) rs772386963
NM_006231.3(POLE):c.1111T>C (p.Phe371Leu) rs1565975308
NM_006231.3(POLE):c.1118A>T (p.Glu373Val) rs1555229138
NM_006231.3(POLE):c.1119G>A (p.Glu373=) rs1555229135
NM_006231.3(POLE):c.1120G>A (p.Ala374Thr)
NM_006231.3(POLE):c.1123C>G (p.Arg375Gly) rs556789278
NM_006231.3(POLE):c.1123C>T (p.Arg375Trp)
NM_006231.3(POLE):c.1124G>A (p.Arg375Gln) rs778572159
NM_006231.3(POLE):c.1127C>A (p.Ala376Glu)
NM_006231.3(POLE):c.1129G>A (p.Ala377Thr) rs754508108
NM_006231.3(POLE):c.112A>T (p.Ser38Cys) rs879254247
NM_006231.3(POLE):c.1134C>G (p.Val378=) rs878854839
NM_006231.3(POLE):c.1137C>T (p.His379=) rs376333939
NM_006231.3(POLE):c.1138G>A (p.Gly380Ser) rs199746481
NM_006231.3(POLE):c.1138G>C (p.Gly380Arg) rs199746481
NM_006231.3(POLE):c.1138G>T (p.Gly380Cys) rs199746481
NM_006231.3(POLE):c.113G>A (p.Ser38Asn) rs141424313
NM_006231.3(POLE):c.1143G>A (p.Leu381=) rs1555229118
NM_006231.3(POLE):c.1145G>A (p.Ser382Asn) rs761600715
NM_006231.3(POLE):c.1147A>G (p.Met383Val) rs879254238
NM_006231.3(POLE):c.1148T>C (p.Met383Thr) rs1060500787
NM_006231.3(POLE):c.1151A>G (p.Gln384Arg) rs1565975180
NM_006231.3(POLE):c.1156G>A (p.Glu386Lys) rs893340262
NM_006231.3(POLE):c.1160T>C (p.Ile387Thr) rs1060500833
NM_006231.3(POLE):c.1165T>G (p.Phe389Val) rs1555229108
NM_006231.3(POLE):c.1166T>A (p.Phe389Tyr) rs1565975150
NM_006231.3(POLE):c.1171_1173del (p.Lys391del) rs753999122
NM_006231.3(POLE):c.1175A>G (p.Asp392Gly) rs878854840
NM_006231.3(POLE):c.1176C>G (p.Asp392Glu) rs752873913
NM_006231.3(POLE):c.1180C>T (p.Gln394Ter) rs1565975090
NM_006231.3(POLE):c.1181del (p.Gln394fs) rs764289504
NM_006231.3(POLE):c.1183G>A (p.Gly395Arg)
NM_006231.3(POLE):c.1184G>A (p.Gly395Glu) rs546499094
NM_006231.3(POLE):c.1184G>T (p.Gly395Val)
NM_006231.3(POLE):c.1188G>A (p.Glu396=) rs371717068
NM_006231.3(POLE):c.1191C>G (p.Tyr397Ter) rs1208085896
NM_006231.3(POLE):c.1193A>G (p.Lys398Arg) rs1402549512
NM_006231.3(POLE):c.1196C>T (p.Ala399Val) rs1060500853
NM_006231.3(POLE):c.1197G>A (p.Ala399=) rs1000162996
NM_006231.3(POLE):c.119G>A (p.Trp40Ter) rs1565981653
NM_006231.3(POLE):c.1200C>T (p.Pro400=) rs1330997509
NM_006231.3(POLE):c.1203G>C (p.Gln401His) rs1060500810
NM_006231.3(POLE):c.1206C>T (p.Cys402=) rs772441931
NM_006231.3(POLE):c.1211A>G (p.His404Arg) rs1565975006
NM_006231.3(POLE):c.1213A>C (p.Met405Leu) rs1064796182
NM_006231.3(POLE):c.1213A>G (p.Met405Val)
NM_006231.3(POLE):c.1214T>G (p.Met405Arg)
NM_006231.3(POLE):c.1215G>C (p.Met405Ile) rs1060500847
NM_006231.3(POLE):c.1222C>G (p.Leu408Val)
NM_006231.3(POLE):c.1224C>A (p.Leu408=) rs748536025
NM_006231.3(POLE):c.1226+13G>A rs577646338
NM_006231.3(POLE):c.1226+1G>A rs778501724
NM_006231.3(POLE):c.1226+2_1226+5delTAGG
NM_006231.3(POLE):c.1226+45C>T
NM_006231.3(POLE):c.1226+6G>A
NM_006231.3(POLE):c.1227-149T>C
NM_006231.3(POLE):c.1227-2A>T rs1057517609
NM_006231.3(POLE):c.1227-8C>T rs537816213
NM_006231.3(POLE):c.1228T>C (p.Trp410Arg)
NM_006231.3(POLE):c.122C>T (p.Thr41Met) rs148269473
NM_006231.3(POLE):c.1231G>A (p.Val411Met) rs1057519945
NM_006231.3(POLE):c.1231G>T (p.Val411Leu) rs1057519945
NM_006231.3(POLE):c.1232T>C (p.Val411Ala) rs1031999052
NM_006231.3(POLE):c.123G>A (p.Thr41=) rs5744734
NM_006231.3(POLE):c.123G>C (p.Thr41=) rs5744734
NM_006231.3(POLE):c.1242C>T (p.Asp414=) rs775213170
NM_006231.3(POLE):c.1252C>A (p.Pro418Thr) rs1555228651
NM_006231.3(POLE):c.1254T>G (p.Pro418=) rs1555228650
NM_006231.3(POLE):c.1257G>A (p.Val419=) rs1565973352
NM_006231.3(POLE):c.125A>C (p.Asp42Ala)
NM_006231.3(POLE):c.125A>T (p.Asp42Val) rs749886101
NM_006231.3(POLE):c.1260C>T (p.Gly420=) rs1057523868
NM_006231.3(POLE):c.1264C>G (p.His422Asp) rs745356467
NM_006231.3(POLE):c.1264C>T (p.His422Tyr) rs745356467
NM_006231.3(POLE):c.1270C>G (p.Leu424Val) rs483352909
NM_006231.3(POLE):c.1272C>G (p.Leu424=) rs1555228638
NM_006231.3(POLE):c.1274A>G (p.Lys425Arg) rs757186755
NM_006231.3(POLE):c.1277C>T (p.Ala426Val) rs374920539
NM_006231.3(POLE):c.1278G>A (p.Ala426=) rs1437075270
NM_006231.3(POLE):c.1278G>C (p.Ala426=) rs1437075270
NM_006231.3(POLE):c.1280C>T (p.Ala427Val) rs878854841
NM_006231.3(POLE):c.1281C>T (p.Ala427=) rs371586756
NM_006231.3(POLE):c.1282G>A (p.Ala428Thr) rs150032060
NM_006231.3(POLE):c.1284C>T (p.Ala428=) rs1555228629
NM_006231.3(POLE):c.1284del (p.Lys429fs) rs1057517613
NM_006231.3(POLE):c.1288G>A (p.Ala430Thr) rs140566004
NM_006231.3(POLE):c.1291_1311dup (p.Lys431_Val437dup)
NM_006231.3(POLE):c.1294C>G (p.Leu432Val) rs750475909
NM_006231.3(POLE):c.1296A>G (p.Leu432=) rs142624113
NM_006231.3(POLE):c.1297G>A (p.Gly433Ser) rs1190891892
NM_006231.3(POLE):c.1297G>T (p.Gly433Cys) rs1190891892
NM_006231.3(POLE):c.1298G>A (p.Gly433Asp) rs1465684132
NM_006231.3(POLE):c.1298G>T (p.Gly433Val)
NM_006231.3(POLE):c.1303G>A (p.Asp435Asn) rs879254276
NM_006231.3(POLE):c.1306C>A (p.Pro436Thr) rs1565973210
NM_006231.3(POLE):c.1307C>G (p.Pro436Arg) rs864622766
NM_006231.3(POLE):c.1308C>T (p.Pro436=) rs755627156
NM_006231.3(POLE):c.1309G>A (p.Val437Met) rs115047349
NM_006231.3(POLE):c.1309G>T (p.Val437Leu)
NM_006231.3(POLE):c.1320C>G (p.Asp440Glu) rs763350226
NM_006231.3(POLE):c.1322C>G (p.Pro441Arg) rs775340163
NM_006231.3(POLE):c.1322C>T (p.Pro441Leu) rs775340163
NM_006231.3(POLE):c.1323G>A (p.Pro441=) rs116573514
NM_006231.3(POLE):c.1326G>A (p.Glu442=) rs745411507
NM_006231.3(POLE):c.1328A>G (p.Asp443Gly) rs1555228601
NM_006231.3(POLE):c.1330A>G (p.Met444Val)
NM_006231.3(POLE):c.1336C>T (p.Arg446Trp) rs200403177
NM_006231.3(POLE):c.1337G>A (p.Arg446Gln) rs151273553
NM_006231.3(POLE):c.1339A>C (p.Met447Leu) rs376095661
NM_006231.3(POLE):c.1339A>G (p.Met447Val) rs376095661
NM_006231.3(POLE):c.1341G>A (p.Met447Ile) rs1565973097
NM_006231.3(POLE):c.1345A>G (p.Thr449Ala) rs747935432
NM_006231.3(POLE):c.1346C>T (p.Thr449Met) rs780299012
NM_006231.3(POLE):c.1347G>A (p.Thr449=) rs142373951
NM_006231.3(POLE):c.1347G>C (p.Thr449=) rs142373951
NM_006231.3(POLE):c.1349_1359delAGCAGCCCCAG rs1565973030
NM_006231.3(POLE):c.1350G>A (p.Glu450=) rs1555228575
NM_006231.3(POLE):c.1351C>T (p.Gln451Ter)
NM_006231.3(POLE):c.1354C>A (p.Pro452Thr) rs1555228573
NM_006231.3(POLE):c.1357C>G (p.Gln453Glu) rs781360770
NM_006231.3(POLE):c.1359+18C>T rs5744775
NM_006231.3(POLE):c.1359+19G>A rs375000942
NM_006231.3(POLE):c.1359+2C>T
NM_006231.3(POLE):c.1359+4C>A rs752118019
NM_006231.3(POLE):c.1359+4C>T rs752118019
NM_006231.3(POLE):c.1359+5G>A rs761564635
NM_006231.3(POLE):c.1359+6T>A rs1555228569
NM_006231.3(POLE):c.1359+9G>A rs75135381
NM_006231.3(POLE):c.1360-10C>G rs1480904053
NM_006231.3(POLE):c.1360-13G>A rs149689764
NM_006231.3(POLE):c.1360-14C>T rs757413516
NM_006231.3(POLE):c.1360-20C>G rs781212006
NM_006231.3(POLE):c.1360-5C>T rs1555228512
NM_006231.3(POLE):c.1360-6C>A
NM_006231.3(POLE):c.1360-6C>T rs139836643
NM_006231.3(POLE):c.1360-8C>T rs1555228513
NM_006231.3(POLE):c.1363_1364delCT rs1347535436
NM_006231.3(POLE):c.1366G>C (p.Ala456Pro) rs1565972665
NM_006231.3(POLE):c.1370C>T (p.Thr457Met) rs878854842
NM_006231.3(POLE):c.1371G>A (p.Thr457=) rs753216372
NM_006231.3(POLE):c.1372T>A (p.Tyr458Asn) rs879254259
NM_006231.3(POLE):c.1376C>G (p.Ser459Cys) rs765702675
NM_006231.3(POLE):c.1378G>A (p.Val460Met) rs753586583
NM_006231.3(POLE):c.1384G>A (p.Asp462Asn)
NM_006231.3(POLE):c.138del (p.Leu46fs) rs1555230420
NM_006231.3(POLE):c.1390G>A (p.Val464Ile) rs1555228496
NM_006231.3(POLE):c.1392C>T (p.Val464=) rs772578799
NM_006231.3(POLE):c.1393G>A (p.Ala465Thr) rs771526654
NM_006231.3(POLE):c.1394C>T (p.Ala465Val) rs1555228490
NM_006231.3(POLE):c.1396A>G (p.Thr466Ala) rs761765763
NM_006231.3(POLE):c.139C>T (p.Arg47Trp) rs143626223
NM_006231.3(POLE):c.1405C>G (p.Leu469Val) rs368303888
NM_006231.3(POLE):c.1405C>T (p.Leu469=) rs368303888
NM_006231.3(POLE):c.140G>A (p.Arg47Gln) rs1161199196
NM_006231.3(POLE):c.1411A>G (p.Met471Val) rs749021187
NM_006231.3(POLE):c.1414A>G (p.Lys472Glu) rs1565972540
NM_006231.3(POLE):c.1419C>G (p.Tyr473Ter) rs369961557
NM_006231.3(POLE):c.1419C>T (p.Tyr473=) rs369961557
NM_006231.3(POLE):c.141del (p.Phe48fs) rs761329565
NM_006231.3(POLE):c.1420G>A (p.Val474Ile) rs980578884
NM_006231.3(POLE):c.1422C>T (p.Val474=) rs1555228472
NM_006231.3(POLE):c.1423C>A (p.His475Asn) rs952195021
NM_006231.3(POLE):c.1426C>T (p.Pro476Ser) rs1555228469
NM_006231.3(POLE):c.1439C>T (p.Ala480Val) rs951851739
NM_006231.3(POLE):c.1440T>C (p.Ala480=) rs1248513702
NM_006231.3(POLE):c.1447A>G (p.Thr483Ala) rs777736640
NM_006231.3(POLE):c.1447A>T (p.Thr483Ser) rs777736640
NM_006231.3(POLE):c.1452T>C (p.Ile484=) rs1060504063
NM_006231.3(POLE):c.1453A>G (p.Ile485Val)
NM_006231.3(POLE):c.1455T>G (p.Ile485Met) rs878854843
NM_006231.3(POLE):c.1456C>T (p.Pro486Ser) rs1565972431
NM_006231.3(POLE):c.145G>A (p.Gly49Ser) rs1555230418
NM_006231.3(POLE):c.1462G>A (p.Glu488Lys) rs375615461
NM_006231.3(POLE):c.1464G>A (p.Glu488=) rs1012445618
NM_006231.3(POLE):c.1467C>T (p.Pro489=) rs995585765
NM_006231.3(POLE):c.1467_1468del (p.Asp490fs) rs1060500792
NM_006231.3(POLE):c.1468G>A (p.Asp490Asn) rs755463796
NM_006231.3(POLE):c.1470C>T (p.Asp490=) rs5744777
NM_006231.3(POLE):c.1471G>A (p.Glu491Lys) rs776770625
NM_006231.3(POLE):c.1473+19G>A rs1057517628
NM_006231.3(POLE):c.1473+7A>G rs1555228439
NM_006231.3(POLE):c.1474-13G>A rs1555228383
NM_006231.3(POLE):c.1474-14G>T rs756438835
NM_006231.3(POLE):c.1474-1G>C rs1565972026
NM_006231.3(POLE):c.1474-7C>T rs1172867643
NM_006231.3(POLE):c.1478del (p.Leu493fs) rs760070332
NM_006231.3(POLE):c.1479G>C (p.Leu493=) rs1555228372
NM_006231.3(POLE):c.1480C>T (p.Arg494Trp) rs756829894
NM_006231.3(POLE):c.1487G>T (p.Gly496Val) rs1485752650
NM_006231.3(POLE):c.1487del (p.Gly496fs) rs1555228358
NM_006231.3(POLE):c.1489T>C (p.Ser497Pro) rs764069224
NM_006231.3(POLE):c.1492G>C (p.Gly498Arg)
NM_006231.3(POLE):c.1499T>C (p.Leu500Pro) rs775457973
NM_006231.3(POLE):c.1503_1504del rs762636894
NM_006231.3(POLE):c.1504G>C (p.Glu502Gln)
NM_006231.3(POLE):c.1509C>T (p.Ala503=) rs1415621480
NM_006231.3(POLE):c.1516A>G (p.Met506Val) rs773634913
NM_006231.3(POLE):c.1520T>C (p.Val507Ala)
NM_006231.3(POLE):c.1523A>G (p.Gln508Arg)
NM_006231.3(POLE):c.1524G>T (p.Gln508His) rs762030811
NM_006231.3(POLE):c.1533C>T (p.His511=) rs545378475
NM_006231.3(POLE):c.1534G>A (p.Ala512Thr) rs113998091
NM_006231.3(POLE):c.1537A>G (p.Asn513Asp) rs200136603
NM_006231.3(POLE):c.153G>A (p.Glu51=) rs762772484
NM_006231.3(POLE):c.1543A>G (p.Ile515Val) rs1060500815
NM_006231.3(POLE):c.154C>A (p.Arg52=) rs115452881
NM_006231.3(POLE):c.154C>T (p.Arg52Trp) rs115452881
NM_006231.3(POLE):c.1550C>T (p.Pro517Leu) rs780556141
NM_006231.3(POLE):c.1551C>A (p.Pro517=) rs770117116
NM_006231.3(POLE):c.1551C>T (p.Pro517=) rs770117116
NM_006231.3(POLE):c.1553A>G (p.Asn518Ser)
NM_006231.3(POLE):c.1554C>A (p.Asn518Lys) rs1251796496
NM_006231.3(POLE):c.1559A>C (p.Gln520Pro)
NM_006231.3(POLE):c.1559A>G (p.Gln520Arg) rs780865223
NM_006231.3(POLE):c.155G>A (p.Arg52Gln) rs372459649
NM_006231.3(POLE):c.1560A>G (p.Gln520=) rs201841065
NM_006231.3(POLE):c.1565A>G (p.Gln522Arg) rs1555228312
NM_006231.3(POLE):c.1567G>A (p.Glu523Lys) rs1275423655
NM_006231.3(POLE):c.1567dup (p.Glu523fs) rs1555228310
NM_006231.3(POLE):c.1570T>G (p.Phe524Val)
NM_006231.3(POLE):c.1571T>A (p.Phe524Tyr)
NM_006231.3(POLE):c.1573A>C (p.Asn525His) rs751164982
NM_006231.3(POLE):c.1574A>G (p.Asn525Ser) rs74878897
NM_006231.3(POLE):c.1576A>G (p.Lys526Glu) rs1444399170
NM_006231.3(POLE):c.157C>T (p.Leu53=) rs915665174
NM_006231.3(POLE):c.1583C>T (p.Thr528Met) rs116263919
NM_006231.3(POLE):c.1584G>A (p.Thr528=) rs371824210
NM_006231.3(POLE):c.1586A>G (p.Asp529Gly) rs1565971720
NM_006231.3(POLE):c.1587C>T (p.Asp529=) rs574092762
NM_006231.3(POLE):c.1588G>A (p.Asp530Asn) rs753660907
NM_006231.3(POLE):c.1588_1594delGACGGAC rs1555228293
NM_006231.3(POLE):c.1590C>T (p.Asp530=) rs1040269464
NM_006231.3(POLE):c.1591G>A (p.Gly531Arg) rs748489355
NM_006231.3(POLE):c.1593A>T (p.Gly531=) rs762153693
NM_006231.3(POLE):c.1596C>T (p.His532=) rs114978673
NM_006231.3(POLE):c.1597G>A (p.Val533Met) rs374140892
NM_006231.3(POLE):c.15C>A (p.Ser5Arg) rs1361332747
NM_006231.3(POLE):c.1600C>T (p.Leu534=) rs1060504056
NM_006231.3(POLE):c.1608T>C (p.Ser536=) rs763078534
NM_006231.3(POLE):c.1613C>T (p.Thr538Ile) rs1565971628
NM_006231.3(POLE):c.1614C>A (p.Thr538=) rs1060504052
NM_006231.3(POLE):c.1614C>G (p.Thr538=)
NM_006231.3(POLE):c.1617C>T (p.Tyr539=) rs775930793
NM_006231.3(POLE):c.1618G>A (p.Val540Ile) rs770307281
NM_006231.3(POLE):c.1620C>T (p.Val540=) rs746282048
NM_006231.3(POLE):c.1621G>A (p.Gly541Arg) rs1555228286
NM_006231.3(POLE):c.1623_1633del (p.His543fs)
NM_006231.3(POLE):c.1625dup (p.His543fs) rs1565971583
NM_006231.3(POLE):c.1627C>T (p.His543Tyr) rs1555228285
NM_006231.3(POLE):c.1628A>C (p.His543Pro) rs1555228282
NM_006231.3(POLE):c.1639C>T (p.Leu547Phe) rs1327695331
NM_006231.3(POLE):c.1641C>A (p.Leu547=) rs267603387
NM_006231.3(POLE):c.1642G>A (p.Glu548Lys) rs908638591
NM_006231.3(POLE):c.1642G>T (p.Glu548Ter) rs908638591
NM_006231.3(POLE):c.1645T>C (p.Ser549Pro) rs115558715
NM_006231.3(POLE):c.1649G>A (p.Gly550Glu) rs1555228272
NM_006231.3(POLE):c.1650G>A (p.Gly550=) rs1060504067
NM_006231.3(POLE):c.1656C>T (p.Phe552=) rs1555228270
NM_006231.3(POLE):c.1657C>T (p.Arg553Cys) rs878854844
NM_006231.3(POLE):c.1659C>T (p.Arg553=) rs1555228265
NM_006231.3(POLE):c.1661G>A (p.Ser554Asn) rs1028317886
NM_006231.3(POLE):c.1662C>T (p.Ser554=) rs752219944
NM_006231.3(POLE):c.1663G>A (p.Asp555Asn) rs778763440
NM_006231.3(POLE):c.1673del (p.Cys558fs) rs1060500859
NM_006231.3(POLE):c.1676G>A (p.Arg559Gln) rs766276875
NM_006231.3(POLE):c.167C>T (p.Pro56Leu) rs1555230404
NM_006231.3(POLE):c.1684A>G (p.Met562Val)
NM_006231.3(POLE):c.1686+1G>C rs1555228250
NM_006231.3(POLE):c.1686+32C>G rs762985435
NM_006231.3(POLE):c.1686+3G>A rs1060500868
NM_006231.3(POLE):c.1687-13A>G rs527311638
NM_006231.3(POLE):c.1687-16C>G rs530732187
NM_006231.3(POLE):c.1687-17T>C rs1026163395
NM_006231.3(POLE):c.1687-3T>G rs148115738
NM_006231.3(POLE):c.1687-4C>G rs375705244
NM_006231.3(POLE):c.1687-4C>T rs375705244
NM_006231.3(POLE):c.1691C>T (p.Pro564Leu)
NM_006231.3(POLE):c.1693G>C (p.Ala565Pro)
NM_006231.3(POLE):c.1693G>T (p.Ala565Ser)
NM_006231.3(POLE):c.1695C>A (p.Ala565=) rs139748472
NM_006231.3(POLE):c.1695C>T (p.Ala565=) rs139748472
NM_006231.3(POLE):c.1696G>A (p.Ala566Thr) rs773813430
NM_006231.3(POLE):c.16G>C (p.Gly6Arg) rs202220778
NM_006231.3(POLE):c.1702G>A (p.Asp568Asn)
NM_006231.3(POLE):c.1704C>G (p.Asp568Glu)
NM_006231.3(POLE):c.1704C>T (p.Asp568=) rs1202536047
NM_006231.3(POLE):c.1707C>G (p.Phe569Leu) rs147438050
NM_006231.3(POLE):c.1707C>T (p.Phe569=) rs147438050
NM_006231.3(POLE):c.1708C>A (p.Leu570Met) rs748807227
NM_006231.3(POLE):c.1708C>T (p.Leu570=) rs748807227
NM_006231.3(POLE):c.1713G>A (p.Leu571=) rs1555228141
NM_006231.3(POLE):c.1715A>T (p.Gln572Leu) rs1555228139
NM_006231.3(POLE):c.1717C>A (p.Arg573=) rs373000452
NM_006231.3(POLE):c.1717C>G (p.Arg573Gly)
NM_006231.3(POLE):c.1717C>T (p.Arg573Trp) rs373000452
NM_006231.3(POLE):c.1718G>A (p.Arg573Gln)
NM_006231.3(POLE):c.1726A>G (p.Lys576Glu)
NM_006231.3(POLE):c.1729A>G (p.Thr577Ala) rs1565970674
NM_006231.3(POLE):c.172G>A (p.Glu58Lys)
NM_006231.3(POLE):c.1735C>T (p.Arg579Cys) rs116260568
NM_006231.3(POLE):c.1736G>A (p.Arg579His) rs149296223
NM_006231.3(POLE):c.1737C>T (p.Arg579=) rs1057523317
NM_006231.3(POLE):c.1738C>A (p.His580Asn) rs371149234
NM_006231.3(POLE):c.1740C>T (p.His580=) rs114972594
NM_006231.3(POLE):c.1741G>A (p.Ala581Thr) rs755090755
NM_006231.3(POLE):c.1741G>T (p.Ala581Ser)
NM_006231.3(POLE):c.1744C>T (p.Leu582Phe) rs761273376
NM_006231.3(POLE):c.1756G>A (p.Glu586Lys) rs878854845
NM_006231.3(POLE):c.1759A>C (p.Lys587Gln) rs1060500781
NM_006231.3(POLE):c.1759A>G (p.Lys587Glu)
NM_006231.3(POLE):c.1760A>G (p.Lys587Arg)
NM_006231.3(POLE):c.1769T>A (p.Val590Glu)
NM_006231.3(POLE):c.1770G>A (p.Val590=) rs1060504050
NM_006231.3(POLE):c.1772A>G (p.Glu591Gly) rs1555228119
NM_006231.3(POLE):c.1773G>A (p.Glu591=) rs767933490
NM_006231.3(POLE):c.177G>C (p.Lys59Asn) rs753360358
NM_006231.3(POLE):c.1780A>G (p.Thr594Ala) rs762067222
NM_006231.3(POLE):c.1781C>T (p.Thr594Ile) rs574033788
NM_006231.3(POLE):c.1783A>G (p.Asn595Asp)
NM_006231.3(POLE):c.1784A>G (p.Asn595Ser) rs969500436
NM_006231.3(POLE):c.1789G>A (p.Glu597Lys) rs768396766
NM_006231.3(POLE):c.1791A>C (p.Glu597Asp)
NM_006231.3(POLE):c.1794+11_1794+12insA rs1555228106
NM_006231.3(POLE):c.1794+16G>A rs770818395
NM_006231.3(POLE):c.1794+4A>G rs1555228110
NM_006231.3(POLE):c.1794+4dup
NM_006231.3(POLE):c.1794+5C>A rs200095915
NM_006231.3(POLE):c.1794+5C>T rs200095915
NM_006231.3(POLE):c.1794+6C>T rs769389800
NM_006231.3(POLE):c.1794G>A (p.Glu598=) rs1379550837
NM_006231.3(POLE):c.1795-105A>G
NM_006231.3(POLE):c.1795-11T>C rs750393025
NM_006231.3(POLE):c.1795-13G>A rs749522265
NM_006231.3(POLE):c.1795-14C>T rs369023182
NM_006231.3(POLE):c.1795-250C>T
NM_006231.3(POLE):c.1795-6C>G rs1555227428
NM_006231.3(POLE):c.1795G>A (p.Val599Met) rs1555227427
NM_006231.3(POLE):c.1798T>A (p.Cys600Ser) rs1555227426
NM_006231.3(POLE):c.1799G>A (p.Cys600Tyr) rs1565966836
NM_006231.3(POLE):c.17G>A (p.Gly6Asp) rs772972882
NM_006231.3(POLE):c.1806G>A (p.Glu602=) rs1057521932
NM_006231.3(POLE):c.1806G>C (p.Glu602Asp)
NM_006231.3(POLE):c.180A>G (p.Thr60=) rs1555230398
NM_006231.3(POLE):c.1824C>T (p.Ala608=) rs1555227421
NM_006231.3(POLE):c.1836C>G (p.Asp612Glu)
NM_006231.3(POLE):c.1836C>T (p.Asp612=) rs116456858
NM_006231.3(POLE):c.1836dup (p.Val613fs) rs1555227419
NM_006231.3(POLE):c.1837G>A (p.Val613Ile) rs200471266
NM_006231.3(POLE):c.1843A>G (p.Ser615Gly)
NM_006231.3(POLE):c.1846C>T (p.Arg616Cys) rs752076074
NM_006231.3(POLE):c.1847G>A (p.Arg616His) rs764558974
NM_006231.3(POLE):c.1847G>T (p.Arg616Leu)
NM_006231.3(POLE):c.1851C>T (p.Ile617=) rs1338582924
NM_006231.3(POLE):c.1852G>A (p.Glu618Lys)
NM_006231.3(POLE):c.1855T>C (p.Cys619Arg) rs758779896
NM_006231.3(POLE):c.1856G>A (p.Cys619Tyr) rs752456199
NM_006231.3(POLE):c.1858C>G (p.Pro620Ala)
NM_006231.3(POLE):c.1858C>T (p.Pro620Ser) rs979085449
NM_006231.3(POLE):c.1859C>T (p.Pro620Leu) rs1565966691
NM_006231.3(POLE):c.185G>A (p.Trp62Ter) rs1565981538
NM_006231.3(POLE):c.1861C>T (p.Leu621Phe) rs945099471
NM_006231.3(POLE):c.1863C>G (p.Leu621=) rs767326433
NM_006231.3(POLE):c.1863C>T (p.Leu621=) rs767326433
NM_006231.3(POLE):c.1866C>T (p.Ile622=) rs1060504068
NM_006231.3(POLE):c.1868A>G (p.Tyr623Cys) rs150564856
NM_006231.3(POLE):c.1872C>T (p.His624=) rs368789955
NM_006231.3(POLE):c.1878C>T (p.Asp626=) rs771910847
NM_006231.3(POLE):c.1879G>A (p.Val627Met) rs747929590
NM_006231.3(POLE):c.1883G>T (p.Gly628Val)
NM_006231.3(POLE):c.1884G>C (p.Gly628=) rs1555227393
NM_006231.3(POLE):c.1885G>A (p.Ala629Thr)
NM_006231.3(POLE):c.1888A>G (p.Met630Val) rs1555227390
NM_006231.3(POLE):c.1894C>T (p.Pro632Ser) rs1565966599
NM_006231.3(POLE):c.1895C>G (p.Pro632Arg) rs1218293194
NM_006231.3(POLE):c.1897A>C (p.Asn633His) rs141657198
NM_006231.3(POLE):c.1897A>G (p.Asn633Asp)
NM_006231.3(POLE):c.1899C>T (p.Asn633=) rs748584449
NM_006231.3(POLE):c.1900A>G (p.Ile634Val) rs757296864
NM_006231.3(POLE):c.1905C>T (p.Ile635=) rs145203544
NM_006231.3(POLE):c.1916G>A (p.Arg639His)
NM_006231.3(POLE):c.1921C>T (p.Gln641Ter) rs1060500777
NM_006231.3(POLE):c.1923+10T>C rs765816578
NM_006231.3(POLE):c.1923+12C>G rs764448704
NM_006231.3(POLE):c.1923+15C>A rs763092591
NM_006231.3(POLE):c.1923+18G>A rs1387507213
NM_006231.3(POLE):c.1923+6A>G
NM_006231.3(POLE):c.1924-23_1927del rs1064795679
NM_006231.3(POLE):c.1924-5C>T rs878854846
NM_006231.3(POLE):c.1924-6T>C rs755311168
NM_006231.3(POLE):c.1924-6del rs758112633
NM_006231.3(POLE):c.1924-8C>T rs530352468
NM_006231.3(POLE):c.1924C>A (p.Pro642Thr) rs1178412345
NM_006231.3(POLE):c.1926C>T (p.Pro642=) rs779747873
NM_006231.3(POLE):c.1930G>A (p.Ala644Thr) rs1060500885
NM_006231.3(POLE):c.1935G>A (p.Met645Ile) rs561707898
NM_006231.3(POLE):c.1940A>G (p.Asp647Gly)
NM_006231.3(POLE):c.1940A>T (p.Asp647Val) rs1060500884
NM_006231.3(POLE):c.1941C>T (p.Asp647=) rs766967355
NM_006231.3(POLE):c.1942G>A (p.Glu648Lys)
NM_006231.3(POLE):c.1949C>T (p.Thr650Ile)
NM_006231.3(POLE):c.1950C>T (p.Thr650=) rs1555227360
NM_006231.3(POLE):c.1952G>A (p.Cys651Tyr) rs1060500877
NM_006231.3(POLE):c.1957G>T (p.Ala653Ser) rs751451482
NM_006231.3(POLE):c.1958C>T (p.Ala653Val) rs1555227357
NM_006231.3(POLE):c.1964A>G (p.Asp655Gly)
NM_006231.3(POLE):c.196A>G (p.Met66Val) rs534552358
NM_006231.3(POLE):c.1970A>G (p.Asn657Ser) rs763809781
NM_006231.3(POLE):c.198G>A (p.Met66Ile) rs764962999
NM_006231.3(POLE):c.1993C>A (p.Arg665=) rs367902268
NM_006231.3(POLE):c.1993C>T (p.Arg665Trp) rs367902268
NM_006231.3(POLE):c.1994G>A (p.Arg665Gln)
NM_006231.3(POLE):c.1997A>C (p.Lys666Thr) rs1060500796
NM_006231.3(POLE):c.1999A>C (p.Met667Leu) rs1418383181
NM_006231.3(POLE):c.199C>A (p.His67Asn) rs1555230392
NM_006231.3(POLE):c.19G>A (p.Gly7Arg) rs771930571
NM_006231.3(POLE):c.19G>C (p.Gly7Arg)
NM_006231.3(POLE):c.1A>C (p.Met1Leu) rs878854847
NM_006231.3(POLE):c.1A>G (p.Met1Val) rs878854847
NM_006231.3(POLE):c.1A>T (p.Met1Leu) rs878854847
NM_006231.3(POLE):c.2000T>C (p.Met667Thr)
NM_006231.3(POLE):c.2002G>A (p.Ala668Thr)
NM_006231.3(POLE):c.2014A>G (p.Arg672Gly)
NM_006231.3(POLE):c.2016G>A (p.Arg672=) rs991583405
NM_006231.3(POLE):c.2019C>T (p.Gly673=) rs748614767
NM_006231.3(POLE):c.201T>C (p.His67=) rs1555230391
NM_006231.3(POLE):c.2020G>A (p.Glu674Lys) rs779458859
NM_006231.3(POLE):c.2026+10G>A rs1282226694
NM_006231.3(POLE):c.2026+14G>T rs751509566
NM_006231.3(POLE):c.2026+18_2026+62del rs1064795073
NM_006231.3(POLE):c.2026+1G>C
NM_006231.3(POLE):c.2026+3G>T rs749631362
NM_006231.3(POLE):c.2026+9C>T rs373790607
NM_006231.3(POLE):c.2026A>G (p.Met676Val) rs1447713785
NM_006231.3(POLE):c.2027-11C>T rs1555227287
NM_006231.3(POLE):c.2027-12C>G rs767811987
NM_006231.3(POLE):c.2027-12C>T rs767811987
NM_006231.3(POLE):c.2027-16A>G rs1057517614
NM_006231.3(POLE):c.2027-61T>C
NM_006231.3(POLE):c.202C>A (p.Pro68Thr) rs1408600144
NM_006231.3(POLE):c.202C>G (p.Pro68Ala) rs1408600144
NM_006231.3(POLE):c.2038C>T (p.Arg680Cys) rs764044031
NM_006231.3(POLE):c.2039G>A (p.Arg680His) rs763522976
NM_006231.3(POLE):c.2039G>T (p.Arg680Leu) rs763522976
NM_006231.3(POLE):c.204+3A>G rs962416286
NM_006231.3(POLE):c.204+6C>T rs1555230386
NM_006231.3(POLE):c.204+8C>G rs749595462
NM_006231.3(POLE):c.2043C>T (p.Ser681=) rs554997781
NM_006231.3(POLE):c.2044G>A (p.Glu682Lys) rs878854848
NM_006231.3(POLE):c.2048A>G (p.Tyr683Cys)
NM_006231.3(POLE):c.2049C>G (p.Tyr683Ter) rs1196356920
NM_006231.3(POLE):c.2051A>G (p.His684Arg)
NM_006231.3(POLE):c.2051A>T (p.His684Leu)
NM_006231.3(POLE):c.2053C>T (p.Arg685Trp) rs116326665
NM_006231.3(POLE):c.2054G>A (p.Arg685Gln) rs770597683
NM_006231.3(POLE):c.2059C>A (p.Gln687Lys)
NM_006231.3(POLE):c.2061G>A (p.Gln687=) rs1400021883
NM_006231.3(POLE):c.2064C>G (p.His688Gln) rs1555227275
NM_006231.3(POLE):c.2068C>G (p.Leu690Val) rs1565965882
NM_006231.3(POLE):c.206_211delCCGAGA rs1555230325
NM_006231.3(POLE):c.2075C>T (p.Ser692Leu) rs1060500776
NM_006231.3(POLE):c.207C>G (p.Thr69=) rs146986360
NM_006231.3(POLE):c.207C>T (p.Thr69=) rs146986360
NM_006231.3(POLE):c.2083T>A (p.Phe695Ile) rs5744799
NM_006231.3(POLE):c.2083T>C (p.Phe695Leu) rs5744799
NM_006231.3(POLE):c.2083T>G (p.Phe695Val)
NM_006231.3(POLE):c.2085C>A (p.Phe695Leu) rs1060500837
NM_006231.3(POLE):c.2085C>T (p.Phe695=) rs1060500837
NM_006231.3(POLE):c.2087C>T (p.Pro696Leu) rs766037063
NM_006231.3(POLE):c.2089C>A (p.Pro697Thr) rs5744800
NM_006231.3(POLE):c.2089C>G (p.Pro697Ala) rs5744800
NM_006231.3(POLE):c.2089C>T (p.Pro697Ser) rs5744800
NM_006231.3(POLE):c.208G>A (p.Glu70Lys)
NM_006231.3(POLE):c.2090C>A (p.Pro697His) rs36120395
NM_006231.3(POLE):c.2090C>G (p.Pro697Arg) rs36120395
NM_006231.3(POLE):c.2090C>T (p.Pro697Leu) rs36120395
NM_006231.3(POLE):c.2091C>A (p.Pro697=) rs1060504055
NM_006231.3(POLE):c.2091C>T (p.Pro697=) rs1060504055
NM_006231.3(POLE):c.2091del (p.Leu698fs) rs752846614
NM_006231.3(POLE):c.2091dup (p.Phe699fs) rs752846614
NM_006231.3(POLE):c.2097C>T (p.Phe699=) rs1555227263
NM_006231.3(POLE):c.2098C>T (p.Pro700Ser) rs145793634
NM_006231.3(POLE):c.2099C>T (p.Pro700Leu) rs777002868
NM_006231.3(POLE):c.20_29dup (p.Asp12fs) rs1555231426
NM_006231.3(POLE):c.2106G>T (p.Gly702=) rs5744801
NM_006231.3(POLE):c.2110G>C (p.Ala704Pro)
NM_006231.3(POLE):c.2113C>T (p.Arg705Trp) rs200621883
NM_006231.3(POLE):c.2114G>A (p.Arg705Gln) rs773738016
NM_006231.3(POLE):c.2118C>T (p.Ala706=) rs1555227247
NM_006231.3(POLE):c.2122C>T (p.His708Tyr)
NM_006231.3(POLE):c.2125G>T (p.Glu709Ter)
NM_006231.3(POLE):c.2128C>T (p.Leu710=) rs1555227245
NM_006231.3(POLE):c.2129T>C (p.Leu710Pro)
NM_006231.3(POLE):c.2131T>C (p.Ser711Pro) rs374800058
NM_006231.3(POLE):c.2133C>G (p.Ser711=) rs1368511972
NM_006231.3(POLE):c.2134C>G (p.Arg712Gly) rs749194160
NM_006231.3(POLE):c.2134C>T (p.Arg712Cys) rs749194160
NM_006231.3(POLE):c.2135G>A (p.Arg712His) rs115225325
NM_006231.3(POLE):c.2135G>T (p.Arg712Leu)
NM_006231.3(POLE):c.2136C>T (p.Arg712=) rs755810756
NM_006231.3(POLE):c.2137G>A (p.Glu713Lys) rs751870998
NM_006231.3(POLE):c.2140del (p.Glu714fs) rs1555227239
NM_006231.3(POLE):c.2146G>A (p.Ala716Thr) rs1379490235
NM_006231.3(POLE):c.2147C>T (p.Ala716Val) rs567031389
NM_006231.3(POLE):c.2148G>A (p.Ala716=) rs115142739
NM_006231.3(POLE):c.214T>G (p.Leu72Val)
NM_006231.3(POLE):c.2152T>C (p.Tyr718His) rs1267528399
NM_006231.3(POLE):c.2154C>T (p.Tyr718=) rs1057524685
NM_006231.3(POLE):c.2155G>A (p.Glu719Lys) rs765254190
NM_006231.3(POLE):c.2158A>T (p.Lys720Ter) rs1565965603
NM_006231.3(POLE):c.2164del (p.Arg722fs) rs1555227234
NM_006231.3(POLE):c.2170G>A (p.Ala724Thr)
NM_006231.3(POLE):c.2171C>T (p.Ala724Val) rs61734163
NM_006231.3(POLE):c.2172G>A (p.Ala724=) rs372240734
NM_006231.3(POLE):c.2173+11G>A rs1057522621
NM_006231.3(POLE):c.2173+5G>A rs878854849
NM_006231.3(POLE):c.2173+9C>T rs1056554121
NM_006231.3(POLE):c.2173G>T (p.Asp725Tyr) rs760942391
NM_006231.3(POLE):c.2174-11G>A rs111570840
NM_006231.3(POLE):c.2174-12C>G rs192222479
NM_006231.3(POLE):c.2174-15C>T rs750771177
NM_006231.3(POLE):c.2174-8G>A rs117409343
NM_006231.3(POLE):c.2174-8G>C rs117409343
NM_006231.3(POLE):c.2174-9C>T rs774092365
NM_006231.3(POLE):c.2178C>T (p.Tyr726=) rs915331738
NM_006231.3(POLE):c.2179T>A (p.Cys727Ser) rs1060500832
NM_006231.3(POLE):c.2182C>T (p.Arg728Trp)
NM_006231.3(POLE):c.2183G>A (p.Arg728Gln) rs762552065
NM_006231.3(POLE):c.2187A>G (p.Lys729=) rs1060504065
NM_006231.3(POLE):c.2187_2199delinsGT (p.Ala730fs) rs1555227130
NM_006231.3(POLE):c.2189_2199delinsT (p.Ala730fs) rs1064792921
NM_006231.3(POLE):c.218A>G (p.Asp73Gly) rs1060500786
NM_006231.3(POLE):c.2193C>T (p.Tyr731=) rs769596366
NM_006231.3(POLE):c.2198A>G (p.Lys733Arg)
NM_006231.3(POLE):c.21G>A (p.Gly7=) rs1060504040
NM_006231.3(POLE):c.2204A>T (p.His735Leu)
NM_006231.3(POLE):c.2205C>T (p.His735=) rs1057523974
NM_006231.3(POLE):c.2207T>G (p.Ile736Ser) rs1060500850
NM_006231.3(POLE):c.2209A>G (p.Thr737Ala) rs779102091
NM_006231.3(POLE):c.2210C>A (p.Thr737Asn)
NM_006231.3(POLE):c.2214G>C (p.Lys738Asn) rs749305408
NM_006231.3(POLE):c.2217G>A (p.Val739=) rs374750963
NM_006231.3(POLE):c.2222A>G (p.Glu741Gly) rs1060500807
NM_006231.3(POLE):c.2223G>C (p.Glu741Asp) rs750872591
NM_006231.3(POLE):c.2224C>T (p.Arg742Cys)
NM_006231.3(POLE):c.2225G>A (p.Arg742His) rs116360781
NM_006231.3(POLE):c.2227C>T (p.Leu743Phe)
NM_006231.3(POLE):c.2236A>G (p.Ile746Val) rs1480527153
NM_006231.3(POLE):c.2244G>A (p.Gln748=) rs1057522980
NM_006231.3(POLE):c.2245C>A (p.Arg749=) rs751326135
NM_006231.3(POLE):c.2245C>T (p.Arg749Trp) rs751326135
NM_006231.3(POLE):c.2245del (p.Arg749fs) rs1565964707
NM_006231.3(POLE):c.2246G>A (p.Arg749Gln) rs1010159851
NM_006231.3(POLE):c.2251A>G (p.Asn751Asp) rs1565964683
NM_006231.3(POLE):c.2253C>T (p.Asn751=) rs1239144686
NM_006231.3(POLE):c.2255_2257del (p.Ser752del) rs878854850
NM_006231.3(POLE):c.2258_2260del (p.Phe753del) rs1060500779
NM_006231.3(POLE):c.2262C>T (p.Tyr754=) rs145337550
NM_006231.3(POLE):c.2263G>A (p.Val755Met) rs1222472060
NM_006231.3(POLE):c.2269A>G (p.Thr757Ala) rs1060500880
NM_006231.3(POLE):c.226A>T (p.Lys76Ter) rs1468404698
NM_006231.3(POLE):c.2271C>T (p.Thr757=) rs765532123
NM_006231.3(POLE):c.2272G>A (p.Val758Met) rs1210448190
NM_006231.3(POLE):c.2275C>T (p.Arg759Cys) rs759398253
NM_006231.3(POLE):c.2276G>A (p.Arg759His) rs746774432
NM_006231.3(POLE):c.2276G>T (p.Arg759Leu)
NM_006231.3(POLE):c.2284C>T (p.Arg762Trp) rs1064794759
NM_006231.3(POLE):c.2285G>A (p.Arg762Gln) rs1023692053
NM_006231.3(POLE):c.2289C>T (p.Asp763=) rs1057521109
NM_006231.3(POLE):c.228G>A (p.Lys76=)
NM_006231.3(POLE):c.2290A>C (p.Arg764=) rs1555227098
NM_006231.3(POLE):c.2292G>A (p.Arg764=) rs1555227097
NM_006231.3(POLE):c.2294G>A (p.Arg765His) rs1555227096
NM_006231.3(POLE):c.2298C>T (p.Tyr766=) rs760031526
NM_006231.3(POLE):c.2299G>A (p.Glu767Lys) rs1565964543
NM_006231.3(POLE):c.229C>T (p.Arg77Cys) rs1060500889
NM_006231.3(POLE):c.22C>G (p.Arg8Gly)
NM_006231.3(POLE):c.22C>T (p.Arg8Trp) rs1196946399
NM_006231.3(POLE):c.2308G>C (p.Gly770Arg) rs1565964535
NM_006231.3(POLE):c.2309G>T (p.Gly770Val) rs1555227087
NM_006231.3(POLE):c.2316C>T (p.His772=) rs768883555
NM_006231.3(POLE):c.2317A>G (p.Lys773Glu) rs1324963603
NM_006231.3(POLE):c.2319+19C>T rs370320759
NM_006231.3(POLE):c.2319+5G>T
NM_006231.3(POLE):c.2319G>A (p.Lys773=) rs1565964510
NM_006231.3(POLE):c.2320-113T>C
NM_006231.3(POLE):c.2320-13A>G rs75329753
NM_006231.3(POLE):c.2320-156C>T
NM_006231.3(POLE):c.2320-68G>A
NM_006231.3(POLE):c.2320-9G>A rs769834031
NM_006231.3(POLE):c.2320-9G>T rs769834031
NM_006231.3(POLE):c.2321T>C (p.Val774Ala) rs771591846
NM_006231.3(POLE):c.2322G>A (p.Val774=) rs1057524564
NM_006231.3(POLE):c.2327A>G (p.Lys776Arg) rs375791061
NM_006231.3(POLE):c.2332A>C (p.Lys778Gln) rs1263904781
NM_006231.3(POLE):c.2333A>C (p.Lys778Thr) rs868832791
NM_006231.3(POLE):c.2334G>A (p.Lys778=) rs929596537
NM_006231.3(POLE):c.2339C>T (p.Ser780Leu) rs778288256
NM_006231.3(POLE):c.233T>C (p.Leu78Ser)
NM_006231.3(POLE):c.2340G>A (p.Ser780=) rs5744822
NM_006231.3(POLE):c.2340G>C (p.Ser780=) rs5744822
NM_006231.3(POLE):c.2342C>T (p.Ala781Val) rs1060500855
NM_006231.3(POLE):c.2343G>A (p.Ala781=) rs199751241
NM_006231.3(POLE):c.2343_2345delGGC rs1064796065
NM_006231.3(POLE):c.2346C>G (p.Ala782=) rs114642756
NM_006231.3(POLE):c.2346C>T (p.Ala782=) rs114642756
NM_006231.3(POLE):c.2347G>A (p.Val783Met) rs371085002
NM_006231.3(POLE):c.2348T>C (p.Val783Ala) rs1269621526
NM_006231.3(POLE):c.2350G>A (p.Glu784Lys)
NM_006231.3(POLE):c.2358C>T (p.Gly786=) rs1278181584
NM_006231.3(POLE):c.2359G>A (p.Asp787Asn) rs878854851
NM_006231.3(POLE):c.235G>A (p.Gly79Ser)
NM_006231.3(POLE):c.2361C>T (p.Asp787=) rs1060504070
NM_006231.3(POLE):c.2362G>A (p.Ala788Thr) rs896350761
NM_006231.3(POLE):c.2363C>T (p.Ala788Val) rs1060500813
NM_006231.3(POLE):c.2364G>A (p.Ala788=) rs753367995
NM_006231.3(POLE):c.2370G>A (p.Glu790=) rs1555226756
NM_006231.3(POLE):c.2374A>G (p.Lys792Glu) rs1565962393
NM_006231.3(POLE):c.2377C>T (p.Arg793Cys) rs376624527
NM_006231.3(POLE):c.2378G>A (p.Arg793His) rs1422986795
NM_006231.3(POLE):c.2378G>T (p.Arg793Leu) rs1422986795
NM_006231.3(POLE):c.2379C>T (p.Arg793=) rs200259552
NM_006231.3(POLE):c.2382C>T (p.Cys794=)
NM_006231.3(POLE):c.2384A>G (p.Lys795Arg) rs867677414
NM_006231.3(POLE):c.2385G>A (p.Lys795=) rs761666105
NM_006231.3(POLE):c.2389A>G (p.Met797Val)
NM_006231.3(POLE):c.2389A>T (p.Met797Leu)
NM_006231.3(POLE):c.2398C>T (p.Leu800=) rs1333910199
NM_006231.3(POLE):c.239G>A (p.Ser80Asn) rs1064795406
NM_006231.3(POLE):c.2400G>T (p.Leu800=) rs776882880
NM_006231.3(POLE):c.2402A>G (p.Tyr801Cys) rs1060500825
NM_006231.3(POLE):c.2408C>T (p.Ser803Leu) rs1565962323
NM_006231.3(POLE):c.2409G>A (p.Ser803=) rs369150359
NM_006231.3(POLE):c.2411T>G (p.Leu804Arg)
NM_006231.3(POLE):c.2418G>A (p.Leu806=) rs772361015
NM_006231.3(POLE):c.241G>A (p.Ala81Thr) rs749720207
NM_006231.3(POLE):c.2423A>G (p.His808Arg) rs1060500854
NM_006231.3(POLE):c.2427G>A (p.Lys809=) rs754686646
NM_006231.3(POLE):c.2428T>C (p.Cys810Arg) rs753421179
NM_006231.3(POLE):c.2429G>A (p.Cys810Tyr) rs1565962279
NM_006231.3(POLE):c.242C>T (p.Ala81Val) rs780246896
NM_006231.3(POLE):c.2432T>C (p.Ile811Thr)
NM_006231.3(POLE):c.2433C>T (p.Ile811=) rs1256279930
NM_006231.3(POLE):c.2439C>A (p.Asn813Lys)
NM_006231.3(POLE):c.2442C>T (p.Ser814=) rs377036799
NM_006231.3(POLE):c.2453A>G (p.Tyr818Cys) rs148691442
NM_006231.3(POLE):c.2455G>C (p.Val819Leu) rs1555226692
NM_006231.3(POLE):c.2459T>C (p.Met820Thr)
NM_006231.3(POLE):c.2462G>A (p.Arg821His)
NM_006231.3(POLE):c.2462G>T (p.Arg821Leu) rs757051826
NM_006231.3(POLE):c.2463C>A (p.Arg821=) rs751392565
NM_006231.3(POLE):c.2463C>T (p.Arg821=) rs751392565
NM_006231.3(POLE):c.2465_2467dup (p.Gly823_Ala824insGlu) rs1237046519
NM_006231.3(POLE):c.2468+10C>T rs5744823
NM_006231.3(POLE):c.2468+12C>T rs776938447
NM_006231.3(POLE):c.2468+18C>T rs748559369
NM_006231.3(POLE):c.2468+19G>A rs768950827
NM_006231.3(POLE):c.2468+1G>A rs1060500806
NM_006231.3(POLE):c.2468+2dup rs1555226665
NM_006231.3(POLE):c.2468+4G>A rs1555226663
NM_006231.3(POLE):c.2468+4G>C rs1555226663
NM_006231.3(POLE):c.2468G>C (p.Gly823Ala)
NM_006231.3(POLE):c.2469-10G>A rs1060500870
NM_006231.3(POLE):c.2469-15G>A rs5744833
NM_006231.3(POLE):c.2469-227C>T
NM_006231.3(POLE):c.2469-242G>A
NM_006231.3(POLE):c.2469-5C>T rs1565961371
NM_006231.3(POLE):c.2469G>A (p.Gly823=) rs1006182755
NM_006231.3(POLE):c.2473C>T (p.Arg825Cys) rs200283666
NM_006231.3(POLE):c.2473_2492del (p.Arg825fs)
NM_006231.3(POLE):c.2474G>A (p.Arg825His)
NM_006231.3(POLE):c.2474G>T (p.Arg825Leu) rs1555226511
NM_006231.3(POLE):c.2477G>T (p.Trp826Leu) rs1565961348
NM_006231.3(POLE):c.2481C>T (p.Tyr827=) rs149513974
NM_006231.3(POLE):c.2484C>T (p.Ser828=) rs1060504053
NM_006231.3(POLE):c.2485A>G (p.Met829Val) rs762395135
NM_006231.3(POLE):c.2486T>C (p.Met829Thr) rs1060500860
NM_006231.3(POLE):c.2487G>A (p.Met829Ile) rs372109189
NM_006231.3(POLE):c.2492T>G (p.Met831Arg) rs749619971
NM_006231.3(POLE):c.2499C>T (p.Gly833=)
NM_006231.3(POLE):c.249T>C (p.Asp83=) rs374225370
NM_006231.3(POLE):c.2502C>T (p.Ile834=) rs769459883
NM_006231.3(POLE):c.2503G>A (p.Val835Ile) rs1013082648
NM_006231.3(POLE):c.2505C>G (p.Val835=) rs878854852
NM_006231.3(POLE):c.2510T>C (p.Phe837Ser) rs139182500
NM_006231.3(POLE):c.2513C>T (p.Thr838Ile)
NM_006231.3(POLE):c.2527A>G (p.Ile843Val) rs780758461
NM_006231.3(POLE):c.252C>T (p.Tyr84=) rs148838481
NM_006231.3(POLE):c.2532C>A (p.Thr844=) rs1060504073
NM_006231.3(POLE):c.2536G>T (p.Ala846Ser) rs1555226498
NM_006231.3(POLE):c.2537C>T (p.Ala846Val) rs1060500798
NM_006231.3(POLE):c.2540G>A (p.Arg847Gln) rs534297483
NM_006231.3(POLE):c.2544G>C (p.Glu848Asp) rs374905660
NM_006231.3(POLE):c.254A>G (p.Tyr85Cys) rs1565981016
NM_006231.3(POLE):c.2550C>G (p.Ile850Met) rs5744834
NM_006231.3(POLE):c.2550C>T (p.Ile850=) rs5744834
NM_006231.3(POLE):c.2551G>T (p.Glu851Ter)
NM_006231.3(POLE):c.255_257del (p.Phe86del) rs1565981011
NM_006231.3(POLE):c.2561+14G>A rs912028278
NM_006231.3(POLE):c.2561+16G>A rs1057523560
NM_006231.3(POLE):c.2561+1G>A rs1565961210
NM_006231.3(POLE):c.2561+5G>A rs1555226494
NM_006231.3(POLE):c.2561+6T>C rs116231808
NM_006231.3(POLE):c.2562-20G>C rs557791800
NM_006231.3(POLE):c.2562-2A>C rs751662353
NM_006231.3(POLE):c.2562-48T>C
NM_006231.3(POLE):c.2562-5T>G rs1461925348
NM_006231.3(POLE):c.2566C>T (p.Pro856Ser) rs1555226454
NM_006231.3(POLE):c.2568C>T (p.Pro856=) rs1167513955
NM_006231.3(POLE):c.2569T>C (p.Leu857=) rs763456552
NM_006231.3(POLE):c.2575C>T (p.Leu859=) rs1565960909
NM_006231.3(POLE):c.2587G>C (p.Gly863Arg)
NM_006231.3(POLE):c.258T>C (p.Phe86=) rs1555230311
NM_006231.3(POLE):c.2590A>G (p.Ile864Val)
NM_006231.3(POLE):c.2592A>G (p.Ile864Met)
NM_006231.3(POLE):c.2598C>T (p.Cys866=) rs765653117
NM_006231.3(POLE):c.2599G>A (p.Val867Ile) rs374200895
NM_006231.3(POLE):c.259A>G (p.Ile87Val) rs1223305093
NM_006231.3(POLE):c.25C>T (p.Arg9Trp) rs1480510431
NM_006231.3(POLE):c.2602C>T (p.Leu868=) rs115830215
NM_006231.3(POLE):c.2604G>A (p.Leu868=) rs760386245
NM_006231.3(POLE):c.2609A>G (p.Asn870Ser) rs1060500875
NM_006231.3(POLE):c.260T>C (p.Ile87Thr) rs1565980997
NM_006231.3(POLE):c.2610C>G (p.Asn870Lys) rs1057524008
NM_006231.3(POLE):c.2610C>T (p.Asn870=) rs1057524008
NM_006231.3(POLE):c.2612G>C (p.Ser871Thr) rs770470552
NM_006231.3(POLE):c.2626T>C (p.Phe876Leu) rs1208731306
NM_006231.3(POLE):c.2630T>C (p.Val877Ala) rs1565960854
NM_006231.3(POLE):c.2635A>G (p.Lys879Glu) rs760333190
NM_006231.3(POLE):c.2636A>G (p.Lys879Arg) rs1555226439
NM_006231.3(POLE):c.2638A>G (p.Thr880Ala) rs138548494
NM_006231.3(POLE):c.2638_2639delinsCT (p.Thr880Leu) rs1555226437
NM_006231.3(POLE):c.2639C>T (p.Thr880Met) rs1337524033
NM_006231.3(POLE):c.2640G>A (p.Thr880=) rs1057521163
NM_006231.3(POLE):c.2644A>C (p.Asn882His) rs1455015315
NM_006231.3(POLE):c.2645A>G (p.Asn882Ser) rs539312991
NM_006231.3(POLE):c.2648T>C (p.Val883Ala) rs1555226430
NM_006231.3(POLE):c.2659A>T (p.Lys887Ter) rs1060500878
NM_006231.3(POLE):c.2660A>G (p.Lys887Arg)
NM_006231.3(POLE):c.2662G>A (p.Val888Met)
NM_006231.3(POLE):c.2666C>A (p.Thr889Asn)
NM_006231.3(POLE):c.2666C>T (p.Thr889Ile) rs768534409
NM_006231.3(POLE):c.2668A>G (p.Ile890Val) rs749012938
NM_006231.3(POLE):c.266A>C (p.Asp89Ala) rs756843283
NM_006231.3(POLE):c.2676C>T (p.Tyr892=) rs878854853
NM_006231.3(POLE):c.2678C>T (p.Pro893Leu) rs1555226423
NM_006231.3(POLE):c.2679A>C (p.Pro893=) rs1060504043
NM_006231.3(POLE):c.267T>C (p.Asp89=) rs1364386484
NM_006231.3(POLE):c.2682C>T (p.Gly894=) rs757453683
NM_006231.3(POLE):c.2683G>A (p.Ala895Thr) rs201115064
NM_006231.3(POLE):c.2684C>T (p.Ala895Val) rs1458833255
NM_006231.3(POLE):c.268G>A (p.Asp90Asn)
NM_006231.3(POLE):c.2694C>T (p.Asn898=) rs1060504058
NM_006231.3(POLE):c.2695A>G (p.Ile899Val) rs1555226418
NM_006231.3(POLE):c.2697C>T (p.Ile899=) rs1555226416
NM_006231.3(POLE):c.2701G>A (p.Val901Ile) rs1565960706
NM_006231.3(POLE):c.2703C>T (p.Val901=) rs1555226414
NM_006231.3(POLE):c.2706+10G>A rs372609836
NM_006231.3(POLE):c.2706+11G>C rs1555226410
NM_006231.3(POLE):c.2706+12dup rs1555226409
NM_006231.3(POLE):c.2706+19G>A rs777067793
NM_006231.3(POLE):c.2706+1_2706+5delGTGAG rs779830137
NM_006231.3(POLE):c.2706+2T>C rs1555226411
NM_006231.3(POLE):c.2706+5G>A rs375931088
NM_006231.3(POLE):c.2707-2A>G
NM_006231.3(POLE):c.2707-3C>T rs1555226069
NM_006231.3(POLE):c.2707-9G>A rs1057521516
NM_006231.3(POLE):c.2707G>T (p.Glu903Ter) rs1555226066
NM_006231.3(POLE):c.2709A>G (p.Glu903=) rs1555226065
NM_006231.3(POLE):c.270C>G (p.Asp90Glu)
NM_006231.3(POLE):c.270del (p.Asp90fs) rs878854854
NM_006231.3(POLE):c.2711G>C (p.Gly904Ala) rs1332965505
NM_006231.3(POLE):c.2711G>T (p.Gly904Val) rs1332965505
NM_006231.3(POLE):c.2712C>T (p.Gly904=) rs1555226063
NM_006231.3(POLE):c.2716A>G (p.Thr906Ala)
NM_006231.3(POLE):c.271G>A (p.Gly91Arg) rs1316316435
NM_006231.3(POLE):c.2720A>G (p.Asn907Ser)
NM_006231.3(POLE):c.2721T>C (p.Asn907=) rs779005137
NM_006231.3(POLE):c.2722G>A (p.Asp908Asn) rs1565958703
NM_006231.3(POLE):c.2725dup (p.Gln909fs) rs1555226059
NM_006231.3(POLE):c.2727G>A (p.Gln909=) rs1555226055
NM_006231.3(POLE):c.272G>A (p.Gly91Glu) rs376348304
NM_006231.3(POLE):c.2731del (p.Gln911fs) rs1555226051
NM_006231.3(POLE):c.2732A>C (p.Gln911Pro)
NM_006231.3(POLE):c.2739G>A (p.Leu913=) rs878854855
NM_006231.3(POLE):c.2748G>A (p.Pro916=) rs756542563
NM_006231.3(POLE):c.274A>C (p.Ser92Arg) rs758382516
NM_006231.3(POLE):c.2759C>G (p.Thr920Ser)
NM_006231.3(POLE):c.2763C>T (p.Tyr921=) rs767254003
NM_006231.3(POLE):c.2764G>A (p.Val922Ile) rs551966935
NM_006231.3(POLE):c.2770C>A (p.Arg924Ser) rs369751686
NM_006231.3(POLE):c.2770C>T (p.Arg924Cys) rs369751686
NM_006231.3(POLE):c.2771G>A (p.Arg924His) rs763594644
NM_006231.3(POLE):c.2773T>C (p.Ser925Pro) rs141552148
NM_006231.3(POLE):c.2774C>T (p.Ser925Leu)
NM_006231.3(POLE):c.2781C>T (p.Asn927=) rs775486303
NM_006231.3(POLE):c.2785A>G (p.Ile929Val)
NM_006231.3(POLE):c.2792T>C (p.Phe931Ser) rs376546593
NM_006231.3(POLE):c.2801A>G (p.Asp934Gly) rs1242503528
NM_006231.3(POLE):c.2811C>A (p.Tyr937Ter)
NM_006231.3(POLE):c.2812C>T (p.Leu938Phe)
NM_006231.3(POLE):c.2818A>G (p.Met940Val) rs148382941
NM_006231.3(POLE):c.2820G>A (p.Met940Ile)
NM_006231.3(POLE):c.2821A>G (p.Ile941Val) rs1060500887
NM_006231.3(POLE):c.2824C>T (p.Leu942Phe) rs1555226025
NM_006231.3(POLE):c.2830G>T (p.Ala944Ser)
NM_006231.3(POLE):c.2832C>T (p.Ala944=) rs1164408019
NM_006231.3(POLE):c.2847C>G (p.Gly949=) rs1555226021
NM_006231.3(POLE):c.2847C>T (p.Gly949=) rs1555226021
NM_006231.3(POLE):c.285+13C>A rs76960367
NM_006231.3(POLE):c.285+17G>A rs5744736
NM_006231.3(POLE):c.285+17G>T rs5744736
NM_006231.3(POLE):c.285+7C>T rs1555230294
NM_006231.3(POLE):c.2852A>C (p.Lys951Thr) rs1555226017
NM_006231.3(POLE):c.285G>A (p.Lys95=) rs1060500794
NM_006231.3(POLE):c.286-14G>C rs373822280
NM_006231.3(POLE):c.286-3C>A rs1555230255
NM_006231.3(POLE):c.286-3C>T rs1555230255
NM_006231.3(POLE):c.286-4delA rs1555230256
NM_006231.3(POLE):c.286-7T>G
NM_006231.3(POLE):c.286-96G>A
NM_006231.3(POLE):c.2864+10_2864+11delTC rs1555226012
NM_006231.3(POLE):c.2864+3G>A rs1060500856
NM_006231.3(POLE):c.2864+8T>C rs878854856
NM_006231.3(POLE):c.2864+9C>T rs780578558
NM_006231.3(POLE):c.2865-10T>C rs774623653
NM_006231.3(POLE):c.2865-17dup rs369732588
NM_006231.3(POLE):c.2865-2A>G rs867360056
NM_006231.3(POLE):c.2865-3C>T rs1203095918
NM_006231.3(POLE):c.2865-3del rs1555225973
NM_006231.3(POLE):c.2865-4T>C rs1060500840
NM_006231.3(POLE):c.2865-5_2865-4del rs369732588
NM_006231.3(POLE):c.2865-6_2865-4del rs369732588
NM_006231.3(POLE):c.2865-8T>C rs768655308
NM_006231.3(POLE):c.2872G>A (p.Val958Met)
NM_006231.3(POLE):c.2874G>T (p.Val958=) rs1232360648
NM_006231.3(POLE):c.2877C>T (p.Phe959=) rs770453296
NM_006231.3(POLE):c.2879A>G (p.Asn960Ser) rs746311547
NM_006231.3(POLE):c.2880T>G (p.Asn960Lys) rs1555225966
NM_006231.3(POLE):c.2883A>G (p.Glu961=) rs1555225965
NM_006231.3(POLE):c.2886C>T (p.Asp962=) rs757682919
NM_006231.3(POLE):c.2887G>A (p.Gly963Ser) rs751237672
NM_006231.3(POLE):c.2888G>A (p.Gly963Asp) rs777454763
NM_006231.3(POLE):c.28C>T (p.Arg10Cys) rs1245695191
NM_006231.3(POLE):c.2904C>T (p.Leu968=) rs752277161
NM_006231.3(POLE):c.2908G>A (p.Gly970Ser) rs1480250083
NM_006231.3(POLE):c.2910C>G (p.Gly970=) rs1555225960
NM_006231.3(POLE):c.2917G>T (p.Val973Phe)
NM_006231.3(POLE):c.2919C>A (p.Val973=) rs1060500819
NM_006231.3(POLE):c.2923C>T (p.Arg975Cys)
NM_006231.3(POLE):c.2924G>A (p.Arg975His)
NM_006231.3(POLE):c.2926C>T (p.Arg976Cys) rs1060500820
NM_006231.3(POLE):c.2927G>A (p.Arg976His) rs878854857
NM_006231.3(POLE):c.2928C>T (p.Arg976=) rs5744845
NM_006231.3(POLE):c.292T>G (p.Leu98Val)
NM_006231.3(POLE):c.2932G>T (p.Glu978Ter) rs1555225958
NM_006231.3(POLE):c.2932dup (p.Glu978fs) rs1032311596
NM_006231.3(POLE):c.2935C>T (p.Leu979=) rs56081968
NM_006231.3(POLE):c.2952C>T (p.Ile984=) rs1000861691
NM_006231.3(POLE):c.2956del (p.Gln986fs)
NM_006231.3(POLE):c.2958A>G (p.Gln986=) rs538349768
NM_006231.3(POLE):c.295C>G (p.Pro99Ala) rs1060500863
NM_006231.3(POLE):c.295C>T (p.Pro99Ser)
NM_006231.3(POLE):c.2960C>A (p.Ser987Tyr)
NM_006231.3(POLE):c.2960C>T (p.Ser987Phe)
NM_006231.3(POLE):c.2963C>T (p.Ser988Leu) rs138391248
NM_006231.3(POLE):c.2964G>A (p.Ser988=) rs200080353
NM_006231.3(POLE):c.2965G>T (p.Val989Leu)
NM_006231.3(POLE):c.2967G>A (p.Val989=) rs1222374159
NM_006231.3(POLE):c.296C>T (p.Pro99Leu) rs5744739
NM_006231.3(POLE):c.2974G>A (p.Ala992Thr) rs115193764
NM_006231.3(POLE):c.297C>A (p.Pro99=) rs962061115
NM_006231.3(POLE):c.2982C>T (p.Leu994=) rs771463033
NM_006231.3(POLE):c.2993C>T (p.Thr998Met) rs989886155
NM_006231.3(POLE):c.2994G>A (p.Thr998=) rs777955589
NM_006231.3(POLE):c.2994G>T (p.Thr998=) rs777955589
NM_006231.3(POLE):c.2T>A (p.Met1Lys) rs879254126
NM_006231.3(POLE):c.2T>C (p.Met1Thr) rs879254126
NM_006231.3(POLE):c.2T>G (p.Met1Arg) rs879254126
NM_006231.3(POLE):c.3003G>A (p.Glu1001=) rs1555225949
NM_006231.3(POLE):c.3014C>T (p.Ser1005Phe) rs550579850
NM_006231.3(POLE):c.3015T>C (p.Ser1005=) rs376781169
NM_006231.3(POLE):c.3019G>C (p.Ala1007Pro) rs747692201
NM_006231.3(POLE):c.301A>G (p.Lys101Glu) rs560654523
NM_006231.3(POLE):c.3027G>T (p.Val1009=) rs1057521358
NM_006231.3(POLE):c.302A>G (p.Lys101Arg) rs1016258970
NM_006231.3(POLE):c.3031G>A (p.Asp1011Asn)
NM_006231.3(POLE):c.3036C>T (p.Tyr1012=) rs1060504062
NM_006231.3(POLE):c.3039G>A (p.Trp1013Ter)
NM_006231.3(POLE):c.3045C>T (p.Asp1015=) rs753809068
NM_006231.3(POLE):c.3046G>A (p.Val1016Met) rs147692158
NM_006231.3(POLE):c.3048G>A (p.Val1016=) rs755956392
NM_006231.3(POLE):c.3049C>T (p.Leu1017=) rs371831931
NM_006231.3(POLE):c.3051G>A (p.Leu1017=) rs1555225936
NM_006231.3(POLE):c.3054C>T (p.Tyr1018=) rs201249963
NM_006231.3(POLE):c.3060+16C>T rs1428999721
NM_006231.3(POLE):c.3060+188A>T
NM_006231.3(POLE):c.3060+189C>T
NM_006231.3(POLE):c.3060+1_3060+2dup
NM_006231.3(POLE):c.3060+20C>G rs1555225929
NM_006231.3(POLE):c.3060+2T>G rs775843286
NM_006231.3(POLE):c.3060+5_3060+6delinsTTA rs1555225934
NM_006231.3(POLE):c.3060+7G>T rs1555225931
NM_006231.3(POLE):c.3060G>A (p.Lys1020=) rs878854858
NM_006231.3(POLE):c.3061-10C>G rs750269574
NM_006231.3(POLE):c.3061-12G>C rs779496994
NM_006231.3(POLE):c.3061-15A>G rs754528052
NM_006231.3(POLE):c.3061-4C>G rs201517516
NM_006231.3(POLE):c.3061-4C>T rs201517516
NM_006231.3(POLE):c.3061-9T>C rs878854859
NM_006231.3(POLE):c.3069C>T (p.Asn1023=) rs759786460
NM_006231.3(POLE):c.306G>A (p.Pro102=) rs759888478
NM_006231.3(POLE):c.3071T>C (p.Met1024Thr) rs1565956324
NM_006231.3(POLE):c.3071del (p.Met1024fs)
NM_006231.3(POLE):c.3072G>T (p.Met1024Ile) rs1060500791
NM_006231.3(POLE):c.3074dup (p.Pro1025_Asp1026insTer) rs1565956310
NM_006231.3(POLE):c.3076_3096dup (p.Asp1026_Leu1032dup) rs1555225690
NM_006231.3(POLE):c.307T>C (p.Tyr103His) rs1292121980
NM_006231.3(POLE):c.3084G>A (p.Glu1028=) rs1057521764
NM_006231.3(POLE):c.3086T>C (p.Leu1029Pro) rs1228020822
NM_006231.3(POLE):c.3089T>A (p.Phe1030Tyr) rs1565956275
NM_006231.3(POLE):c.3090C>A (p.Phe1030Leu)
NM_006231.3(POLE):c.3090C>T (p.Phe1030=) rs766306895
NM_006231.3(POLE):c.3094C>T (p.Leu1032Phe) rs1555225694
NM_006231.3(POLE):c.3096C>T (p.Leu1032=) rs200122629
NM_006231.3(POLE):c.30C>A (p.Arg10=) rs1555231425
NM_006231.3(POLE):c.30C>T (p.Arg10=) rs1555231425
NM_006231.3(POLE):c.3108C>T (p.Asn1036=) rs772522635
NM_006231.3(POLE):c.3109C>T (p.Arg1037Cys) rs948001596
NM_006231.3(POLE):c.3121C>T (p.Arg1041Trp) rs762140272
NM_006231.3(POLE):c.3122G>A (p.Arg1041Gln) rs774645622
NM_006231.3(POLE):c.3125A>G (p.Lys1042Arg)
NM_006231.3(POLE):c.3126G>A (p.Lys1042=) rs5744856
NM_006231.3(POLE):c.3130G>A (p.Glu1044Lys)
NM_006231.3(POLE):c.3130G>C (p.Glu1044Gln) rs1060500869
NM_006231.3(POLE):c.3135T>C (p.Asp1045=) rs748871390
NM_006231.3(POLE):c.3138C>T (p.Tyr1046=) rs779628723
NM_006231.3(POLE):c.3139G>A (p.Gly1047Arg) rs1555225676
NM_006231.3(POLE):c.3140G>A (p.Gly1047Glu)
NM_006231.3(POLE):c.3141G>A (p.Gly1047=) rs368560398
NM_006231.3(POLE):c.3142G>A (p.Glu1048Lys) rs1164020030
NM_006231.3(POLE):c.314A>T (p.Tyr105Phe) rs1451750169
NM_006231.3(POLE):c.3151T>C (p.Ser1051Pro) rs1064796258
NM_006231.3(POLE):c.3154A>G (p.Thr1052Ala)
NM_006231.3(POLE):c.3155_3156delinsTA (p.Thr1052Ile)
NM_006231.3(POLE):c.3156G>A (p.Thr1052=) rs5744857
NM_006231.3(POLE):c.3159C>T (p.Ser1053=) rs1057524186
NM_006231.3(POLE):c.3170C>T (p.Ala1057Val) rs975893534
NM_006231.3(POLE):c.3175C>T (p.Arg1059Cys) rs1555225670
NM_006231.3(POLE):c.3176G>T (p.Arg1059Leu)
NM_006231.3(POLE):c.317T>C (p.Ile106Thr)
NM_006231.3(POLE):c.3183C>T (p.Ala1061=) rs751756901
NM_006231.3(POLE):c.318T>C (p.Ile106=) rs770759936
NM_006231.3(POLE):c.3195A>G (p.Gly1065=) rs1454076563
NM_006231.3(POLE):c.3196G>A (p.Asp1066Asn) rs1060500851
NM_006231.3(POLE):c.3198C>A (p.Asp1066Glu) rs1555225663
NM_006231.3(POLE):c.31G>A (p.Ala11Thr)
NM_006231.3(POLE):c.3203T>C (p.Met1068Thr)
NM_006231.3(POLE):c.320C>T (p.Ala107Val) rs878854860
NM_006231.3(POLE):c.3214G>A (p.Ala1072Thr) rs1555225652
NM_006231.3(POLE):c.3219G>A (p.Gly1073=) rs760636704
NM_006231.3(POLE):c.3219G>T (p.Gly1073=) rs760636704
NM_006231.3(POLE):c.321G>A (p.Ala107=) rs752370920
NM_006231.3(POLE):c.3223A>T (p.Ser1075Cys) rs145680387
NM_006231.3(POLE):c.3228C>T (p.Cys1076=) rs767929667
NM_006231.3(POLE):c.3229C>G (p.Arg1077Gly)
NM_006231.3(POLE):c.3229C>T (p.Arg1077Cys) rs149777592
NM_006231.3(POLE):c.3229_3241delinsGG (p.Arg1077fs) rs1064792919
NM_006231.3(POLE):c.322A>T (p.Thr108Ser) rs1565980550
NM_006231.3(POLE):c.3230G>A (p.Arg1077His) rs768950975
NM_006231.3(POLE):c.3235A>G (p.Ile1079Val) rs775002004
NM_006231.3(POLE):c.3240C>G (p.Ile1080Met) rs769386598
NM_006231.3(POLE):c.3244C>T (p.Arg1082Cys)
NM_006231.3(POLE):c.3245G>A (p.Arg1082His) rs201744227
NM_006231.3(POLE):c.3247A>C (p.Lys1083Gln) rs1260941612
NM_006231.3(POLE):c.3252C>T (p.Pro1084=) rs556962209
NM_006231.3(POLE):c.3257G>A (p.Gly1086Asp) rs1060500778
NM_006231.3(POLE):c.3258C>T (p.Gly1086=) rs1555225637
NM_006231.3(POLE):c.3264T>C (p.Pro1088=) rs777729097
NM_006231.3(POLE):c.3264_3275+13delTGTCACGGAGAGGTGAGGGCTCCCC rs761516512
NM_006231.3(POLE):c.3264_3275+13dup rs761516512
NM_006231.3(POLE):c.3265_3275+15dup rs1555225627
NM_006231.3(POLE):c.3267C>T (p.Val1089=) rs1555225636
NM_006231.3(POLE):c.3269C>T (p.Thr1090Met) rs1030360914
NM_006231.3(POLE):c.326G>A (p.Arg109Lys) rs1555230239
NM_006231.3(POLE):c.3270G>A (p.Thr1090=) rs758258927
NM_006231.3(POLE):c.3275+12_3275+37del rs1057517627
NM_006231.3(POLE):c.3275+12_3275+37dup rs1057517627
NM_006231.3(POLE):c.3275+14C>G rs368185422
NM_006231.3(POLE):c.3275+14_3275+21delinsTCATCACT rs1064795121
NM_006231.3(POLE):c.3275+16A>G rs5744858
NM_006231.3(POLE):c.3275+1G>A rs1402672053
NM_006231.3(POLE):c.3275+4A>T
NM_006231.3(POLE):c.3275+6G>T rs1060500874
NM_006231.3(POLE):c.3275+92T>C
NM_006231.3(POLE):c.3275G>C (p.Arg1092Thr) rs1060500857
NM_006231.3(POLE):c.3276-186_3276-185insACAC
NM_006231.3(POLE):c.3276-2A>G rs1060500838
NM_006231.3(POLE):c.3276-3C>G
NM_006231.3(POLE):c.3276-4C>T rs1555225328
NM_006231.3(POLE):c.3276-5C>G rs1293099867
NM_006231.3(POLE):c.3278C>G (p.Ala1093Gly) rs1565954149
NM_006231.3(POLE):c.3279C>T (p.Ala1093=) rs1057521217
NM_006231.3(POLE):c.3291C>T (p.Ala1097=) rs764562529
NM_006231.3(POLE):c.3292A>G (p.Ile1098Val)
NM_006231.3(POLE):c.32C>T (p.Ala11Val) rs1060500821
NM_006231.3(POLE):c.330+3G>A rs369152225
NM_006231.3(POLE):c.330+55G>C rs869312623
NM_006231.3(POLE):c.3305A>C (p.Glu1102Ala) rs1555225324
NM_006231.3(POLE):c.3308C>A (p.Pro1103His) rs759126051
NM_006231.3(POLE):c.331-1G>A rs1555230196
NM_006231.3(POLE):c.331-2A>G rs1565980363
NM_006231.3(POLE):c.331-3T>C rs1269825866
NM_006231.3(POLE):c.331-3T>G rs1269825866
NM_006231.3(POLE):c.3311C>T (p.Thr1104Met) rs531705054
NM_006231.3(POLE):c.3312G>A (p.Thr1104=) rs1026839284
NM_006231.3(POLE):c.3318G>T (p.Arg1106Ser)
NM_006231.3(POLE):c.3320A>G (p.Lys1107Arg) rs1060500800
NM_006231.3(POLE):c.3321G>A (p.Lys1107=) rs1332148448
NM_006231.3(POLE):c.3327T>C (p.Phe1109=) rs748049159
NM_006231.3(POLE):c.3327dup (p.Leu1110fs) rs1555225319
NM_006231.3(POLE):c.3328C>A (p.Leu1110Ile) rs1555225317
NM_006231.3(POLE):c.3328C>G (p.Leu1110Val) rs1555225317
NM_006231.3(POLE):c.3331C>T (p.Arg1111Trp) rs774028311
NM_006231.3(POLE):c.3332G>A (p.Arg1111Gln) rs114315196
NM_006231.3(POLE):c.3333G>A (p.Arg1111=) rs200319525
NM_006231.3(POLE):c.3333G>T (p.Arg1111=) rs200319525
NM_006231.3(POLE):c.3335A>C (p.Lys1112Thr) rs1555225311
NM_006231.3(POLE):c.3338G>A (p.Trp1113Ter) rs1461016090
NM_006231.3(POLE):c.3338G>C (p.Trp1113Ser) rs1461016090
NM_006231.3(POLE):c.333T>C (p.Gly111=) rs933506354
NM_006231.3(POLE):c.3342C>T (p.Leu1114=) rs769584721
NM_006231.3(POLE):c.3347_3350delinsTT (p.Ser1116fs) rs1555225303
NM_006231.3(POLE):c.3348C>G (p.Ser1116Arg)
NM_006231.3(POLE):c.3349T>C (p.Ser1117Pro) rs777793030
NM_006231.3(POLE):c.3350C>T (p.Ser1117Phe) rs1555225302
NM_006231.3(POLE):c.3355C>T (p.Leu1119Phe)
NM_006231.3(POLE):c.3359A>C (p.Gln1120Pro) rs1565953982
NM_006231.3(POLE):c.3363C>T (p.Asp1121=) rs1057522030
NM_006231.3(POLE):c.3367G>C (p.Asp1123His) rs1565953965
NM_006231.3(POLE):c.3373C>T (p.Arg1125Ter) rs139603739
NM_006231.3(POLE):c.3374G>A (p.Arg1125Gln) rs1565953956
NM_006231.3(POLE):c.3376G>T (p.Ala1126Ser) rs1555225288
NM_006231.3(POLE):c.3377C>T (p.Ala1126Val) rs373707446
NM_006231.3(POLE):c.3378+10A>G rs193075152
NM_006231.3(POLE):c.3378+11G>C rs1281293430
NM_006231.3(POLE):c.3378+15C>T rs574954983
NM_006231.3(POLE):c.3378+7G>T rs755370377
NM_006231.3(POLE):c.3379-12C>T rs187618435
NM_006231.3(POLE):c.3379-17G>A rs907214942
NM_006231.3(POLE):c.3379-18C>T rs1057517632
NM_006231.3(POLE):c.3379-5T>C rs5744886
NM_006231.3(POLE):c.3379-6A>G rs754281673
NM_006231.3(POLE):c.3379-8A>C rs1555225219
NM_006231.3(POLE):c.3382C>G (p.Leu1128Val)
NM_006231.3(POLE):c.3382C>T (p.Leu1128=) rs755839896
NM_006231.3(POLE):c.3384G>A (p.Leu1128=) rs1555225210
NM_006231.3(POLE):c.3387T>C (p.Asp1129=) rs371357642
NM_006231.3(POLE):c.3388T>C (p.Trp1130Arg)
NM_006231.3(POLE):c.3392A>G (p.Asp1131Gly)
NM_006231.3(POLE):c.3393C>G (p.Asp1131Glu) rs750084800
NM_006231.3(POLE):c.3396C>T (p.Tyr1132=)
NM_006231.3(POLE):c.3400A>C (p.Ile1134Leu) rs1060500888
NM_006231.3(POLE):c.3401T>C (p.Ile1134Thr) rs1054915845
NM_006231.3(POLE):c.3406C>T (p.Arg1136Trp) rs531475854
NM_006231.3(POLE):c.3407G>A (p.Arg1136Gln) rs761355093
NM_006231.3(POLE):c.340C>T (p.Arg114Ter) rs1555230189
NM_006231.3(POLE):c.3411G>A (p.Leu1137=) rs368920055
NM_006231.3(POLE):c.3415_3420delinsTG (p.Gly1138_Ser1139insTer) rs1555225201
NM_006231.3(POLE):c.3417C>T (p.Ser1139=) rs762838377
NM_006231.3(POLE):c.3418G>A (p.Ala1140Thr) rs775271152
NM_006231.3(POLE):c.341G>A (p.Arg114Gln) rs375785166
NM_006231.3(POLE):c.3429G>A (p.Lys1143=) rs1060504042
NM_006231.3(POLE):c.3432C>G (p.Ile1144Met)
NM_006231.3(POLE):c.3434_3436delTCA rs976070874
NM_006231.3(POLE):c.3437C>G (p.Thr1146Ser) rs1555225192
NM_006231.3(POLE):c.3438C>T (p.Thr1146=) rs1432352196
NM_006231.3(POLE):c.343G>A (p.Glu115Lys) rs1565980334
NM_006231.3(POLE):c.3441C>T (p.Ile1147=) rs748278223
NM_006231.3(POLE):c.3443C>G (p.Pro1148Arg) rs1060500886
NM_006231.3(POLE):c.3446C>T (p.Ala1149Val) rs778212434
NM_006231.3(POLE):c.3447G>A (p.Ala1149=)
NM_006231.3(POLE):c.3450C>T (p.Ala1150=) rs1207177804
NM_006231.3(POLE):c.3459+13T>G rs372587100
NM_006231.3(POLE):c.3459+1G>A rs1555225184
NM_006231.3(POLE):c.3459+2T>C rs1057517634
NM_006231.3(POLE):c.3459+3A>C rs1555225183
NM_006231.3(POLE):c.3459+8C>T rs375852759
NM_006231.3(POLE):c.3459+9G>A rs745555988
NM_006231.3(POLE):c.3459G>A (p.Gln1153=) rs1060500818
NM_006231.3(POLE):c.3460-7C>T rs1555225168
NM_006231.3(POLE):c.3462A>G (p.Val1154=) rs756940534
NM_006231.3(POLE):c.3462A>T (p.Val1154=) rs756940534
NM_006231.3(POLE):c.3465G>T (p.Lys1155Asn) rs1449239461
NM_006231.3(POLE):c.3469C>G (p.Pro1157Ala)
NM_006231.3(POLE):c.346G>A (p.Val116Ile)
NM_006231.3(POLE):c.3478C>T (p.Arg1160Cys)
NM_006231.3(POLE):c.347T>C (p.Val116Ala) rs771744496
NM_006231.3(POLE):c.3481G>A (p.Val1161Ile) rs1555225160
NM_006231.3(POLE):c.3485A>G (p.Lys1162Arg) rs1565953154
NM_006231.3(POLE):c.3489C>T (p.His1163=) rs5744888
NM_006231.3(POLE):c.3492C>T (p.Pro1164=) rs754348616
NM_006231.3(POLE):c.3493G>A (p.Asp1165Asn) rs575738148
NM_006231.3(POLE):c.3497G>A (p.Trp1166Ter) rs1426673673
NM_006231.3(POLE):c.34G>A (p.Asp12Asn) rs1355767159
NM_006231.3(POLE):c.3500T>G (p.Leu1167Arg)
NM_006231.3(POLE):c.3501G>A (p.Leu1167=) rs1060504061
NM_006231.3(POLE):c.3501_3502insGGTCAAA (p.His1168fs) rs1060500814
NM_006231.3(POLE):c.3506A>G (p.Lys1169Arg) rs374456899
NM_006231.3(POLE):c.3510A>G (p.Lys1170=) rs1555225146
NM_006231.3(POLE):c.3510dup (p.Leu1171fs) rs1555225149
NM_006231.3(POLE):c.3518A>G (p.Glu1173Gly) rs762150108
NM_006231.3(POLE):c.351A>G (p.Ser117=) rs199773841
NM_006231.3(POLE):c.3527A>G (p.Asp1176Gly) rs1060500785
NM_006231.3(POLE):c.3534C>A (p.Tyr1178Ter) rs370133842
NM_006231.3(POLE):c.3534C>T (p.Tyr1178=) rs370133842
NM_006231.3(POLE):c.3539A>G (p.Gln1180Arg) rs1311314922
NM_006231.3(POLE):c.3545_3547delAGA rs1555225139
NM_006231.3(POLE):c.3546G>A (p.Lys1182=) rs1393231299
NM_006231.3(POLE):c.355T>A (p.Phe119Ile) rs879254235
NM_006231.3(POLE):c.355T>C (p.Phe119Leu) rs879254235
NM_006231.3(POLE):c.3563C>A (p.Thr1188Asn) rs1565952926
NM_006231.3(POLE):c.3572G>T (p.Gly1191Val) rs1429556469
NM_006231.3(POLE):c.3582+12G>A rs1252638342
NM_006231.3(POLE):c.3582+16C>T rs374051195
NM_006231.3(POLE):c.3582+16_3582+17inv rs1064794717
NM_006231.3(POLE):c.3582+17A>G rs5744889
NM_006231.3(POLE):c.3582+20G>T rs746745345
NM_006231.3(POLE):c.3582+5C>T rs775661457
NM_006231.3(POLE):c.3582+6G>A rs113307290
NM_006231.3(POLE):c.3582+7G>A rs558837073
NM_006231.3(POLE):c.3582+9G>A rs1057524057
NM_006231.3(POLE):c.3583-10dupG rs766426579
NM_006231.3(POLE):c.3583-164T>C
NM_006231.3(POLE):c.3583-3C>T rs371139965
NM_006231.3(POLE):c.3583-4C>G rs977709348
NM_006231.3(POLE):c.3587C>T (p.Thr1196Met) rs866237249
NM_006231.3(POLE):c.3588G>A (p.Thr1196=) rs771747587
NM_006231.3(POLE):c.358C>G (p.Leu120Val) rs888631588
NM_006231.3(POLE):c.3590delinsGGTCTGA (p.Met1197delinsArgSerGlu) rs1555224131
NM_006231.3(POLE):c.3593C>A (p.Ala1198Asp) rs1024652254
NM_006231.3(POLE):c.3594C>T (p.Ala1198=) rs200803943
NM_006231.3(POLE):c.3595G>A (p.Glu1199Lys) rs1012418859
NM_006231.3(POLE):c.3598G>A (p.Ala1200Thr) rs1555224126
NM_006231.3(POLE):c.3604G>A (p.Glu1202Lys) rs1565946881
NM_006231.3(POLE):c.3605A>G (p.Glu1202Gly)
NM_006231.3(POLE):c.3611G>A (p.Ser1204Asn) rs1555224124
NM_006231.3(POLE):c.3612T>G (p.Ser1204Arg)
NM_006231.3(POLE):c.3612dup (p.Pro1205fs) rs1555224123
NM_006231.3(POLE):c.3614C>A (p.Pro1205Gln) rs772686048
NM_006231.3(POLE):c.3614C>T (p.Pro1205Leu) rs772686048
NM_006231.3(POLE):c.3615G>A (p.Pro1205=) rs560825851
NM_006231.3(POLE):c.3617G>T (p.Arg1206Met) rs1060500839
NM_006231.3(POLE):c.3618G>A (p.Arg1206=) rs888690702
NM_006231.3(POLE):c.3619C>T (p.Pro1207Ser) rs878854861
NM_006231.3(POLE):c.3620C>T (p.Pro1207Leu) rs144086049
NM_006231.3(POLE):c.3622A>C (p.Ser1208Arg) rs1207616449
NM_006231.3(POLE):c.3623G>A (p.Ser1208Asn) rs781094608
NM_006231.3(POLE):c.3626C>T (p.Ala1209Val)
NM_006231.3(POLE):c.3629C>T (p.Pro1210Leu)
NM_006231.3(POLE):c.3629dup (p.Pro1210_Asp1211insTer) rs1555224111
NM_006231.3(POLE):c.3632A>C (p.Asp1211Ala) rs1555224110
NM_006231.3(POLE):c.3634A>G (p.Met1212Val) rs1565946789
NM_006231.3(POLE):c.3635T>C (p.Met1212Thr) rs1565946781
NM_006231.3(POLE):c.363C>T (p.Ser121=) rs1555230177
NM_006231.3(POLE):c.3645C>T (p.Phe1215=) rs758716323
NM_006231.3(POLE):c.3646G>A (p.Gly1216Ser) rs200114024
NM_006231.3(POLE):c.3651C>G (p.Leu1217=) rs765445494
NM_006231.3(POLE):c.3651C>T (p.Leu1217=) rs765445494
NM_006231.3(POLE):c.3652G>A (p.Val1218Ile) rs756246229
NM_006231.3(POLE):c.3664C>T (p.His1222Tyr) rs1555224105
NM_006231.3(POLE):c.3668C>G (p.Pro1223Arg)
NM_006231.3(POLE):c.3669A>C (p.Pro1223=) rs1433054330
NM_006231.3(POLE):c.3670G>T (p.Ala1224Ser) rs369338222
NM_006231.3(POLE):c.3670_3671delinsTT (p.Ala1224Leu) rs864622698
NM_006231.3(POLE):c.3671C>T (p.Ala1224Val) rs375208564
NM_006231.3(POLE):c.3672_3674dupAGC rs750939989
NM_006231.3(POLE):c.3677C>T (p.Pro1226Leu) rs1390451656
NM_006231.3(POLE):c.3677_3678del (p.Pro1226fs) rs765645032
NM_006231.3(POLE):c.3685G>A (p.Val1229Met) rs1565946654
NM_006231.3(POLE):c.3692G>A (p.Arg1231Lys) rs1271903915
NM_006231.3(POLE):c.3694A>G (p.Lys1232Glu) rs748763589
NM_006231.3(POLE):c.3695A>C (p.Lys1232Thr) rs774999422
NM_006231.3(POLE):c.3695A>G (p.Lys1232Arg) rs774999422
NM_006231.3(POLE):c.3696G>A (p.Lys1232=) rs546733374
NM_006231.3(POLE):c.3696G>T (p.Lys1232Asn)
NM_006231.3(POLE):c.3697C>A (p.Arg1233=) rs745750549
NM_006231.3(POLE):c.3698G>A (p.Arg1233Gln) rs201738371
NM_006231.3(POLE):c.369G>A (p.Lys123=) rs1328407908
NM_006231.3(POLE):c.3713G>A (p.Ser1238Asn) rs879255392
NM_006231.3(POLE):c.3715C>G (p.Gln1239Glu) rs1565946576
NM_006231.3(POLE):c.3716A>G (p.Gln1239Arg) rs146210785
NM_006231.3(POLE):c.3718G>A (p.Glu1240Lys) rs113594027
NM_006231.3(POLE):c.3720G>T (p.Glu1240Asp) rs1565946565
NM_006231.3(POLE):c.3721G>T (p.Glu1241Ter) rs779261309
NM_006231.3(POLE):c.3721_3722inv (p.Glu1241Ser)
NM_006231.3(POLE):c.3722A>C (p.Glu1241Ala)
NM_006231.3(POLE):c.3725C>G (p.Ser1242Cys) rs373213156
NM_006231.3(POLE):c.3725C>T (p.Ser1242Phe) rs373213156
NM_006231.3(POLE):c.3727C>T (p.Gln1243Ter) rs949436167
NM_006231.3(POLE):c.3733C>T (p.Leu1245Phe) rs1431438300
NM_006231.3(POLE):c.3737C>G (p.Thr1246Arg) rs750902578
NM_006231.3(POLE):c.3737C>T (p.Thr1246Met) rs750902578
NM_006231.3(POLE):c.3738G>A (p.Thr1246=) rs545161424
NM_006231.3(POLE):c.3740C>T (p.Pro1247Leu) rs572986717
NM_006231.3(POLE):c.3741G>A (p.Pro1247=) rs368978839
NM_006231.3(POLE):c.3745G>A (p.Val1249Met) rs762626359
NM_006231.3(POLE):c.3747G>A (p.Val1249=) rs80290414
NM_006231.3(POLE):c.3756G>A (p.Gln1252=) rs1555224057
NM_006231.3(POLE):c.3757G>C (p.Glu1253Gln)
NM_006231.3(POLE):c.3758A>G (p.Glu1253Gly) rs1483605737
NM_006231.3(POLE):c.3763T>C (p.Leu1255=) rs745838504
NM_006231.3(POLE):c.3768G>A (p.Gly1256=) rs776702809
NM_006231.3(POLE):c.3777C>A (p.Pro1259=) rs770904877
NM_006231.3(POLE):c.3777C>T (p.Pro1259=) rs770904877
NM_006231.3(POLE):c.3778G>A (p.Ala1260Thr) rs143858927
NM_006231.3(POLE):c.3787A>G (p.Thr1263Ala) rs1025864203
NM_006231.3(POLE):c.3788C>T (p.Thr1263Ile) rs1555224039
NM_006231.3(POLE):c.378C>A (p.Gly126=) rs374163231
NM_006231.3(POLE):c.3794A>T (p.Gln1265Leu) rs1555224038
NM_006231.3(POLE):c.3795+15T>G rs375745403
NM_006231.3(POLE):c.3795+5G>A
NM_006231.3(POLE):c.3795+8_3795+13delinsTGGTGATA
NM_006231.3(POLE):c.3796-11A>G rs1555223983
NM_006231.3(POLE):c.3796-20G>A rs1057522550
NM_006231.3(POLE):c.3796-58A>G
NM_006231.3(POLE):c.3796-5C>T rs908934016
NM_006231.3(POLE):c.3796G>A (p.Glu1266Lys)
NM_006231.3(POLE):c.3801A>G (p.Glu1267=) rs369436095
NM_006231.3(POLE):c.3808G>A (p.Val1270Ile) rs199574832
NM_006231.3(POLE):c.3812G>C (p.Trp1271Ser)
NM_006231.3(POLE):c.3813G>A (p.Trp1271Ter) rs1274554341
NM_006231.3(POLE):c.3817C>T (p.Arg1273Trp) rs758784435
NM_006231.3(POLE):c.3818G>A (p.Arg1273Gln)
NM_006231.3(POLE):c.3818G>T (p.Arg1273Leu) rs377324348
NM_006231.3(POLE):c.3833A>G (p.Lys1278Arg)
NM_006231.3(POLE):c.3834G>A (p.Lys1278=) rs878854862
NM_006231.3(POLE):c.3850C>T (p.Arg1284Trp) rs753426630
NM_006231.3(POLE):c.3851G>A (p.Arg1284Gln) rs149462407
NM_006231.3(POLE):c.3856C>T (p.Arg1286Cys) rs373170535
NM_006231.3(POLE):c.3857G>A (p.Arg1286His) rs771823596
NM_006231.3(POLE):c.3857G>T (p.Arg1286Leu)
NM_006231.3(POLE):c.3858C>T (p.Arg1286=) rs878854863
NM_006231.3(POLE):c.3858_3881del (p.Ala1288_Leu1295del) rs759449495
NM_006231.3(POLE):c.3861C>T (p.Leu1287=) rs761684406
NM_006231.3(POLE):c.3862G>A (p.Ala1288Thr) rs200398117
NM_006231.3(POLE):c.3863C>T (p.Ala1288Val) rs1467975024
NM_006231.3(POLE):c.3865C>A (p.Arg1289Ser) rs770036124
NM_006231.3(POLE):c.3865C>T (p.Arg1289Cys) rs770036124
NM_006231.3(POLE):c.3866G>A (p.Arg1289His) rs781298285
NM_006231.3(POLE):c.3867C>T (p.Arg1289=)
NM_006231.3(POLE):c.3870G>C (p.Arg1290Ser) rs1206673155
NM_006231.3(POLE):c.3872A>G (p.Lys1291Arg) rs878854864
NM_006231.3(POLE):c.3879G>A (p.Gln1293=) rs1555223957
NM_006231.3(POLE):c.3880C>T (p.Arg1294Cys) rs770966534
NM_006231.3(POLE):c.3881G>A (p.Arg1294His) rs115455318
NM_006231.3(POLE):c.3881G>T (p.Arg1294Leu) rs115455318
NM_006231.3(POLE):c.3883C>A (p.Leu1295Met) rs1184724406
NM_006231.3(POLE):c.3885G>A (p.Leu1295=) rs758772641
NM_006231.3(POLE):c.3890C>T (p.Ser1297Leu) rs746585658
NM_006231.3(POLE):c.3891G>A (p.Ser1297=) rs375466233
NM_006231.3(POLE):c.3891G>T (p.Ser1297=) rs375466233
NM_006231.3(POLE):c.3892G>A (p.Ala1298Thr)
NM_006231.3(POLE):c.38C>T (p.Pro13Leu) rs878854865
NM_006231.3(POLE):c.3904C>T (p.Leu1302Phe) rs1555223949
NM_006231.3(POLE):c.3905T>C (p.Leu1302Pro) rs766058852
NM_006231.3(POLE):c.3906C>T (p.Leu1302=) rs760222689
NM_006231.3(POLE):c.3912C>T (p.Pro1304=) rs116482376
NM_006231.3(POLE):c.3913G>A (p.Gly1305Arg) rs563990655
NM_006231.3(POLE):c.3914G>A (p.Gly1305Glu) rs761617609
NM_006231.3(POLE):c.3914G>C (p.Gly1305Ala) rs761617609
NM_006231.3(POLE):c.3916G>A (p.Ala1306Thr) rs774219559
NM_006231.3(POLE):c.3919A>G (p.Ile1307Val) rs1000912264
NM_006231.3(POLE):c.391G>T (p.Val131Leu) rs745601745
NM_006231.3(POLE):c.3921C>A (p.Ile1307=) rs1555223944
NM_006231.3(POLE):c.3922C>T (p.Arg1308Trp) rs763854815
NM_006231.3(POLE):c.3923G>A (p.Arg1308Gln) rs759793243
NM_006231.3(POLE):c.3925G>A (p.Asp1309Asn) rs1555223943
NM_006231.3(POLE):c.3925G>T (p.Asp1309Tyr) rs1555223943
NM_006231.3(POLE):c.3926A>G (p.Asp1309Gly) rs776828609
NM_006231.3(POLE):c.3932C>T (p.Pro1311Leu) rs1042198717
NM_006231.3(POLE):c.3933T>C (p.Pro1311=) rs533545710
NM_006231.3(POLE):c.3934G>A (p.Ala1312Thr) rs1565945759
NM_006231.3(POLE):c.3937A>G (p.Thr1313Ala) rs878854866
NM_006231.3(POLE):c.3938C>T (p.Thr1313Met)
NM_006231.3(POLE):c.3939G>A (p.Thr1313=) rs150282789
NM_006231.3(POLE):c.3942G>T (p.Gly1314=) rs1177628476
NM_006231.3(POLE):c.3942del (p.Leu1315fs) rs1555223939
NM_006231.3(POLE):c.3946G>A (p.Gly1316Arg)
NM_006231.3(POLE):c.3949A>G (p.Ser1317Gly)
NM_006231.3(POLE):c.3958C>T (p.Arg1320Ter) rs754411056
NM_006231.3(POLE):c.3959G>A (p.Arg1320Gln) rs772663586
NM_006231.3(POLE):c.3968C>T (p.Ala1323Val)
NM_006231.3(POLE):c.3970C>T (p.Arg1324Cys) rs779464847
NM_006231.3(POLE):c.3971G>A (p.Arg1324His) rs143981093
NM_006231.3(POLE):c.3971G>T (p.Arg1324Leu) rs143981093
NM_006231.3(POLE):c.3975C>T (p.Ser1325=) rs749011369
NM_006231.3(POLE):c.3976A>G (p.Ile1326Val) rs557996561
NM_006231.3(POLE):c.3978C>T (p.Ile1326=) rs755659438
NM_006231.3(POLE):c.3987T>C (p.Leu1329=) rs1555223929
NM_006231.3(POLE):c.3989C>T (p.Pro1330Leu) rs1409584745
NM_006231.3(POLE):c.3990G>A (p.Pro1330=)
NM_006231.3(POLE):c.3990G>T (p.Pro1330=) rs777546371
NM_006231.3(POLE):c.3997A>G (p.Ile1333Val) rs751467689
NM_006231.3(POLE):c.3999T>A (p.Ile1333=) rs929039052
NM_006231.3(POLE):c.3999T>C (p.Ile1333=) rs929039052
NM_006231.3(POLE):c.399T>C (p.Thr133=) rs202102690
NM_006231.3(POLE):c.39A>G (p.Pro13=) rs1555231415
NM_006231.3(POLE):c.3G>A (p.Met1Ile) rs1555231433
NM_006231.3(POLE):c.4005+20G>A rs775205537
NM_006231.3(POLE):c.4005+7A>G rs372329585
NM_006231.3(POLE):c.4005+8C>A rs762723589
NM_006231.3(POLE):c.4005+9C>A rs368874247
NM_006231.3(POLE):c.4006-15C>T rs751257970
NM_006231.3(POLE):c.4006-1G>T rs1057519256
NM_006231.3(POLE):c.4006-20A>G rs1057523958
NM_006231.3(POLE):c.4006-2A>T
NM_006231.3(POLE):c.4006-3C>A
NM_006231.3(POLE):c.4006-3C>T
NM_006231.3(POLE):c.4006-8C>A rs745486661
NM_006231.3(POLE):c.4011C>T (p.Ser1337=) rs756716850
NM_006231.3(POLE):c.4012G>A (p.Glu1338Lys) rs751555395
NM_006231.3(POLE):c.4015A>G (p.Thr1339Ala) rs1555223881
NM_006231.3(POLE):c.4018A>G (p.Ser1340Gly)
NM_006231.3(POLE):c.4020C>T (p.Ser1340=) rs961050579
NM_006231.3(POLE):c.4024G>A (p.Ala1342Thr) rs1301501264
NM_006231.3(POLE):c.4026C>T (p.Ala1342=) rs764030317
NM_006231.3(POLE):c.4027G>A (p.Gly1343Ser) rs556821288
NM_006231.3(POLE):c.4031T>C (p.Leu1344Pro) rs368111350
NM_006231.3(POLE):c.403C>T (p.Pro135Ser) rs1060500817
NM_006231.3(POLE):c.4045G>C (p.Ala1349Pro) rs1555223876
NM_006231.3(POLE):c.4046C>T (p.Ala1349Val) rs536988344
NM_006231.3(POLE):c.4047G>A (p.Ala1349=) rs201746181
NM_006231.3(POLE):c.404C>A (p.Pro135His) rs1565980234
NM_006231.3(POLE):c.4050C>T (p.Leu1350=) rs764888601
NM_006231.3(POLE):c.4051G>A (p.Val1351Ile) rs138443282
NM_006231.3(POLE):c.4055G>C (p.Gly1352Ala) rs147088333
NM_006231.3(POLE):c.4057A>G (p.Ser1353Gly) rs141619382
NM_006231.3(POLE):c.4059T>G (p.Ser1353Arg) rs1555223871
NM_006231.3(POLE):c.405C>T (p.Pro135=) rs1057521357
NM_006231.3(POLE):c.4062C>A (p.Asp1354Glu) rs762002242
NM_006231.3(POLE):c.4069T>C (p.Cys1357Arg) rs1565945381
NM_006231.3(POLE):c.4077G>T (p.Arg1359Ser) rs1064796047
NM_006231.3(POLE):c.4079T>C (p.Leu1360Pro) rs1565945357
NM_006231.3(POLE):c.407A>G (p.Lys136Arg) rs752771738
NM_006231.3(POLE):c.4080G>C (p.Leu1360=) rs1555223858
NM_006231.3(POLE):c.4088C>T (p.Pro1363Leu) rs1399456425
NM_006231.3(POLE):c.4090C>T (p.Arg1364Cys) rs770024304
NM_006231.3(POLE):c.4091G>A (p.Arg1364His) rs369171111
NM_006231.3(POLE):c.4100A>G (p.Tyr1367Cys) rs1365073969
NM_006231.3(POLE):c.4101C>T (p.Tyr1367=) rs780694561
NM_006231.3(POLE):c.4102G>A (p.Val1368Met) rs770558983
NM_006231.3(POLE):c.4106A>G (p.Asn1369Ser) rs746524982
NM_006231.3(POLE):c.4111C>T (p.Arg1371Ter) rs151278283
NM_006231.3(POLE):c.4112G>A (p.Arg1371Gln) rs535074635
NM_006231.3(POLE):c.4114G>A (p.Val1372Ile)
NM_006231.3(POLE):c.4116C>T (p.Val1372=) rs1171373480
NM_006231.3(POLE):c.4122A>T (p.Lys1374Asn) rs878854867
NM_006231.3(POLE):c.4123G>A (p.Ala1375Thr) rs1390398091
NM_006231.3(POLE):c.4123G>T (p.Ala1375Ser) rs1390398091
NM_006231.3(POLE):c.4124C>T (p.Ala1375Val) rs766168647
NM_006231.3(POLE):c.4125G>A (p.Ala1375=) rs374210113
NM_006231.3(POLE):c.4125G>T (p.Ala1375=) rs374210113
NM_006231.3(POLE):c.412G>C (p.Asp138His)
NM_006231.3(POLE):c.4133G>T (p.Gly1378Val)
NM_006231.3(POLE):c.4135G>A (p.Ala1379Thr) rs1565945249
NM_006231.3(POLE):c.4137T>C (p.Ala1379=) rs1555223836
NM_006231.3(POLE):c.4139C>T (p.Ser1380Leu) rs762090058
NM_006231.3(POLE):c.4140G>A (p.Ser1380=) rs199851128
NM_006231.3(POLE):c.4142A>G (p.Tyr1381Cys)
NM_006231.3(POLE):c.4144C>G (p.Arg1382Gly) rs5744904
NM_006231.3(POLE):c.4144C>T (p.Arg1382Cys) rs5744904
NM_006231.3(POLE):c.4145G>A (p.Arg1382His) rs143229302
NM_006231.3(POLE):c.4149+12C>G rs566422403
NM_006231.3(POLE):c.4149+1524C>T rs869312624
NM_006231.3(POLE):c.4149+152C>T
NM_006231.3(POLE):c.4149+2T>C rs1064796760
NM_006231.3(POLE):c.4149+3A>C rs1358505756
NM_006231.3(POLE):c.4149+3A>G rs1358505756
NM_006231.3(POLE):c.4149+4G>A
NM_006231.3(POLE):c.4149+9G>A rs1478720555
NM_006231.3(POLE):c.414T>G (p.Asp138Glu)
NM_006231.3(POLE):c.4150-107C>T
NM_006231.3(POLE):c.4150-12T>C rs551697046
NM_006231.3(POLE):c.4150-13G>A rs780409701
NM_006231.3(POLE):c.4150-1411C>A rs869312622
NM_006231.3(POLE):c.4150-16G>T rs375774291
NM_006231.3(POLE):c.4150-17C>T rs758539843
NM_006231.3(POLE):c.4150-1G>C rs1372928198
NM_006231.3(POLE):c.4150-5G>A rs771624962
NM_006231.3(POLE):c.4150-6C>T rs756837862
NM_006231.3(POLE):c.4150-8C>A rs760355462
NM_006231.3(POLE):c.4150-8C>G
NM_006231.3(POLE):c.4150-90dup
NM_006231.3(POLE):c.4156C>T (p.Arg1386Trp)
NM_006231.3(POLE):c.4157G>A (p.Arg1386Gln) rs969355093
NM_006231.3(POLE):c.4157G>C (p.Arg1386Pro) rs969355093
NM_006231.3(POLE):c.4158G>A (p.Arg1386=) rs1473134331
NM_006231.3(POLE):c.4164T>C (p.Leu1388=) rs1555223120
NM_006231.3(POLE):c.4168C>T (p.Arg1390Cys) rs768504121
NM_006231.3(POLE):c.4169G>A (p.Arg1390His) rs200776293
NM_006231.3(POLE):c.4172C>G (p.Ser1391Cys) rs149145495
NM_006231.3(POLE):c.4177A>G (p.Met1393Val)
NM_006231.3(POLE):c.4179G>T (p.Met1393Ile) rs778153462
NM_006231.3(POLE):c.4183T>C (p.Tyr1395His)
NM_006231.3(POLE):c.4184A>G (p.Tyr1395Cys) rs5744933
NM_006231.3(POLE):c.4185C>T (p.Tyr1395=) rs1221858843
NM_006231.3(POLE):c.4187A>G (p.Asn1396Ser) rs5744934
NM_006231.3(POLE):c.4188_4195delinsA (p.Asn1396fs) rs1555223097
NM_006231.3(POLE):c.4193A>G (p.Tyr1398Cys) rs878854868
NM_006231.3(POLE):c.4193_4194del (p.Leu1397_Tyr1398insTer) rs1323151304
NM_006231.3(POLE):c.4195G>A (p.Glu1399Lys)
NM_006231.3(POLE):c.4195G>C (p.Glu1399Gln) rs5744935
NM_006231.3(POLE):c.4198T>C (p.Tyr1400His) rs761011442
NM_006231.3(POLE):c.4199A>G (p.Tyr1400Cys) rs370971579
NM_006231.3(POLE):c.4206G>A (p.Val1402=) rs773786700
NM_006231.3(POLE):c.4209A>G (p.Pro1403=) rs768182675
NM_006231.3(POLE):c.4213G>A (p.Asp1405Asn)
NM_006231.3(POLE):c.4216A>G (p.Met1406Val) rs1452685600
NM_006231.3(POLE):c.4217T>C (p.Met1406Thr) rs749250454
NM_006231.3(POLE):c.4218G>A (p.Met1406Ile) rs1060500841
NM_006231.3(POLE):c.4220A>G (p.Tyr1407Cys) rs775556994
NM_006231.3(POLE):c.4220A>T (p.Tyr1407Phe) rs775556994
NM_006231.3(POLE):c.4221C>T (p.Tyr1407=) rs1486192402
NM_006231.3(POLE):c.4225G>A (p.Glu1409Lys) rs1060500845
NM_006231.3(POLE):c.4229A>C (p.His1410Pro) rs1313711311
NM_006231.3(POLE):c.423+20T>C rs201628896
NM_006231.3(POLE):c.423+70G>A rs779530987
NM_006231.3(POLE):c.4231A>G (p.Ile1411Val) rs1233033042
NM_006231.3(POLE):c.4231_4232del (p.Ile1411fs)
NM_006231.3(POLE):c.4233C>G (p.Ile1411Met) rs1555223081
NM_006231.3(POLE):c.4236C>T (p.Asn1412=) rs377245595
NM_006231.3(POLE):c.4237G>A (p.Glu1413Lys) rs372901803
NM_006231.3(POLE):c.424-10C>T rs748433747
NM_006231.3(POLE):c.424-1G>A rs1555230115
NM_006231.3(POLE):c.424-20G>A rs781020097
NM_006231.3(POLE):c.424-2A>G rs1555230117
NM_006231.3(POLE):c.424-3T>C rs1555230120
NM_006231.3(POLE):c.424-9G>A rs1060504074
NM_006231.3(POLE):c.4244A>G (p.Asn1415Ser) rs748378612
NM_006231.3(POLE):c.4245C>T (p.Asn1415=) rs778896278
NM_006231.3(POLE):c.4246G>A (p.Ala1416Thr) rs146711942
NM_006231.3(POLE):c.4247C>T (p.Ala1416Val)
NM_006231.3(POLE):c.4248T>A (p.Ala1416=) rs754358557
NM_006231.3(POLE):c.4249G>C (p.Glu1417Gln)
NM_006231.3(POLE):c.4249_4251delinsCT (p.Glu1417fs) rs1555223073
NM_006231.3(POLE):c.4259C>T (p.Ala1420Val) rs41561818
NM_006231.3(POLE):c.4260G>A (p.Ala1420=) rs750810969
NM_006231.3(POLE):c.4267A>G (p.Ile1423Val) rs139498590
NM_006231.3(POLE):c.4269C>T (p.Ile1423=) rs761413102
NM_006231.3(POLE):c.4270G>A (p.Glu1424Lys) rs575419120
NM_006231.3(POLE):c.4276G>A (p.Val1426Ile) rs775072147
NM_006231.3(POLE):c.427A>C (p.Asn143His) rs889470853
NM_006231.3(POLE):c.427A>G (p.Asn143Asp)
NM_006231.3(POLE):c.4285A>T (p.Thr1429Ser) rs759497382
NM_006231.3(POLE):c.4287T>C (p.Thr1429=) rs1060504044
NM_006231.3(POLE):c.4289A>G (p.Gln1430Arg) rs1060500836
NM_006231.3(POLE):c.4290+102A>T
NM_006231.3(POLE):c.4290+1G>A rs1565940214
NM_006231.3(POLE):c.4290+1G>C rs1565940214
NM_006231.3(POLE):c.4290+20C>T rs768700204
NM_006231.3(POLE):c.4290+5C>T rs5744936
NM_006231.3(POLE):c.4291-11G>A rs369564167
NM_006231.3(POLE):c.4291-12C>G rs564807391
NM_006231.3(POLE):c.4291-12C>T rs564807391
NM_006231.3(POLE):c.4291-3delC rs1060500805
NM_006231.3(POLE):c.4291-7C>A rs1060504076
NM_006231.3(POLE):c.4291G>C (p.Val1431Leu)
NM_006231.3(POLE):c.4295C>A (p.Pro1432Gln) rs371712284
NM_006231.3(POLE):c.4295C>T (p.Pro1432Leu)
NM_006231.3(POLE):c.4296G>A (p.Pro1432=) rs777949353
NM_006231.3(POLE):c.4296G>T (p.Pro1432=) rs777949353
NM_006231.3(POLE):c.42C>A (p.Gly14=) rs934764678
NM_006231.3(POLE):c.42C>T (p.Gly14=)
NM_006231.3(POLE):c.4306C>G (p.Arg1436Gly)
NM_006231.3(POLE):c.4306C>T (p.Arg1436Trp) rs764904030
NM_006231.3(POLE):c.4307G>A (p.Arg1436Gln) rs754518522
NM_006231.3(POLE):c.4307G>C (p.Arg1436Pro)
NM_006231.3(POLE):c.4308G>C (p.Arg1436=) rs367898059
NM_006231.3(POLE):c.4311C>T (p.Ala1437=) rs1555223017
NM_006231.3(POLE):c.4318C>T (p.His1440Tyr) rs373785842
NM_006231.3(POLE):c.4319A>G (p.His1440Arg) rs1555223013
NM_006231.3(POLE):c.431A>G (p.His144Arg) rs755709875
NM_006231.3(POLE):c.4327_4328TG[5] (p.Val1446fs) rs758487568
NM_006231.3(POLE):c.4329T>G (p.Cys1443Trp) rs1565939772
NM_006231.3(POLE):c.4331T>C (p.Val1444Ala) rs767189495
NM_006231.3(POLE):c.4336G>C (p.Val1446Leu) rs878854869
NM_006231.3(POLE):c.4339G>A (p.Val1447Ile) rs1565939714
NM_006231.3(POLE):c.4341C>T (p.Val1447=) rs878854870
NM_006231.3(POLE):c.4343A>G (p.Asn1448Ser) rs150545516
NM_006231.3(POLE):c.434T>C (p.Leu145Ser)
NM_006231.3(POLE):c.4352T>G (p.Leu1451Arg)
NM_006231.3(POLE):c.4353G>A (p.Leu1451=) rs769149466
NM_006231.3(POLE):c.4353G>C (p.Leu1451=) rs769149466
NM_006231.3(POLE):c.4354G>A (p.Val1452Met)
NM_006231.3(POLE):c.4356G>A (p.Val1452=) rs1060504066
NM_006231.3(POLE):c.4357A>C (p.Arg1453=) rs1057524305
NM_006231.3(POLE):c.4357A>T (p.Arg1453Trp) rs1057524305
NM_006231.3(POLE):c.4360C>T (p.His1454Tyr) rs1060500842
NM_006231.3(POLE):c.4362C>T (p.His1454=) rs115568973
NM_006231.3(POLE):c.4370G>T (p.Gly1457Val) rs776534749
NM_006231.3(POLE):c.4371C>T (p.Gly1457=) rs771489059
NM_006231.3(POLE):c.4380A>G (p.Ala1460=) rs758830037
NM_006231.3(POLE):c.4385C>T (p.Thr1462Ile)
NM_006231.3(POLE):c.4386C>T (p.Thr1462=) rs1555222988
NM_006231.3(POLE):c.4388T>G (p.Phe1463Cys) rs1565939600
NM_006231.3(POLE):c.4390G>C (p.Ala1464Pro) rs778717624
NM_006231.3(POLE):c.4396G>A (p.Glu1466Lys) rs1258004616
NM_006231.3(POLE):c.4396G>C (p.Glu1466Gln) rs1258004616
NM_006231.3(POLE):c.4399C>A (p.His1467Asn)
NM_006231.3(POLE):c.43G>A (p.Ala15Thr) rs1060500788
NM_006231.3(POLE):c.43G>C (p.Ala15Pro)
NM_006231.3(POLE):c.4403T>G (p.Leu1468Arg) rs1555222979
NM_006231.3(POLE):c.4404G>A (p.Leu1468=) rs1565939532
NM_006231.3(POLE):c.4411C>G (p.Arg1471Gly)
NM_006231.3(POLE):c.4411C>T (p.Arg1471Cys) rs528264567
NM_006231.3(POLE):c.4419G>C (p.Leu1473=) rs1555222975
NM_006231.3(POLE):c.4420del (p.Ala1474fs) rs1555222974
NM_006231.3(POLE):c.4427T>G (p.Phe1476Cys) rs985504177
NM_006231.3(POLE):c.4428C>T (p.Phe1476=) rs878854871
NM_006231.3(POLE):c.4433A>G (p.Tyr1478Cys) rs1162335715
NM_006231.3(POLE):c.4441C>T (p.Pro1481Ser)
NM_006231.3(POLE):c.4444+10G>T rs761312129
NM_006231.3(POLE):c.4444+18C>T rs780605858
NM_006231.3(POLE):c.4444+19G>A rs368659272
NM_006231.3(POLE):c.4444+3A>G rs398122515
NM_006231.3(POLE):c.4444+4T>A rs5744941
NM_006231.3(POLE):c.4444+9T>C rs1060504072
NM_006231.3(POLE):c.4444G>C (p.Gly1482Arg) rs759703428
NM_006231.3(POLE):c.4445-10C>T rs1057522514
NM_006231.3(POLE):c.4445-2A>C
NM_006231.3(POLE):c.4445-2A>G rs766538692
NM_006231.3(POLE):c.4445-33C>T
NM_006231.3(POLE):c.4445-3C>T rs1555222948
NM_006231.3(POLE):c.4445-7T>C rs754001064
NM_006231.3(POLE):c.4445G>A (p.Gly1482Glu) rs1555222946
NM_006231.3(POLE):c.4449T>C (p.Ser1483=) rs1057521430
NM_006231.3(POLE):c.444G>C (p.Leu148Phe) rs1060500797
NM_006231.3(POLE):c.4450A>C (p.Ile1484Leu) rs772734618
NM_006231.3(POLE):c.4450A>G (p.Ile1484Val) rs772734618
NM_006231.3(POLE):c.4453C>T (p.Arg1485Cys) rs969429633
NM_006231.3(POLE):c.4454G>A (p.Arg1485His)
NM_006231.3(POLE):c.4455C>T (p.Arg1485=) rs750833365
NM_006231.3(POLE):c.4457A>T (p.His1486Leu) rs1555222928
NM_006231.3(POLE):c.4459A>C (p.Ile1487Leu) rs1555222924
NM_006231.3(POLE):c.4459A>G (p.Ile1487Val) rs1555222924
NM_006231.3(POLE):c.4461C>T (p.Ile1487=) rs536917758
NM_006231.3(POLE):c.4464C>T (p.Tyr1488=) rs1555222919
NM_006231.3(POLE):c.446A>G (p.Lys149Arg) rs374428362
NM_006231.3(POLE):c.4473C>T (p.His1491=) rs774898453
NM_006231.3(POLE):c.4476C>A (p.His1492Gln) rs5744943
NM_006231.3(POLE):c.4476C>G (p.His1492Gln)
NM_006231.3(POLE):c.4476C>T (p.His1492=) rs5744943
NM_006231.3(POLE):c.4477G>A (p.Ala1493Thr) rs748522633
NM_006231.3(POLE):c.4477G>T (p.Ala1493Ser)
NM_006231.3(POLE):c.4478_4479CA[1] (p.Gln1494fs)
NM_006231.3(POLE):c.4480C>G (p.Gln1494Glu) rs1443837551
NM_006231.3(POLE):c.4485C>G (p.Ala1495=) rs878854872
NM_006231.3(POLE):c.448C>T (p.Arg150Ter) rs775815329
NM_006231.3(POLE):c.4490A>G (p.Lys1497Arg) rs557957962
NM_006231.3(POLE):c.4493C>T (p.Ala1498Val) rs751465593
NM_006231.3(POLE):c.4494G>A (p.Ala1498=) rs777611171
NM_006231.3(POLE):c.4495C>T (p.Leu1499Phe) rs1555222907
NM_006231.3(POLE):c.449G>A (p.Arg150Gln) rs780775837
NM_006231.3(POLE):c.44C>T (p.Ala15Val) rs1565986587
NM_006231.3(POLE):c.4500C>G (p.Phe1500Leu) rs370543622
NM_006231.3(POLE):c.4500C>T (p.Phe1500=) rs370543622
NM_006231.3(POLE):c.4501G>A (p.Gly1501Arg) rs758114596
NM_006231.3(POLE):c.4510A>T (p.Ile1504Phe) rs1555222899
NM_006231.3(POLE):c.4513C>G (p.Pro1505Ala) rs878854873
NM_006231.3(POLE):c.4514C>T (p.Pro1505Leu) rs1060500822
NM_006231.3(POLE):c.4522C>G (p.Arg1508Gly) rs766511597
NM_006231.3(POLE):c.4522C>T (p.Arg1508Cys) rs766511597
NM_006231.3(POLE):c.4523G>A (p.Arg1508His) rs142508245
NM_006231.3(POLE):c.4525A>G (p.Arg1509Gly) rs1060500816
NM_006231.3(POLE):c.4527G>A (p.Arg1509=) rs767676720
NM_006231.3(POLE):c.4529_4530inv (p.Ala1510Val)
NM_006231.3(POLE):c.452A>G (p.Asn151Ser) rs969812647
NM_006231.3(POLE):c.4530A>G (p.Ala1510=) rs5744944
NM_006231.3(POLE):c.4532C>T (p.Ser1511Phe) rs1565939011
NM_006231.3(POLE):c.4533C>T (p.Ser1511=) rs1057523672
NM_006231.3(POLE):c.4534G>A (p.Val1512Ile) rs147354120
NM_006231.3(POLE):c.4541T>C (p.Val1514Ala) rs116742454
NM_006231.3(POLE):c.4542del (p.Leu1515fs) rs878854874
NM_006231.3(POLE):c.4544T>G (p.Leu1515Arg)
NM_006231.3(POLE):c.4547A>G (p.Asp1516Gly)
NM_006231.3(POLE):c.4551+10G>A rs1565938933
NM_006231.3(POLE):c.4551+11G>A rs769356284
NM_006231.3(POLE):c.4551+15C>T rs770422878
NM_006231.3(POLE):c.4551+18C>T rs747006780
NM_006231.3(POLE):c.4551+20T>C rs377147295
NM_006231.3(POLE):c.4551+2_4551+3delTG rs1251654299
NM_006231.3(POLE):c.4551+3G>A rs1565938943
NM_006231.3(POLE):c.4551+8C>T rs1555222872
NM_006231.3(POLE):c.4551T>G (p.Thr1517=) rs1033333357
NM_006231.3(POLE):c.4552-10G>A rs5744946
NM_006231.3(POLE):c.4552-10G>T rs5744946
NM_006231.3(POLE):c.4552-11C>G rs202176361
NM_006231.3(POLE):c.4552-11C>T rs202176361
NM_006231.3(POLE):c.4552-1dup
NM_006231.3(POLE):c.4552-4C>G rs913720556
NM_006231.3(POLE):c.4552-5T>A rs1064795991
NM_006231.3(POLE):c.4552-7G>T rs751714913
NM_006231.3(POLE):c.4552-9T>C rs1432965677
NM_006231.3(POLE):c.4552-9T>G
NM_006231.3(POLE):c.4554G>A (p.Val1518=) rs1555222799
NM_006231.3(POLE):c.4555C>T (p.Arg1519Cys) rs542430685
NM_006231.3(POLE):c.4556G>A (p.Arg1519His) rs376530977
NM_006231.3(POLE):c.4558A>G (p.Ser1520Gly) rs1021500357
NM_006231.3(POLE):c.4559G>A (p.Ser1520Asn)
NM_006231.3(POLE):c.4559G>T (p.Ser1520Ile)
NM_006231.3(POLE):c.4562A>G (p.Asn1521Ser) rs1565938621
NM_006231.3(POLE):c.4567A>G (p.Met1523Val) rs1209633210
NM_006231.3(POLE):c.4568T>C (p.Met1523Thr)
NM_006231.3(POLE):c.456C>T (p.Tyr152=)
NM_006231.3(POLE):c.4572C>T (p.Pro1524=) rs766050469
NM_006231.3(POLE):c.4574G>C (p.Ser1525Thr)
NM_006231.3(POLE):c.4581C>T (p.Gly1527=) rs772646117
NM_006231.3(POLE):c.4582G>A (p.Ala1528Thr) rs373468985
NM_006231.3(POLE):c.4582G>T (p.Ala1528Ser)
NM_006231.3(POLE):c.4583C>T (p.Ala1528Val) rs1292909825
NM_006231.3(POLE):c.4585C>T (p.Leu1529=) rs1060504041
NM_006231.3(POLE):c.4587G>A (p.Leu1529=) rs1565938547
NM_006231.3(POLE):c.4589A>G (p.Tyr1530Cys)
NM_006231.3(POLE):c.4592C>T (p.Ser1531Leu) rs1555222764
NM_006231.3(POLE):c.4593A>T (p.Ser1531=) rs878854875
NM_006231.3(POLE):c.4593_4611del (p.Ala1532fs)
NM_006231.3(POLE):c.4599G>C (p.Glu1533Asp)
NM_006231.3(POLE):c.459C>G (p.Ile153Met) rs371147799
NM_006231.3(POLE):c.45G>A (p.Ala15=) rs1314665962
NM_006231.3(POLE):c.4600C>T (p.His1534Tyr)
NM_006231.3(POLE):c.4602C>T (p.His1534=) rs749126952
NM_006231.3(POLE):c.4603G>A (p.Gly1535Ser) rs138564205
NM_006231.3(POLE):c.4607T>G (p.Leu1536Arg)
NM_006231.3(POLE):c.4608C>T (p.Leu1536=) rs1462826498
NM_006231.3(POLE):c.4609C>T (p.Leu1537Phe)
NM_006231.3(POLE):c.4610T>A (p.Leu1537His) rs1555222743
NM_006231.3(POLE):c.4611_4613delCCT rs1555222739
NM_006231.3(POLE):c.4615G>A (p.Glu1539Lys)
NM_006231.3(POLE):c.4616A>G (p.Glu1539Gly)
NM_006231.3(POLE):c.4617G>A (p.Glu1539=) rs1429494989
NM_006231.3(POLE):c.461G>A (p.Arg154Lys) rs769882912
NM_006231.3(POLE):c.462G>A (p.Arg154=) rs555774342
NM_006231.3(POLE):c.462G>C (p.Arg154Ser) rs555774342
NM_006231.3(POLE):c.462G>T (p.Arg154Ser)
NM_006231.3(POLE):c.4630G>C (p.Glu1544Gln) rs1555222735
NM_006231.3(POLE):c.4631dup (p.Leu1545fs) rs1555222731
NM_006231.3(POLE):c.4632G>A (p.Glu1544=) rs1555222727
NM_006231.3(POLE):c.4635C>T (p.Leu1545=) rs199945393
NM_006231.3(POLE):c.4637T>G (p.Leu1546Arg) rs1565938434
NM_006231.3(POLE):c.4642C>A (p.Pro1548Thr) rs1555222725
NM_006231.3(POLE):c.4642C>T (p.Pro1548Ser) rs1555222725
NM_006231.3(POLE):c.4643C>T (p.Pro1548Leu)
NM_006231.3(POLE):c.4644C>T (p.Pro1548=) rs1555222721
NM_006231.3(POLE):c.4645C>A (p.Pro1549Thr) rs147500308
NM_006231.3(POLE):c.4645C>G (p.Pro1549Ala) rs147500308
NM_006231.3(POLE):c.4645C>T (p.Pro1549Ser) rs147500308
NM_006231.3(POLE):c.4646C>G (p.Pro1549Arg) rs577952179
NM_006231.3(POLE):c.4646C>T (p.Pro1549Leu) rs577952179
NM_006231.3(POLE):c.4647C>G (p.Pro1549=) rs1004972253
NM_006231.3(POLE):c.4647C>T (p.Pro1549=) rs1004972253
NM_006231.3(POLE):c.4647dup (p.Lys1550fs) rs754220952
NM_006231.3(POLE):c.4649A>G (p.Lys1550Arg) rs5744947
NM_006231.3(POLE):c.4651C>T (p.His1551Tyr)
NM_006231.3(POLE):c.4654_4655delAC rs1555222708
NM_006231.3(POLE):c.4656C>T (p.Thr1552=) rs1318993810
NM_006231.3(POLE):c.4657T>C (p.Phe1553Leu) rs1565938308
NM_006231.3(POLE):c.4659C>T (p.Phe1553=) rs767021717
NM_006231.3(POLE):c.465G>A (p.Leu155=) rs1340414570
NM_006231.3(POLE):c.4660G>A (p.Glu1554Lys) rs143247306
NM_006231.3(POLE):c.4663G>A (p.Val1555Ile) rs1060500799
NM_006231.3(POLE):c.4666C>G (p.Arg1556Gly)
NM_006231.3(POLE):c.4666C>T (p.Arg1556Trp) rs768741587
NM_006231.3(POLE):c.4667G>A (p.Arg1556Gln) rs762965148
NM_006231.3(POLE):c.4668G>T (p.Arg1556=) rs1555222702
NM_006231.3(POLE):c.4677T>G (p.Thr1559=) rs1329248039
NM_006231.3(POLE):c.467C>G (p.Ser156Cys) rs1565979877
NM_006231.3(POLE):c.4680C>G (p.Asp1560Glu) rs774425403
NM_006231.3(POLE):c.4680C>T (p.Asp1560=) rs774425403
NM_006231.3(POLE):c.4689C>T (p.Thr1563=) rs1057522743
NM_006231.3(POLE):c.4689del (p.Ile1564fs) rs1555222696
NM_006231.3(POLE):c.4689dup (p.Ile1564fs) rs1555222696
NM_006231.3(POLE):c.4691T>C (p.Ile1564Thr) rs1555222691
NM_006231.3(POLE):c.4692C>T (p.Ile1564=) rs748286441
NM_006231.3(POLE):c.4696A>G (p.Arg1566Gly) rs1365206650
NM_006231.3(POLE):c.46G>A (p.Asp16Asn) rs1241114520
NM_006231.3(POLE):c.46G>C (p.Asp16His) rs1241114520
NM_006231.3(POLE):c.4701C>T (p.Ala1567=) rs1060504060
NM_006231.3(POLE):c.4708C>A (p.Arg1570=) rs1037592848
NM_006231.3(POLE):c.4708C>T (p.Arg1570Ter) rs1037592848
NM_006231.3(POLE):c.4709G>A (p.Arg1570Gln)
NM_006231.3(POLE):c.4716G>A (p.Leu1572=) rs138782478
NM_006231.3(POLE):c.4716G>C (p.Leu1572=) rs138782478
NM_006231.3(POLE):c.4719C>T (p.Leu1573=) rs115219846
NM_006231.3(POLE):c.4720G>A (p.Ala1574Thr) rs878854876
NM_006231.3(POLE):c.4724A>G (p.Tyr1575Cys)
NM_006231.3(POLE):c.4728+10G>A rs1237098723
NM_006231.3(POLE):c.4728+14_4728+21del rs1311664292
NM_006231.3(POLE):c.4728G>A (p.Lys1576=) rs1555222662
NM_006231.3(POLE):c.4729-11C>T rs1555222633
NM_006231.3(POLE):c.4729-12G>A rs765204902
NM_006231.3(POLE):c.4729-13dup rs1057517615
NM_006231.3(POLE):c.4729-7G>C rs768719788
NM_006231.3(POLE):c.4729-8T>C rs759376994
NM_006231.3(POLE):c.4730A>C (p.Glu1577Ala) rs5744948
NM_006231.3(POLE):c.4731G>A (p.Glu1577=) rs772361606
NM_006231.3(POLE):c.4731G>C (p.Glu1577Asp) rs772361606
NM_006231.3(POLE):c.4735C>G (p.Arg1579Gly) rs1060500802
NM_006231.3(POLE):c.4735C>T (p.Arg1579Cys) rs1060500802
NM_006231.3(POLE):c.4736G>A (p.Arg1579His) rs375590443
NM_006231.3(POLE):c.4737C>A (p.Arg1579=) rs774453650
NM_006231.3(POLE):c.4738C>T (p.Arg1580Trp) rs192908615
NM_006231.3(POLE):c.4739G>A (p.Arg1580Gln) rs201950040
NM_006231.3(POLE):c.4744C>T (p.Pro1582Ser) rs556887600
NM_006231.3(POLE):c.4745C>A (p.Pro1582His) rs1555222617
NM_006231.3(POLE):c.4749A>G (p.Thr1583=) rs878854877
NM_006231.3(POLE):c.4752C>T (p.Leu1584=) rs1057524354
NM_006231.3(POLE):c.4754T>A (p.Ile1585Asn) rs1565937957
NM_006231.3(POLE):c.4755C>T (p.Ile1585=) rs540172985
NM_006231.3(POLE):c.4756G>A (p.Ala1586Thr) rs746266857
NM_006231.3(POLE):c.4757C>T (p.Ala1586Val)
NM_006231.3(POLE):c.4759G>A (p.Val1587Ile) rs372388555
NM_006231.3(POLE):c.4759G>C (p.Val1587Leu)
NM_006231.3(POLE):c.4767C>T (p.Ser1589=) rs1555222607
NM_006231.3(POLE):c.4779G>A (p.Leu1593=) rs542995085
NM_006231.3(POLE):c.4779G>T (p.Leu1593=) rs542995085
NM_006231.3(POLE):c.477T>C (p.Thr159=) rs377652373
NM_006231.3(POLE):c.4784G>T (p.Arg1595Met) rs1565937889
NM_006231.3(POLE):c.4785G>C (p.Arg1595Ser)
NM_006231.3(POLE):c.4789G>A (p.Ala1597Thr) rs752184541
NM_006231.3(POLE):c.4792A>C (p.Ser1598Arg) rs776538943
NM_006231.3(POLE):c.4794T>C (p.Ser1598=) rs1555222600
NM_006231.3(POLE):c.4796A>G (p.Glu1599Gly) rs762160282
NM_006231.3(POLE):c.4799T>C (p.Ile1600Thr)
NM_006231.3(POLE):c.47A>G (p.Asp16Gly)
NM_006231.3(POLE):c.47A>T (p.Asp16Val)
NM_006231.3(POLE):c.4801C>G (p.Pro1601Ala)
NM_006231.3(POLE):c.4802C>G (p.Pro1601Arg)
NM_006231.3(POLE):c.4809G>A (p.Leu1603=) rs75378940
NM_006231.3(POLE):c.4812G>C (p.Glu1604Asp) rs1064794898
NM_006231.3(POLE):c.4813G>A (p.Glu1605Lys) rs768801696
NM_006231.3(POLE):c.4822C>G (p.Leu1608Val) rs1555222593
NM_006231.3(POLE):c.4823T>G (p.Leu1608Arg) rs1255478620
NM_006231.3(POLE):c.4827G>A (p.Val1609=) rs770382974
NM_006231.3(POLE):c.4831A>C (p.Ile1611Leu) rs551368454
NM_006231.3(POLE):c.4831A>G (p.Ile1611Val)
NM_006231.3(POLE):c.4835G>C (p.Cys1612Ser) rs1411134935
NM_006231.3(POLE):c.4841C>T (p.Ala1614Val) rs1565937687
NM_006231.3(POLE):c.4843G>A (p.Asp1615Asn) rs1565937674
NM_006231.3(POLE):c.4845C>T (p.Asp1615=) rs1060504046
NM_006231.3(POLE):c.4847A>G (p.Lys1616Arg)
NM_006231.3(POLE):c.484G>C (p.Asp162His) rs759492756
NM_006231.3(POLE):c.4852A>G (p.Asn1618Asp) rs377406943
NM_006231.3(POLE):c.4855T>C (p.Tyr1619His) rs1060500849
NM_006231.3(POLE):c.4856A>G (p.Tyr1619Cys)
NM_006231.3(POLE):c.4857T>C (p.Tyr1619=) rs1060504075
NM_006231.3(POLE):c.4857_4858insA (p.Gly1620fs) rs1432073374
NM_006231.3(POLE):c.4863C>G (p.Val1621=) rs1057522227
NM_006231.3(POLE):c.4863C>T (p.Val1621=) rs1057522227
NM_006231.3(POLE):c.4872G>A (p.Trp1624Ter) rs754982151
NM_006231.3(POLE):c.4873C>G (p.Gln1625Glu) rs1064794648
NM_006231.3(POLE):c.4876C>T (p.Arg1626Cys) rs753713315
NM_006231.3(POLE):c.4877G>A (p.Arg1626His) rs766252708
NM_006231.3(POLE):c.4878C>T (p.Arg1626=) rs1294064987
NM_006231.3(POLE):c.4880A>C (p.His1627Pro) rs1274894982
NM_006231.3(POLE):c.4880A>G (p.His1627Arg) rs1274894982
NM_006231.3(POLE):c.4881T>C (p.His1627=) rs1060504049
NM_006231.3(POLE):c.4886C>T (p.Ala1629Val) rs1555222573
NM_006231.3(POLE):c.4888C>T (p.Arg1630Trp) rs148076304
NM_006231.3(POLE):c.4889G>A (p.Arg1630Gln) rs750180239
NM_006231.3(POLE):c.4891C>T (p.Arg1631Cys) rs565413729
NM_006231.3(POLE):c.4892G>A (p.Arg1631His) rs775590365
NM_006231.3(POLE):c.4892G>T (p.Arg1631Leu) rs775590365
NM_006231.3(POLE):c.4894A>G (p.Met1632Val) rs1565937490
NM_006231.3(POLE):c.4899C>T (p.Ile1633=) rs1555222570
NM_006231.3(POLE):c.48T>C (p.Asp16=) rs1057523833
NM_006231.3(POLE):c.4900C>T (p.Arg1634Cys) rs769762523
NM_006231.3(POLE):c.4900del (p.Arg1634fs) rs1555222567
NM_006231.3(POLE):c.4901G>A (p.Arg1634His) rs760149463
NM_006231.3(POLE):c.4907A>C (p.Tyr1636Ser) rs1555222562
NM_006231.3(POLE):c.4913A>G (p.Asn1638Ser)
NM_006231.3(POLE):c.4913A>T (p.Asn1638Ile) rs771399151
NM_006231.3(POLE):c.4916T>C (p.Leu1639Pro) rs878854878
NM_006231.3(POLE):c.4917G>A (p.Leu1639=) rs1565937426
NM_006231.3(POLE):c.4924T>C (p.Cys1642Arg)
NM_006231.3(POLE):c.4927C>G (p.Leu1643Val) rs1418072475
NM_006231.3(POLE):c.4931C>T (p.Ser1644Leu) rs771896231
NM_006231.3(POLE):c.4932G>A (p.Ser1644=) rs1057522607
NM_006231.3(POLE):c.4932G>T (p.Ser1644=) rs1057522607
NM_006231.3(POLE):c.4934A>G (p.Gln1645Arg) rs878854879
NM_006231.3(POLE):c.4936G>C (p.Ala1646Pro) rs1555222550
NM_006231.3(POLE):c.4936G>T (p.Ala1646Ser)
NM_006231.3(POLE):c.4941C>T (p.Phe1647=) rs145639967
NM_006231.3(POLE):c.4942G>A (p.Glu1648Lys) rs532781183
NM_006231.3(POLE):c.4945A>G (p.Met1649Val) rs1565937350
NM_006231.3(POLE):c.4948A>G (p.Ser1650Gly) rs1060500881
NM_006231.3(POLE):c.4949G>A (p.Ser1650Asn)
NM_006231.3(POLE):c.494A>C (p.Lys165Thr) rs1060500782
NM_006231.3(POLE):c.4952+10G>A rs376828693
NM_006231.3(POLE):c.4952+11T>A rs779889181
NM_006231.3(POLE):c.4952+13C>T rs1057517612
NM_006231.3(POLE):c.4952+16T>C rs755998543
NM_006231.3(POLE):c.4952+17C>T rs750268044
NM_006231.3(POLE):c.4952+17_4952+19dupCGT rs571641918
NM_006231.3(POLE):c.4952+20_4952+22del rs752389775
NM_006231.3(POLE):c.4952+4A>G rs962068207
NM_006231.3(POLE):c.4952+5G>A rs1555222548
NM_006231.3(POLE):c.4952+9A>G rs1555222544
NM_006231.3(POLE):c.4953-10C>G rs1060504059
NM_006231.3(POLE):c.4953-5T>G rs757060708
NM_006231.3(POLE):c.4959del (p.His1654fs)
NM_006231.3(POLE):c.4959dup (p.His1654fs) rs1555222526
NM_006231.3(POLE):c.4962C>T (p.His1654=) rs1555222521
NM_006231.3(POLE):c.4963A>G (p.Ile1655Val) rs1060500876
NM_006231.3(POLE):c.4965T>C (p.Ile1655=) rs751304582
NM_006231.3(POLE):c.4970T>C (p.Ile1657Thr) rs1060500827
NM_006231.3(POLE):c.4971T>C (p.Ile1657=) rs1555222518
NM_006231.3(POLE):c.4983A>G (p.Pro1661=) rs878854880
NM_006231.3(POLE):c.4985A>C (p.Glu1662Ala)
NM_006231.3(POLE):c.4987G>C (p.Asp1663His) rs753910068
NM_006231.3(POLE):c.4991T>C (p.Ile1664Thr)
NM_006231.3(POLE):c.4992C>T (p.Ile1664=) rs1555222515
NM_006231.3(POLE):c.4994C>T (p.Ser1665Phe) rs1565937052
NM_006231.3(POLE):c.4995C>T (p.Ser1665=) rs766531363
NM_006231.3(POLE):c.49G>A (p.Gly17Ser) rs1243827536
NM_006231.3(POLE):c.5001C>T (p.Phe1667=) rs112358554
NM_006231.3(POLE):c.5002G>A (p.Gly1668Ser) rs371348453
NM_006231.3(POLE):c.5003G>T (p.Gly1668Val) rs368735471
NM_006231.3(POLE):c.5007C>T (p.Ser1669=) rs146761597
NM_006231.3(POLE):c.5008G>A (p.Asp1670Asn) rs1060500823
NM_006231.3(POLE):c.5010C>T (p.Asp1670=)
NM_006231.3(POLE):c.5013C>A (p.Leu1671=) rs1260912213
NM_006231.3(POLE):c.5016_5018delCTT rs1555222501
NM_006231.3(POLE):c.501G>A (p.Arg167=) rs1555230088
NM_006231.3(POLE):c.5020G>A (p.Ala1674Thr)
NM_006231.3(POLE):c.5023C>T (p.Arg1675Cys) rs1027297469
NM_006231.3(POLE):c.5025C>T (p.Arg1675=) rs1555222498
NM_006231.3(POLE):c.5032C>T (p.Gln1678Ter) rs1301816028
NM_006231.3(POLE):c.5035C>T (p.Arg1679Cys) rs768244569
NM_006231.3(POLE):c.5036G>T (p.Arg1679Leu) rs748940418
NM_006231.3(POLE):c.5037C>A (p.Arg1679=) rs1057523897
NM_006231.3(POLE):c.5044C>T (p.His1682Tyr)
NM_006231.3(POLE):c.5046C>T (p.His1682=) rs769284070
NM_006231.3(POLE):c.5056C>G (p.Leu1686Val) rs1476020004
NM_006231.3(POLE):c.5060C>A (p.Ser1687Tyr) rs1565936909
NM_006231.3(POLE):c.5060C>T (p.Ser1687Phe)
NM_006231.3(POLE):c.5062C>T (p.Pro1688Ser) rs781114688
NM_006231.3(POLE):c.5067A>G (p.Thr1689=) rs1256621322
NM_006231.3(POLE):c.5068G>A (p.Ala1690Thr)
NM_006231.3(POLE):c.5071C>T (p.Arg1691Cys) rs777599909
NM_006231.3(POLE):c.507G>A (p.Glu169=) rs1555230086
NM_006231.3(POLE):c.5081T>C (p.Leu1694Pro) rs1555222481
NM_006231.3(POLE):c.5084G>A (p.Gly1695Asp) rs920535000
NM_006231.3(POLE):c.5084G>T (p.Gly1695Val) rs920535000
NM_006231.3(POLE):c.5085T>C (p.Gly1695=) rs755191548
NM_006231.3(POLE):c.5088A>G (p.Gly1696=) rs1555222476
NM_006231.3(POLE):c.508A>C (p.Ile170Leu) rs1331686551
NM_006231.3(POLE):c.5090A>G (p.Lys1697Arg) rs879254207
NM_006231.3(POLE):c.5093_5095delAGG rs1555222471
NM_006231.3(POLE):c.5095G>A (p.Ala1699Thr) rs1256635297
NM_006231.3(POLE):c.5102A>T (p.Asp1701Val) rs1565936830
NM_006231.3(POLE):c.5103_5173+29delCAACTGTCTTGTCATGGAGTTCGATGACCAAGCCACTGTTGAGATCAACAGTTCAGGCTGTTACTCCACAGGTAAGTGGGCGGGAGGACGAGGCCCATGA rs1565936576
NM_006231.3(POLE):c.5104A>G (p.Asn1702Asp) rs1431532125
NM_006231.3(POLE):c.5105A>G (p.Asn1702Ser) rs754086131
NM_006231.3(POLE):c.5106C>T (p.Asn1702=) rs116001373
NM_006231.3(POLE):c.5108G>C (p.Cys1703Ser) rs961736994
NM_006231.3(POLE):c.510C>A (p.Ile170=) rs374074035
NM_006231.3(POLE):c.510C>T (p.Ile170=) rs374074035
NM_006231.3(POLE):c.5112T>A (p.Leu1704=) rs1555222458
NM_006231.3(POLE):c.5116A>T (p.Met1706Leu) rs1478959461
NM_006231.3(POLE):c.5118G>T (p.Met1706Ile)
NM_006231.3(POLE):c.5119dup (p.Glu1707fs) rs1555222457
NM_006231.3(POLE):c.5121G>T (p.Glu1707Asp) rs750460626
NM_006231.3(POLE):c.5124C>T (p.Phe1708=) rs114891564
NM_006231.3(POLE):c.5125G>A (p.Asp1709Asn) rs572502366
NM_006231.3(POLE):c.5130C>T (p.Asp1710=) rs1340452589
NM_006231.3(POLE):c.5131C>A (p.Gln1711Lys)
NM_006231.3(POLE):c.5135C>T (p.Ala1712Val) rs5744950
NM_006231.3(POLE):c.5136C>T (p.Ala1712=) rs1555222447
NM_006231.3(POLE):c.513C>T (p.Ser171=) rs1555230083
NM_006231.3(POLE):c.5140G>T (p.Val1714Phe)
NM_006231.3(POLE):c.5143G>C (p.Glu1715Gln)
NM_006231.3(POLE):c.5148C>T (p.Ile1716=) rs1060504054
NM_006231.3(POLE):c.5149A>G (p.Asn1717Asp)
NM_006231.3(POLE):c.5150A>G (p.Asn1717Ser)
NM_006231.3(POLE):c.5151del (p.Asn1717fs) rs1565936691
NM_006231.3(POLE):c.5152A>G (p.Ser1718Gly) rs374381852
NM_006231.3(POLE):c.5153G>A (p.Ser1718Asn) rs1555222434
NM_006231.3(POLE):c.5157A>T (p.Ser1719=) rs1057523692
NM_006231.3(POLE):c.5168C>T (p.Ser1723Phe) rs996998835
NM_006231.3(POLE):c.516T>G (p.Pro172=) rs768997534
NM_006231.3(POLE):c.5173+10C>G rs371098994
NM_006231.3(POLE):c.5173+10C>T rs371098994
NM_006231.3(POLE):c.5173+11G>A rs201001062
NM_006231.3(POLE):c.5173+17A>G rs368209692
NM_006231.3(POLE):c.5173+18C>T rs201587262
NM_006231.3(POLE):c.5173+1G>T rs1060500866
NM_006231.3(POLE):c.5173+4A>G rs1565936629
NM_006231.3(POLE):c.5173+5del
NM_006231.3(POLE):c.5173+9G>A rs1555222421
NM_006231.3(POLE):c.5174-17G>A rs201254290
NM_006231.3(POLE):c.5174-1G>T rs5744954
NM_006231.3(POLE):c.5174-2A>C
NM_006231.3(POLE):c.5174-3C>T rs878854881
NM_006231.3(POLE):c.5174-6G>C rs770466844
NM_006231.3(POLE):c.5174T>C (p.Val1725Ala) rs1064796427
NM_006231.3(POLE):c.5176T>A (p.Cys1726Ser)
NM_006231.3(POLE):c.5180T>A (p.Val1727Glu) rs1384842148
NM_006231.3(POLE):c.5180_5181delTG rs1555222376
NM_006231.3(POLE):c.5181G>A (p.Val1727=) rs1057523212
NM_006231.3(POLE):c.5184G>A (p.Glu1728=) rs1555222373
NM_006231.3(POLE):c.5189A>G (p.Asp1730Gly) rs1565936260
NM_006231.3(POLE):c.5199C>T (p.Asn1733=) rs773214571
NM_006231.3(POLE):c.519C>T (p.Ala173=) rs187690610
NM_006231.3(POLE):c.51C>G (p.Gly17=) rs780436496
NM_006231.3(POLE):c.5205C>T (p.Ala1735=) rs778829972
NM_006231.3(POLE):c.5206G>A (p.Val1736Ile) rs770181299
NM_006231.3(POLE):c.5210A>G (p.Asn1737Ser) rs1565936216
NM_006231.3(POLE):c.5215A>G (p.Ile1739Val) rs1064794641
NM_006231.3(POLE):c.5220C>T (p.Leu1740=) rs746085748
NM_006231.3(POLE):c.5221C>T (p.Gln1741Ter) rs781481160
NM_006231.3(POLE):c.5227C>T (p.His1743Tyr) rs1565936182
NM_006231.3(POLE):c.5229C>A (p.His1743Gln) rs1170880797
NM_006231.3(POLE):c.5232T>C (p.His1744=) rs1060504045
NM_006231.3(POLE):c.5233G>A (p.Val1745Ile)
NM_006231.3(POLE):c.5237A>G (p.Asn1746Ser) rs377461656
NM_006231.3(POLE):c.5237A>T (p.Asn1746Ile) rs377461656
NM_006231.3(POLE):c.5238C>T (p.Asn1746=) rs200128464
NM_006231.3(POLE):c.5240A>G (p.Asp1747Gly) rs1555222355
NM_006231.3(POLE):c.5245G>T (p.Glu1749Ter)
NM_006231.3(POLE):c.524A>G (p.Lys175Arg) rs1555230082
NM_006231.3(POLE):c.5252C>T (p.Ala1751Val) rs1555222349
NM_006231.3(POLE):c.5253C>T (p.Ala1751=) rs765888059
NM_006231.3(POLE):c.5260A>C (p.Met1754Leu)
NM_006231.3(POLE):c.5264G>A (p.Gly1755Glu) rs760235113
NM_006231.3(POLE):c.5265del (p.Ile1756fs) rs1555222342
NM_006231.3(POLE):c.5266A>G (p.Ile1756Val)
NM_006231.3(POLE):c.5267T>A (p.Ile1756Asn) rs199535980
NM_006231.3(POLE):c.5270G>T (p.Ser1757Ile) rs878854882
NM_006231.3(POLE):c.5271C>T (p.Ser1757=) rs1555222331
NM_006231.3(POLE):c.5275G>A (p.Asp1759Asn) rs768559928
NM_006231.3(POLE):c.5275G>T (p.Asp1759Tyr)
NM_006231.3(POLE):c.5278G>A (p.Val1760Met) rs373272795
NM_006231.3(POLE):c.5278del (p.Asp1759_Val1760insTer) rs1565935966
NM_006231.3(POLE):c.5288A>G (p.Gln1763Arg) rs1565935906
NM_006231.3(POLE):c.528_530delGAA rs1060500793
NM_006231.3(POLE):c.5290G>A (p.Ala1764Thr)
NM_006231.3(POLE):c.5290G>C (p.Ala1764Pro) rs1315730296
NM_006231.3(POLE):c.5291C>T (p.Ala1764Val) rs1285538355
NM_006231.3(POLE):c.5293T>C (p.Ser1765Pro)
NM_006231.3(POLE):c.52G>C (p.Glu18Gln)
NM_006231.3(POLE):c.52G>T (p.Glu18Ter) rs1555231403
NM_006231.3(POLE):c.5305A>G (p.Met1769Val) rs1449742140
NM_006231.3(POLE):c.5312C>T (p.Thr1771Met) rs777695766
NM_006231.3(POLE):c.5313G>A (p.Thr1771=) rs201803493
NM_006231.3(POLE):c.5313G>T (p.Thr1771=) rs201803493
NM_006231.3(POLE):c.5317G>A (p.Gly1773Ser) rs1565935798
NM_006231.3(POLE):c.5326G>T (p.Ala1776Ser) rs748644914
NM_006231.3(POLE):c.5327C>A (p.Ala1776Asp) rs779305242
NM_006231.3(POLE):c.5332G>A (p.Ala1778Thr) rs755346486
NM_006231.3(POLE):c.5334C>T (p.Ala1778=) rs11146986
NM_006231.3(POLE):c.5335C>T (p.Pro1779Ser)
NM_006231.3(POLE):c.5336C>T (p.Pro1779Leu)
NM_006231.3(POLE):c.5336del (p.Pro1779fs)
NM_006231.3(POLE):c.5337G>A (p.Pro1779=) rs749991080
NM_006231.3(POLE):c.5339C>G (p.Ala1780Gly) rs1024088828
NM_006231.3(POLE):c.5340C>T (p.Ala1780=) rs1291600656
NM_006231.3(POLE):c.5341A>G (p.Ser1781Gly)
NM_006231.3(POLE):c.5342G>C (p.Ser1781Thr)
NM_006231.3(POLE):c.5345A>G (p.Tyr1782Cys)
NM_006231.3(POLE):c.5346C>T (p.Tyr1782=) rs761902063
NM_006231.3(POLE):c.5347G>A (p.Asp1783Asn) rs149893630
NM_006231.3(POLE):c.5347G>C (p.Asp1783His) rs149893630
NM_006231.3(POLE):c.5350G>A (p.Glu1784Lys) rs1555222266
NM_006231.3(POLE):c.5352G>C (p.Glu1784Asp) rs1555222265
NM_006231.3(POLE):c.5355A>G (p.Thr1785=) rs1555222255
NM_006231.3(POLE):c.5361del (p.Cys1788fs) rs752558475
NM_006231.3(POLE):c.5363G>A (p.Cys1788Tyr) rs1565935614
NM_006231.3(POLE):c.5364C>T (p.Cys1788=) rs5744955
NM_006231.3(POLE):c.5367dup (p.Asn1790Ter) rs959133191
NM_006231.3(POLE):c.5376C>T (p.Phe1792=) rs1555222243
NM_006231.3(POLE):c.5378+1G>T
NM_006231.3(POLE):c.5378+5C>T rs1171630569
NM_006231.3(POLE):c.5378+6A>G rs1380872711
NM_006231.3(POLE):c.5378+9C>G rs1177871620
NM_006231.3(POLE):c.5379-19C>T rs376722984
NM_006231.3(POLE):c.5379-3C>A rs1415497701
NM_006231.3(POLE):c.5379-3C>G rs1415497701
NM_006231.3(POLE):c.5379-5T>C rs761910924
NM_006231.3(POLE):c.5379-7C>T rs1460370920
NM_006231.3(POLE):c.537G>A (p.Glu179=) rs1349794825
NM_006231.3(POLE):c.5382C>G (p.Ile1794Met) rs368364666
NM_006231.3(POLE):c.538C>T (p.Gln180Ter) rs1565979764
NM_006231.3(POLE):c.5390G>A (p.Ser1797Asn) rs749755939
NM_006231.3(POLE):c.5392A>G (p.Met1798Val) rs1555221940
NM_006231.3(POLE):c.5395G>A (p.Val1799Ile) rs780525568
NM_006231.3(POLE):c.5395G>T (p.Val1799Phe)
NM_006231.3(POLE):c.5397C>T (p.Val1799=) rs770069897
NM_006231.3(POLE):c.5398G>A (p.Val1800Met) rs199777048
NM_006231.3(POLE):c.5401G>T (p.Gly1801Cys) rs1447287662
NM_006231.3(POLE):c.5402G>A (p.Gly1801Asp) rs1060500803
NM_006231.3(POLE):c.5407G>A (p.Val1803Met) rs1555221935
NM_006231.3(POLE):c.5412G>A (p.Lys1804=) rs144218410
NM_006231.3(POLE):c.5420C>G (p.Thr1807Ser) rs1565933242
NM_006231.3(POLE):c.5420C>T (p.Thr1807Ile)
NM_006231.3(POLE):c.5422C>G (p.Gln1808Glu) rs1167794021
NM_006231.3(POLE):c.5423A>G (p.Gln1808Arg) rs1060500811
NM_006231.3(POLE):c.5423del (p.Gln1808fs) rs1565933220
NM_006231.3(POLE):c.5424G>C (p.Gln1808His) rs1555221929
NM_006231.3(POLE):c.5429A>T (p.His1810Leu) rs777390504
NM_006231.3(POLE):c.542A>T (p.Asp181Val) rs1555230076
NM_006231.3(POLE):c.5432A>G (p.Asn1811Ser) rs1565933181
NM_006231.3(POLE):c.5434A>G (p.Ile1812Val)
NM_006231.3(POLE):c.5438A>G (p.Tyr1813Cys)
NM_006231.3(POLE):c.5438A>T (p.Tyr1813Phe) rs752559134
NM_006231.3(POLE):c.5454G>A (p.Val1818=) rs1046972573
NM_006231.3(POLE):c.5464_5466dup (p.Tyr1822dup) rs773960177
NM_006231.3(POLE):c.5467C>T (p.Arg1823Cys) rs753627422
NM_006231.3(POLE):c.5468G>A (p.Arg1823His) rs767747669
NM_006231.3(POLE):c.5468G>C (p.Arg1823Pro)
NM_006231.3(POLE):c.546C>T (p.His182=) rs115257501
NM_006231.3(POLE):c.5476C>T (p.Arg1826Trp) rs762000608
NM_006231.3(POLE):c.5477G>A (p.Arg1826Gln) rs1555221919
NM_006231.3(POLE):c.5478G>A (p.Arg1826=) rs537648186
NM_006231.3(POLE):c.5478G>T (p.Arg1826=) rs537648186
NM_006231.3(POLE):c.547G>A (p.Ala183Thr) rs993340577
NM_006231.3(POLE):c.5480C>T (p.Ser1827Leu) rs763031537
NM_006231.3(POLE):c.5481G>A (p.Ser1827=) rs775867327
NM_006231.3(POLE):c.5484A>G (p.Pro1828=) rs770297218
NM_006231.3(POLE):c.5484A>T (p.Pro1828=) rs770297218
NM_006231.3(POLE):c.5484del (p.Ser1829fs) rs1555221914
NM_006231.3(POLE):c.5487_5488CT[2] (p.Leu1831fs) rs878854883
NM_006231.3(POLE):c.5492T>C (p.Leu1831Pro) rs781674901
NM_006231.3(POLE):c.5494C>T (p.Leu1832Phe) rs1456049352
NM_006231.3(POLE):c.5496T>C (p.Leu1832=) rs147543146
NM_006231.3(POLE):c.5498A>G (p.His1833Arg)
NM_006231.3(POLE):c.549C>A (p.Ala183=) rs1555230075
NM_006231.3(POLE):c.54G>C (p.Glu18Asp) rs1311350422
NM_006231.3(POLE):c.5502C>T (p.Asp1834=) rs1555221903
NM_006231.3(POLE):c.5507C>T (p.Ala1836Val) rs780776704
NM_006231.3(POLE):c.550A>C (p.Ser184Arg) rs1060500790
NM_006231.3(POLE):c.5514C>T (p.His1838=) rs936176137
NM_006231.3(POLE):c.5515C>T (p.Arg1839Cys) rs141519273
NM_006231.3(POLE):c.5516G>A (p.Arg1839His) rs370512955
NM_006231.3(POLE):c.5520A>G (p.Thr1840=) rs778744958
NM_006231.3(POLE):c.5525A>G (p.His1842Arg) rs1060500795
NM_006231.3(POLE):c.5527A>C (p.Asn1843His)
NM_006231.3(POLE):c.5528A>G (p.Asn1843Ser) rs753680242
NM_006231.3(POLE):c.5528_5530del rs868246375
NM_006231.3(POLE):c.5529C>T (p.Asn1843=) rs766130096
NM_006231.3(POLE):c.552C>T (p.Ser184=) rs878854884
NM_006231.3(POLE):c.5539A>C (p.Lys1847Gln)
NM_006231.3(POLE):c.5539_5541delAAG rs1060500844
NM_006231.3(POLE):c.553G>A (p.Asp185Asn) rs369506007
NM_006231.3(POLE):c.5542C>T (p.Leu1848Phe) rs201001790
NM_006231.3(POLE):c.5549T>A (p.Leu1850Gln) rs1565932919
NM_006231.3(POLE):c.5552+14C>T rs1367903300
NM_006231.3(POLE):c.5552+1G>A rs1555221894
NM_006231.3(POLE):c.5552+1G>T rs1555221894
NM_006231.3(POLE):c.5553-12C>G rs766922669
NM_006231.3(POLE):c.5553-1G>A rs1064796152
NM_006231.3(POLE):c.5553-43T>C
NM_006231.3(POLE):c.5553-6C>T rs1555221787
NM_006231.3(POLE):c.5553-7T>C
NM_006231.3(POLE):c.5558T>C (p.Ile1853Thr) rs1057519257
NM_006231.3(POLE):c.5559C>T (p.Ile1853=) rs1032264693
NM_006231.3(POLE):c.555C>T (p.Asp185=) rs763871536
NM_006231.3(POLE):c.5560G>A (p.Ala1854Thr) rs557167678
NM_006231.3(POLE):c.5560G>T (p.Ala1854Ser) rs557167678
NM_006231.3(POLE):c.5565G>A (p.Glu1855=) rs1555221780
NM_006231.3(POLE):c.5566T>C (p.Phe1856Leu) rs1060500846
NM_006231.3(POLE):c.5568C>T (p.Phe1856=) rs1057523481
NM_006231.3(POLE):c.5569A>G (p.Lys1857Glu) rs773659817
NM_006231.3(POLE):c.556G>A (p.Ala186Thr) rs375213599
NM_006231.3(POLE):c.5570A>G (p.Lys1857Arg) rs5744971
NM_006231.3(POLE):c.5570A>T (p.Lys1857Met) rs5744971
NM_006231.3(POLE):c.5572C>T (p.Arg1858Cys) rs1193081581
NM_006231.3(POLE):c.5573G>A (p.Arg1858His) rs1445288473
NM_006231.3(POLE):c.5575C>G (p.Leu1859Val) rs184253572
NM_006231.3(POLE):c.5578G>C (p.Gly1860Arg) rs144343630
NM_006231.3(POLE):c.557C>T (p.Ala186Val) rs151325267
NM_006231.3(POLE):c.5583A>C (p.Ser1861=) rs5744972
NM_006231.3(POLE):c.558G>A (p.Ala186=) rs764758303
NM_006231.3(POLE):c.558G>C (p.Ala186=) rs764758303
NM_006231.3(POLE):c.5591T>C (p.Ile1864Thr) rs896266569
NM_006231.3(POLE):c.5595C>T (p.Tyr1865=) rs370958363
NM_006231.3(POLE):c.5596G>A (p.Ala1866Thr) rs377662540
NM_006231.3(POLE):c.5598C>T (p.Ala1866=) rs1555221772
NM_006231.3(POLE):c.5607C>T (p.Asn1869=) rs1565932038
NM_006231.3(POLE):c.5608C>T (p.Arg1870Cys) rs138231414
NM_006231.3(POLE):c.5609G>A (p.Arg1870His) rs758619238
NM_006231.3(POLE):c.5611A>G (p.Ile1871Val) rs752955761
NM_006231.3(POLE):c.5616C>T (p.Ile1872=) rs778941198
NM_006231.3(POLE):c.5617C>A (p.Leu1873Ile)
NM_006231.3(POLE):c.5619C>A (p.Leu1873=) rs1060504071
NM_006231.3(POLE):c.561C>T (p.Tyr187=) rs143938822
NM_006231.3(POLE):c.5625A>G (p.Thr1875=) rs1555221765
NM_006231.3(POLE):c.5632C>G (p.Arg1878Gly)
NM_006231.3(POLE):c.5632C>T (p.Arg1878Cys) rs199979862
NM_006231.3(POLE):c.5633G>A (p.Arg1878His) rs374022997
NM_006231.3(POLE):c.5635C>T (p.Arg1879Cys) rs767012802
NM_006231.3(POLE):c.5636G>A (p.Arg1879His) rs145621558
NM_006231.3(POLE):c.5636G>C (p.Arg1879Pro)
NM_006231.3(POLE):c.5638G>T (p.Val1880Leu)
NM_006231.3(POLE):c.5639T>C (p.Val1880Ala)
NM_006231.3(POLE):c.563C>T (p.Thr188Ile) rs1565979672
NM_006231.3(POLE):c.5647G>A (p.Ala1883Thr) rs1565931961
NM_006231.3(POLE):c.5652C>A (p.Ile1884=) rs567300887
NM_006231.3(POLE):c.5652C>T (p.Ile1884=) rs567300887
NM_006231.3(POLE):c.5653G>A (p.Ala1885Thr) rs748008084
NM_006231.3(POLE):c.5653G>T (p.Ala1885Ser) rs748008084
NM_006231.3(POLE):c.5655T>C (p.Ala1885=) rs761429503
NM_006231.3(POLE):c.5658C>A (p.Tyr1886Ter)
NM_006231.3(POLE):c.5658C>T (p.Tyr1886=) rs369346799
NM_006231.3(POLE):c.5659G>A (p.Val1887Met) rs114119067
NM_006231.3(POLE):c.565G>C (p.Ala189Pro) rs1555230056
NM_006231.3(POLE):c.5662G>A (p.Glu1888Lys) rs368363850
NM_006231.3(POLE):c.5668A>G (p.Ile1890Val) rs745804149
NM_006231.3(POLE):c.566C>G (p.Ala189Gly)
NM_006231.3(POLE):c.5670C>G (p.Ile1890Met)
NM_006231.3(POLE):c.5670C>T (p.Ile1890=) rs1037020157
NM_006231.3(POLE):c.5672_5674del (p.Thr1891del) rs769630098
NM_006231.3(POLE):c.5678+1G>A
NM_006231.3(POLE):c.5678+212G>A
NM_006231.3(POLE):c.5678+3G>A rs1060500826
NM_006231.3(POLE):c.5678+4C>T rs5744973
NM_006231.3(POLE):c.5678+5G>A rs779223088
NM_006231.3(POLE):c.5678+6G>A
NM_006231.3(POLE):c.5678+6G>C
NM_006231.3(POLE):c.5678+6G>T
NM_006231.3(POLE):c.5678+78C>G
NM_006231.3(POLE):c.5679-127G>A
NM_006231.3(POLE):c.5679-14T>C rs1555221517
NM_006231.3(POLE):c.5679-3C>T rs1555221512
NM_006231.3(POLE):c.5679-82A>G
NM_006231.3(POLE):c.5685T>C (p.His1895=) rs745896415
NM_006231.3(POLE):c.568C>T (p.Leu190=) rs776647660
NM_006231.3(POLE):c.5691G>C (p.Lys1897Asn)
NM_006231.3(POLE):c.5694G>T (p.Glu1898Asp) rs1555221506
NM_006231.3(POLE):c.5697C>T (p.Thr1899=) rs751997713
NM_006231.3(POLE):c.569T>C (p.Leu190Pro) rs1565979656
NM_006231.3(POLE):c.5703T>A (p.His1901Gln)
NM_006231.3(POLE):c.5707C>T (p.Leu1903=) rs5744990
NM_006231.3(POLE):c.5718T>A (p.Ser1906=) rs1060504048
NM_006231.3(POLE):c.5725C>T (p.Arg1909Ter) rs1380204151
NM_006231.3(POLE):c.5726G>A (p.Arg1909Gln) rs201455049
NM_006231.3(POLE):c.5730C>G (p.Cys1910Trp)
NM_006231.3(POLE):c.5730C>T (p.Cys1910=) rs549163600
NM_006231.3(POLE):c.5736A>G (p.Glu1912=) rs369755963
NM_006231.3(POLE):c.5742T>C (p.Leu1914=) rs541999794
NM_006231.3(POLE):c.5742_5744delTCT rs1565930056
NM_006231.3(POLE):c.5744T>C (p.Leu1915Pro)
NM_006231.3(POLE):c.5745C>G (p.Leu1915=) rs760495946
NM_006231.3(POLE):c.574T>C (p.Ser192Pro) rs1555230047
NM_006231.3(POLE):c.5756C>T (p.Pro1919Leu) rs1235640927
NM_006231.3(POLE):c.5757A>G (p.Pro1919=) rs1426714579
NM_006231.3(POLE):c.5758T>C (p.Ser1920Pro) rs1565930031
NM_006231.3(POLE):c.575C>T (p.Ser192Phe) rs1060500891
NM_006231.3(POLE):c.5761A>G (p.Asn1921Asp) rs771980261
NM_006231.3(POLE):c.5763C>G (p.Asn1921Lys) rs113976595
NM_006231.3(POLE):c.5763C>T (p.Asn1921=) rs113976595
NM_006231.3(POLE):c.5769C>T (p.Gly1923=) rs375198950
NM_006231.3(POLE):c.5770G>A (p.Gly1924Arg) rs371862779
NM_006231.3(POLE):c.5777A>G (p.Lys1926Arg) rs757847276
NM_006231.3(POLE):c.577A>G (p.Ser193Gly) rs760588718
NM_006231.3(POLE):c.578+1G>A rs1565979631
NM_006231.3(POLE):c.5783_5784del (p.Lys1928fs)
NM_006231.3(POLE):c.579-140T>G
NM_006231.3(POLE):c.579-15C>G rs368482979
NM_006231.3(POLE):c.579-16T>C rs869312621
NM_006231.3(POLE):c.579-18T>C rs1056677187
NM_006231.3(POLE):c.5792C>G (p.Ser1931Cys)
NM_006231.3(POLE):c.5792C>T (p.Ser1931Phe) rs879254232
NM_006231.3(POLE):c.5794C>T (p.Arg1932Cys) rs879254168
NM_006231.3(POLE):c.5795G>A (p.Arg1932His) rs778190944
NM_006231.3(POLE):c.5797A>G (p.Ile1933Val) rs758762868
NM_006231.3(POLE):c.5804G>A (p.Cys1935Tyr) rs5744991
NM_006231.3(POLE):c.5809C>G (p.Leu1937Val) rs1555221482
NM_006231.3(POLE):c.5809C>T (p.Leu1937=) rs1555221482
NM_006231.3(POLE):c.5811+13C>T rs150195182
NM_006231.3(POLE):c.5811+16T>C rs115381003
NM_006231.3(POLE):c.5811+3_5811+4dup rs1565929922
NM_006231.3(POLE):c.5811+5G>A rs562946055
NM_006231.3(POLE):c.5811+6C>T
NM_006231.3(POLE):c.5811+7G>A rs1428729186
NM_006231.3(POLE):c.5811G>A (p.Leu1937=) rs368174082
NM_006231.3(POLE):c.5812-11_5812-10del rs745976640
NM_006231.3(POLE):c.5812-123G>A
NM_006231.3(POLE):c.5812-19G>A rs1057524156
NM_006231.3(POLE):c.5812-21G>A
NM_006231.3(POLE):c.5812-4A>G rs377036606
NM_006231.3(POLE):c.5812-95A>G
NM_006231.3(POLE):c.5813A>C (p.Gln1938Pro)
NM_006231.3(POLE):c.5829_5830del (p.Gly1945fs) rs878854885
NM_006231.3(POLE):c.5834G>A (p.Gly1945Glu)
NM_006231.3(POLE):c.5836G>A (p.Ala1946Thr) rs772611021
NM_006231.3(POLE):c.5839G>A (p.Glu1947Lys) rs1382652919
NM_006231.3(POLE):c.5840_5841delAG rs1565928712
NM_006231.3(POLE):c.5843A>G (p.Asp1948Gly)
NM_006231.3(POLE):c.5845G>A (p.Glu1949Lys) rs779394509
NM_006231.3(POLE):c.5848_5868dup (p.Gln1950_Glu1956dup) rs1302016488
NM_006231.3(POLE):c.5851G>A (p.Glu1951Lys)
NM_006231.3(POLE):c.585G>C (p.Leu195=) rs1555229762
NM_006231.3(POLE):c.5860_5861delinsTT (p.Asp1954Phe) rs1555221216
NM_006231.3(POLE):c.5862C>T (p.Asp1954=) rs369929044
NM_006231.3(POLE):c.5863G>A (p.Asp1955Asn)
NM_006231.3(POLE):c.5863G>T (p.Asp1955Tyr)
NM_006231.3(POLE):c.5865_5885dup (p.Asp1955_Gly1961dup)
NM_006231.3(POLE):c.5866G>A (p.Glu1956Lys) rs749992643
NM_006231.3(POLE):c.5867A>T (p.Glu1956Val) rs780843358
NM_006231.3(POLE):c.5869G>C (p.Glu1957Gln)
NM_006231.3(POLE):c.5871G>A (p.Glu1957=)
NM_006231.3(POLE):c.5878G>T (p.Asp1960Tyr) rs1565928596
NM_006231.3(POLE):c.587A>G (p.Gln196Arg) rs770126315
NM_006231.3(POLE):c.5880T>C (p.Asp1960=) rs1214579062
NM_006231.3(POLE):c.5883_5885GGA[3] (p.Glu1966del) rs757774039
NM_006231.3(POLE):c.5888_5914dup (p.Glu1963_Asn1971dup) rs778066364
NM_006231.3(POLE):c.5889G>A (p.Glu1963=) rs1555221209
NM_006231.3(POLE):c.5889_5894delGGAGGA rs757774039
NM_006231.3(POLE):c.588G>T (p.Gln196His) rs878854886
NM_006231.3(POLE):c.5898G>A (p.Glu1966=) rs372044043
NM_006231.3(POLE):c.58A>C (p.Ser20Arg)
NM_006231.3(POLE):c.58A>G (p.Ser20Gly)
NM_006231.3(POLE):c.5900C>T (p.Ala1967Val) rs201273415
NM_006231.3(POLE):c.5901G>A (p.Ala1967=) rs200474862
NM_006231.3(POLE):c.5901_5903GGA[3] (p.Glu1969dup) rs754275919
NM_006231.3(POLE):c.5907A>C (p.Glu1969Asp)
NM_006231.3(POLE):c.5907A>G (p.Glu1969=) rs1060504069
NM_006231.3(POLE):c.5909C>T (p.Ser1970Phe)
NM_006231.3(POLE):c.590G>C (p.Arg197Thr) rs528361482
NM_006231.3(POLE):c.5912A>G (p.Asn1971Ser) rs772127913
NM_006231.3(POLE):c.5912_5913insAGTGGAGGAATCCAA (p.Asn1971_Val1972insLysValGluGluSer) rs878854887
NM_006231.3(POLE):c.5913C>T (p.Asn1971=) rs532175815
NM_006231.3(POLE):c.5914G>A (p.Val1972Met)
NM_006231.3(POLE):c.5916G>A (p.Val1972=) rs1060504057
NM_006231.3(POLE):c.5919G>A (p.Glu1973=) rs1555221205
NM_006231.3(POLE):c.5920G>T (p.Asp1974Tyr) rs1555221203
NM_006231.3(POLE):c.5926C>A (p.Leu1976Met) rs1555221202
NM_006231.3(POLE):c.5926_5929delinsA (p.Leu1976_Glu1977delinsLys) rs1565928471
NM_006231.3(POLE):c.5928G>A (p.Leu1976=) rs765521115
NM_006231.3(POLE):c.592G>A (p.Gly198Ser) rs1565978171
NM_006231.3(POLE):c.5932_5942del (p.Asn1978fs) rs1555221197
NM_006231.3(POLE):c.5936A>C (p.Asn1979Thr) rs775893052
NM_006231.3(POLE):c.5936A>G (p.Asn1979Ser)
NM_006231.3(POLE):c.5940G>A (p.Trp1980Ter) rs1470483579
NM_006231.3(POLE):c.5941A>G (p.Asn1981Asp)
NM_006231.3(POLE):c.5942A>G (p.Asn1981Ser) rs1565928438
NM_006231.3(POLE):c.594C>T (p.Gly198=) rs140185156
NM_006231.3(POLE):c.5957T>C (p.Leu1986Ser)
NM_006231.3(POLE):c.595G>A (p.Gly199Ser) rs776540681
NM_006231.3(POLE):c.5961A>G (p.Pro1987=) rs1555221196
NM_006231.3(POLE):c.5965del (p.Ala1989fs) rs1555221193
NM_006231.3(POLE):c.5966C>G (p.Ala1989Gly) rs745501021
NM_006231.3(POLE):c.5968G>C (p.Ala1990Pro) rs1313175914
NM_006231.3(POLE):c.596G>T (p.Gly199Val)
NM_006231.3(POLE):c.5972C>G (p.Ser1991Cys)
NM_006231.3(POLE):c.5975G>T (p.Cys1992Phe)
NM_006231.3(POLE):c.5988C>T (p.Phe1996=) rs756828876
NM_006231.3(POLE):c.5989C>T (p.Leu1997Phe)
NM_006231.3(POLE):c.5C>T (p.Ser2Phe) rs1060500890
NM_006231.3(POLE):c.6000T>A (p.Val2000=) rs746483776
NM_006231.3(POLE):c.6002C>G (p.Ser2001Ter) rs1565928374
NM_006231.3(POLE):c.6004+10G>A rs935178604
NM_006231.3(POLE):c.6004+11A>G rs201591857
NM_006231.3(POLE):c.6004+5G>T rs372169366
NM_006231.3(POLE):c.6005-10C>G rs1555221024
NM_006231.3(POLE):c.6005-12G>A
NM_006231.3(POLE):c.6005-13T>C rs1555221027
NM_006231.3(POLE):c.6005-212A>G
NM_006231.3(POLE):c.6005-3C>T rs1555221015
NM_006231.3(POLE):c.6005C>T (p.Ala2002Val) rs1247397969
NM_006231.3(POLE):c.6006G>A (p.Ala2002=) rs146902214
NM_006231.3(POLE):c.600C>T (p.Val200=) rs878854888
NM_006231.3(POLE):c.6012C>T (p.Ile2004=) rs147806951
NM_006231.3(POLE):c.6013G>A (p.Val2005Met) rs1060500812
NM_006231.3(POLE):c.6013G>T (p.Val2005Leu) rs1060500812
NM_006231.3(POLE):c.6016G>T (p.Ala2006Ser) rs1328375671
NM_006231.3(POLE):c.6017C>T (p.Ala2006Val) rs746545942
NM_006231.3(POLE):c.6018C>T (p.Ala2006=) rs111709550
NM_006231.3(POLE):c.6019G>A (p.Val2007Met) rs748106601
NM_006231.3(POLE):c.6019G>C (p.Val2007Leu) rs748106601
NM_006231.3(POLE):c.6021G>T (p.Val2007=) rs1057522175
NM_006231.3(POLE):c.6023del (p.Tyr2008fs)
NM_006231.3(POLE):c.6026A>G (p.His2009Arg)
NM_006231.3(POLE):c.6026del (p.His2009fs) rs1565927314
NM_006231.3(POLE):c.6029G>A (p.Cys2010Tyr) rs1471000462
NM_006231.3(POLE):c.602T>C (p.Ile201Thr) rs375209004
NM_006231.3(POLE):c.6030C>T (p.Cys2010=) rs1555220994
NM_006231.3(POLE):c.6033G>A (p.Met2011Ile) rs754773239
NM_006231.3(POLE):c.6039C>T (p.Asp2013=) rs371563366
NM_006231.3(POLE):c.6040G>A (p.Gly2014Arg) rs767749736
NM_006231.3(POLE):c.6040G>T (p.Gly2014Trp) rs767749736
NM_006231.3(POLE):c.6041G>A (p.Gly2014Glu)
NM_006231.3(POLE):c.6045G>A (p.Leu2015=) rs764220093
NM_006231.3(POLE):c.6049C>T (p.Arg2017Cys) rs115452769
NM_006231.3(POLE):c.604A>G (p.Thr202Ala)
NM_006231.3(POLE):c.6050G>A (p.Arg2017His) rs144178150
NM_006231.3(POLE):c.6051C>T (p.Arg2017=) rs1279337096
NM_006231.3(POLE):c.6053G>A (p.Ser2018Asn)
NM_006231.3(POLE):c.6057T>C (p.Ala2019=) rs1057522647
NM_006231.3(POLE):c.605_606delinsTC (p.Thr202Ile)
NM_006231.3(POLE):c.6063G>A (p.Gly2021=) rs1255778142
NM_006231.3(POLE):c.6065G>A (p.Ser2022Asn) rs905858506
NM_006231.3(POLE):c.6067A>G (p.Thr2023Ala)
NM_006231.3(POLE):c.6068C>A (p.Thr2023Asn) rs771628123
NM_006231.3(POLE):c.6068C>T (p.Thr2023Ile) rs771628123
NM_006231.3(POLE):c.6069C>A (p.Thr2023=) rs747547378
NM_006231.3(POLE):c.606T>C (p.Thr202=) rs1555229741
NM_006231.3(POLE):c.6072C>T (p.Pro2024=) rs768531930
NM_006231.3(POLE):c.6072del (p.Pro2024_Val2025insTer) rs754630848
NM_006231.3(POLE):c.6073G>A (p.Val2025Met) rs995579204
NM_006231.3(POLE):c.6082A>G (p.Arg2028Gly)
NM_006231.3(POLE):c.6083G>C (p.Arg2028Thr) rs749132017
NM_006231.3(POLE):c.6086G>A (p.Gly2029Glu) rs879254239
NM_006231.3(POLE):c.6088del (p.Ala2030fs) rs1060500809
NM_006231.3(POLE):c.6089_6090delinsG (p.Ala2030fs) rs1555220965
NM_006231.3(POLE):c.6093C>T (p.Ser2031=) rs934958443
NM_006231.3(POLE):c.6097C>G (p.Leu2033Val)
NM_006231.3(POLE):c.609T>C (p.Asp203=) rs1057522410
NM_006231.3(POLE):c.6100_6101dup
NM_006231.3(POLE):c.6101C>T (p.Ser2034Phe) rs1060500834
NM_006231.3(POLE):c.6103C>T (p.Gln2035Ter)
NM_006231.3(POLE):c.6106G>A (p.Glu2036Lys) rs1565927123
NM_006231.3(POLE):c.6107A>G (p.Glu2036Gly) rs751818136
NM_006231.3(POLE):c.6107A>T (p.Glu2036Val) rs751818136
NM_006231.3(POLE):c.6111C>T (p.Ala2037=) rs541439106
NM_006231.3(POLE):c.6112G>A (p.Glu2038Lys) rs181570274
NM_006231.3(POLE):c.6116G>A (p.Gly2039Glu) rs1555220961
NM_006231.3(POLE):c.6119C>T (p.Ala2040Val) rs5745021
NM_006231.3(POLE):c.6120G>A (p.Ala2040=) rs777260502
NM_006231.3(POLE):c.6120G>T (p.Ala2040=) rs777260502
NM_006231.3(POLE):c.6123C>T (p.Val2041=) rs754324470
NM_006231.3(POLE):c.6124G>A (p.Gly2042Arg) rs147954675
NM_006231.3(POLE):c.6130C>T (p.Leu2044Phe) rs1060500801
NM_006231.3(POLE):c.6133C>G (p.Pro2045Ala) rs910631094
NM_006231.3(POLE):c.6134C>G (p.Pro2045Arg) rs1555220951
NM_006231.3(POLE):c.6135C>T (p.Pro2045=) rs368662693
NM_006231.3(POLE):c.6136+1G>T
NM_006231.3(POLE):c.6136+20T>A rs932585832
NM_006231.3(POLE):c.6136+5G>A rs1555220949
NM_006231.3(POLE):c.6136+6C>T
NM_006231.3(POLE):c.6136G>A (p.Gly2046Arg) rs1462887616
NM_006231.3(POLE):c.6137-10A>G rs754412395
NM_006231.3(POLE):c.6137-19A>T rs1057524544
NM_006231.3(POLE):c.6137-7C>T rs1057523210
NM_006231.3(POLE):c.6140T>G (p.Met2047Arg) rs1060500829
NM_006231.3(POLE):c.6145A>G (p.Thr2049Ala)
NM_006231.3(POLE):c.6146C>A (p.Thr2049Asn) rs1315503524
NM_006231.3(POLE):c.6148T>C (p.Phe2050Leu)
NM_006231.3(POLE):c.6150C>T (p.Phe2050=) rs1555220911
NM_006231.3(POLE):c.6156G>A (p.Gln2052=) rs149841283
NM_006231.3(POLE):c.6161A>C (p.Tyr2054Ser)
NM_006231.3(POLE):c.6162T>C (p.Tyr2054=) rs1057523175
NM_006231.3(POLE):c.6165C>T (p.Val2055=) rs1035847971
NM_006231.3(POLE):c.6166G>A (p.Ala2056Thr) rs58916399
NM_006231.3(POLE):c.6166G>T (p.Ala2056Ser)
NM_006231.3(POLE):c.6173A>G (p.Glu2058Gly)
NM_006231.3(POLE):c.6177C>T (p.Leu2059=) rs1565926820
NM_006231.3(POLE):c.6179C>A (p.Thr2060Asn) rs761423995
NM_006231.3(POLE):c.6179C>G (p.Thr2060Ser)
NM_006231.3(POLE):c.6188T>G (p.Phe2063Cys) rs1410600023
NM_006231.3(POLE):c.6192C>T (p.Phe2064=) rs1555220905
NM_006231.3(POLE):c.6195C>T (p.Thr2065=) rs1060504051
NM_006231.3(POLE):c.62+10_62+11delinsTT rs878854889
NM_006231.3(POLE):c.62+13_62+15delinsTTT rs1064795897
NM_006231.3(POLE):c.62+15C>T rs2075784
NM_006231.3(POLE):c.62+1G>C rs1565986506
NM_006231.3(POLE):c.62+3G>A
NM_006231.3(POLE):c.62+5G>A rs1037695225
NM_006231.3(POLE):c.62+6G>A rs1060500861
NM_006231.3(POLE):c.62+97T>G
NM_006231.3(POLE):c.62+9C>T rs878854890
NM_006231.3(POLE):c.6201T>C (p.Thr2067=) rs983980599
NM_006231.3(POLE):c.6205A>G (p.Lys2069Glu) rs1555220903
NM_006231.3(POLE):c.6207G>T (p.Lys2069Asn)
NM_006231.3(POLE):c.6208A>G (p.Ile2070Val) rs763607284
NM_006231.3(POLE):c.620C>G (p.Thr207Ser) rs748503586
NM_006231.3(POLE):c.6210T>A (p.Ile2070=) rs139990705
NM_006231.3(POLE):c.6216G>A (p.Lys2072=) rs769908943
NM_006231.3(POLE):c.6223A>G (p.Thr2075Ala) rs1326812680
NM_006231.3(POLE):c.6224C>T (p.Thr2075Ile)
NM_006231.3(POLE):c.6232C>T (p.Arg2078Trp) rs1060500867
NM_006231.3(POLE):c.6233G>A (p.Arg2078Gln) rs745721448
NM_006231.3(POLE):c.6236_6254del (p.Asn2079fs) rs765923256
NM_006231.3(POLE):c.6244G>A (p.Glu2082Lys) rs1285938402
NM_006231.3(POLE):c.6244_6248del (p.Glu2082fs) rs1555220891
NM_006231.3(POLE):c.6246G>A (p.Glu2082=) rs772402355
NM_006231.3(POLE):c.6247C>T (p.Leu2083Phe)
NM_006231.3(POLE):c.6251_6252inv (p.Ser2084Leu)
NM_006231.3(POLE):c.6252A>G (p.Ser2084=) rs5745022
NM_006231.3(POLE):c.6255G>A (p.Glu2085=) rs1057524260
NM_006231.3(POLE):c.6257T>C (p.Met2086Thr) rs528752399
NM_006231.3(POLE):c.6258G>A (p.Met2086Ile) rs1565926679
NM_006231.3(POLE):c.625A>C (p.Lys209Gln) rs1555229720
NM_006231.3(POLE):c.6262C>T (p.Pro2088Ser) rs749342382
NM_006231.3(POLE):c.6271C>T (p.Pro2091Ser) rs572252265
NM_006231.3(POLE):c.6272C>T (p.Pro2091Leu) rs376093362
NM_006231.3(POLE):c.6273C>T (p.Pro2091=) rs767769851
NM_006231.3(POLE):c.6273_6280del (p.Gly2092fs)
NM_006231.3(POLE):c.6274G>A (p.Gly2092Ser) rs757559474
NM_006231.3(POLE):c.6278C>T (p.Ser2093Phe)
NM_006231.3(POLE):c.6280C>G (p.His2094Asp)
NM_006231.3(POLE):c.6286C>G (p.Leu2096Val) rs1049603207
NM_006231.3(POLE):c.6287T>G (p.Leu2096Arg)
NM_006231.3(POLE):c.6290T>C (p.Leu2097Pro) rs932532496
NM_006231.3(POLE):c.6298C>G (p.Pro2100Ala) rs562071800
NM_006231.3(POLE):c.6299C>G (p.Pro2100Arg) rs1060500780
NM_006231.3(POLE):c.629A>G (p.Lys210Arg) rs765826619
NM_006231.3(POLE):c.63-139_63-135del
NM_006231.3(POLE):c.63-14C>T rs373998767
NM_006231.3(POLE):c.63-223G>A
NM_006231.3(POLE):c.63-?_1794+?dup1732
NM_006231.3(POLE):c.6301G>A (p.Ala2101Thr) rs1395533975
NM_006231.3(POLE):c.6301G>T (p.Ala2101Ser) rs1395533975
NM_006231.3(POLE):c.6303C>G (p.Ala2101=) rs751217923
NM_006231.3(POLE):c.6308A>C (p.Glu2103Ala) rs1555220870
NM_006231.3(POLE):c.6312C>A (p.Phe2104Leu)
NM_006231.3(POLE):c.6312C>G (p.Phe2104Leu) rs1555220869
NM_006231.3(POLE):c.6313A>G (p.Ile2105Val) rs1555220868
NM_006231.3(POLE):c.6315C>G (p.Ile2105Met)
NM_006231.3(POLE):c.6317A>G (p.Lys2106Arg) rs762471347
NM_006231.3(POLE):c.631A>T (p.Ile211Leu) rs1064796126
NM_006231.3(POLE):c.6321C>T (p.Tyr2107=) rs201656807
NM_006231.3(POLE):c.6322G>A (p.Val2108Met) rs776551240
NM_006231.3(POLE):c.6322G>T (p.Val2108Leu) rs776551240
NM_006231.3(POLE):c.6327C>T (p.Cys2109=) rs371146029
NM_006231.3(POLE):c.6328A>C (p.Lys2110Gln)
NM_006231.3(POLE):c.6328A>G (p.Lys2110Glu) rs746736600
NM_006231.3(POLE):c.632T>C (p.Ile211Thr) rs1555229716
NM_006231.3(POLE):c.6330+15G>A rs5745023
NM_006231.3(POLE):c.6330+18C>T rs5745024
NM_006231.3(POLE):c.6330+19G>A rs5745025
NM_006231.3(POLE):c.6330+1G>A
NM_006231.3(POLE):c.6330+209A>G
NM_006231.3(POLE):c.6330+8T>G rs1060504047
NM_006231.3(POLE):c.6331-3C>T rs1332510248
NM_006231.3(POLE):c.6331-8C>T rs769766403
NM_006231.3(POLE):c.6334C>G (p.Leu2112Val) rs373443211
NM_006231.3(POLE):c.6334C>T (p.Leu2112=) rs373443211
NM_006231.3(POLE):c.6335T>C (p.Leu2112Pro)
NM_006231.3(POLE):c.6339C>T (p.Ser2113=) rs781680187
NM_006231.3(POLE):c.6340C>T (p.Leu2114=) rs1165241306
NM_006231.3(POLE):c.6344A>G (p.Asp2115Gly) rs1555301272
NM_006231.3(POLE):c.6346A>C (p.Thr2116Pro) rs1035102321
NM_006231.3(POLE):c.6348C>G (p.Thr2116=) rs1555301270
NM_006231.3(POLE):c.6349A>G (p.Asn2117Asp) rs1555301269
NM_006231.3(POLE):c.6350A>G (p.Asn2117Ser)
NM_006231.3(POLE):c.6351C>T (p.Asn2117=) rs1555301264
NM_006231.3(POLE):c.6354C>T (p.Ile2118=) rs547872135
NM_006231.3(POLE):c.6361C>G (p.Gln2121Glu) rs1555301259
NM_006231.3(POLE):c.6363G>A (p.Gln2121=) rs1057522074
NM_006231.3(POLE):c.6372G>T (p.Lys2124Asn) rs1555301255
NM_006231.3(POLE):c.6379C>G (p.Arg2127Gly)
NM_006231.3(POLE):c.6379C>T (p.Arg2127Ter) rs1057517583
NM_006231.3(POLE):c.6380G>A (p.Arg2127Gln)
NM_006231.3(POLE):c.6382G>T (p.Asp2128Tyr)
NM_006231.3(POLE):c.6384C>A (p.Asp2128Glu) rs758101414
NM_006231.3(POLE):c.6385C>T (p.Leu2129=) rs752303205
NM_006231.3(POLE):c.6391C>T (p.Arg2131Cys) rs369748519
NM_006231.3(POLE):c.6392G>A (p.Arg2131His) rs141954509
NM_006231.3(POLE):c.6392G>T (p.Arg2131Leu) rs141954509
NM_006231.3(POLE):c.6403G>T (p.Val2135Phe) rs878854891
NM_006231.3(POLE):c.6405C>T (p.Val2135=) rs139607077
NM_006231.3(POLE):c.6406G>A (p.Gly2136Ser) rs1368640639
NM_006231.3(POLE):c.6408C>T (p.Gly2136=) rs1057524549
NM_006231.3(POLE):c.6409G>A (p.Glu2137Lys) rs879783561
NM_006231.3(POLE):c.6411G>A (p.Glu2137=) rs753344188
NM_006231.3(POLE):c.6411G>T (p.Glu2137Asp)
NM_006231.3(POLE):c.6414C>G (p.Phe2138Leu) rs969557653
NM_006231.3(POLE):c.6417C>T (p.Ser2139=) rs766935890
NM_006231.3(POLE):c.6418G>A (p.Glu2140Lys) rs5745066
NM_006231.3(POLE):c.6418del (p.Glu2140fs) rs1064794703
NM_006231.3(POLE):c.641A>G (p.Gln214Arg) rs1555229713
NM_006231.3(POLE):c.6422_6423delinsCC (p.Glu2141Ala) rs878854892
NM_006231.3(POLE):c.6423G>A (p.Glu2141=) rs1158336340
NM_006231.3(POLE):c.6424G>A (p.Ala2142Thr)
NM_006231.3(POLE):c.6427C>A (p.Gln2143Lys) rs1566309175
NM_006231.3(POLE):c.6428A>G (p.Gln2143Arg)
NM_006231.3(POLE):c.6432C>T (p.Phe2144=) rs775605353
NM_006231.3(POLE):c.6433C>T (p.Arg2145Ter) rs1451513451
NM_006231.3(POLE):c.6434G>A (p.Arg2145Gln) rs770009143
NM_006231.3(POLE):c.6434_6438del (p.Arg2145fs) rs1555301223
NM_006231.3(POLE):c.6438C>T (p.Asp2146=) rs1555301220
NM_006231.3(POLE):c.6439C>G (p.Pro2147Ala)
NM_006231.3(POLE):c.6440C>T (p.Pro2147Leu) rs1555301218
NM_006231.3(POLE):c.6441C>T (p.Pro2147=) rs1555301216
NM_006231.3(POLE):c.6445C>T (p.Arg2149Cys) rs771490182
NM_006231.3(POLE):c.6446G>A (p.Arg2149His) rs201165149
NM_006231.3(POLE):c.6446G>T (p.Arg2149Leu) rs201165149
NM_006231.3(POLE):c.6448T>C (p.Ser2150Pro)
NM_006231.3(POLE):c.6449C>A (p.Ser2150Tyr)
NM_006231.3(POLE):c.6451T>A (p.Tyr2151Asn)
NM_006231.3(POLE):c.6453C>T (p.Tyr2151=) rs116076060
NM_006231.3(POLE):c.6454G>A (p.Val2152Met) rs138789360
NM_006231.3(POLE):c.6454G>T (p.Val2152Leu) rs138789360
NM_006231.3(POLE):c.6457del (p.Leu2153fs) rs1064794611
NM_006231.3(POLE):c.6460C>T (p.Pro2154Ser)
NM_006231.3(POLE):c.6466G>A (p.Val2156Ile) rs542978638
NM_006231.3(POLE):c.6470T>C (p.Ile2157Thr) rs1566309064
NM_006231.3(POLE):c.6471C>T (p.Ile2157=) rs1478004242
NM_006231.3(POLE):c.6475C>T (p.Arg2159Cys) rs5745067
NM_006231.3(POLE):c.6476G>A (p.Arg2159His) rs373092830
NM_006231.3(POLE):c.6489C>G (p.Phe2163Leu) rs1566309041
NM_006231.3(POLE):c.6491G>A (p.Cys2164Tyr) rs750401329
NM_006231.3(POLE):c.6493C>T (p.Arg2165Cys) rs369549727
NM_006231.3(POLE):c.6494G>A (p.Arg2165His) rs5745068
NM_006231.3(POLE):c.6495C>T (p.Arg2165=) rs114778730
NM_006231.3(POLE):c.6496G>A (p.Asp2166Asn)
NM_006231.3(POLE):c.6498C>A (p.Asp2166Glu)
NM_006231.3(POLE):c.6505C>T (p.Leu2169=) rs878854893
NM_006231.3(POLE):c.6507G>A (p.Leu2169=) rs375256819
NM_006231.3(POLE):c.6507G>T (p.Leu2169=) rs375256819
NM_006231.3(POLE):c.6508T>C (p.Cys2170Arg) rs138094751
NM_006231.3(POLE):c.6511A>G (p.Lys2171Glu)
NM_006231.3(POLE):c.6518C>T (p.Ser2173Phe) rs1555301181
NM_006231.3(POLE):c.6518_6519delCT rs774417192
NM_006231.3(POLE):c.6521C>T (p.Ser2174Phe) rs1555301177
NM_006231.3(POLE):c.6522C>T (p.Ser2174=) rs1555301175
NM_006231.3(POLE):c.652A>G (p.Ile218Val) rs1319446692
NM_006231.3(POLE):c.6531+12C>T rs1041511996
NM_006231.3(POLE):c.6531+15C>T rs1057523088
NM_006231.3(POLE):c.6531+18C>T
NM_006231.3(POLE):c.6531+4C>T rs772586175
NM_006231.3(POLE):c.6531+5G>A rs368538240
NM_006231.3(POLE):c.6531+6G>T rs774747998
NM_006231.3(POLE):c.6532-11G>C rs372829291
NM_006231.3(POLE):c.6532-14C>G rs1483343976
NM_006231.3(POLE):c.6532-19G>T rs201114228
NM_006231.3(POLE):c.6532-20C>T rs367726448
NM_006231.3(POLE):c.6532-21_6532-20del rs1555301127
NM_006231.3(POLE):c.6532-4C>G
NM_006231.3(POLE):c.6536_6537delinsCT (p.Gly2179Ala) rs1060500789
NM_006231.3(POLE):c.6537G>A (p.Gly2179=) rs745411511
NM_006231.3(POLE):c.6537_6541del (p.Ala2180fs) rs879254107
NM_006231.3(POLE):c.6539C>T (p.Ala2180Val) rs552452448
NM_006231.3(POLE):c.6540G>A (p.Ala2180=) rs746976542
NM_006231.3(POLE):c.6544C>T (p.Leu2182=) rs1555301108
NM_006231.3(POLE):c.6547C>T (p.Pro2183Ser) rs777503236
NM_006231.3(POLE):c.654T>C (p.Ile218=) rs1555229709
NM_006231.3(POLE):c.6551A>G (p.Gln2184Arg) rs878854894
NM_006231.3(POLE):c.6552G>A (p.Gln2184=) rs758217788
NM_006231.3(POLE):c.6553T>C (p.Trp2185Arg)
NM_006231.3(POLE):c.6555G>T (p.Trp2185Cys)
NM_006231.3(POLE):c.6563C>G (p.Ser2188Cys) rs780307061
NM_006231.3(POLE):c.6563C>T (p.Ser2188Phe)
NM_006231.3(POLE):c.6565A>T (p.Asn2189Tyr) rs150345709
NM_006231.3(POLE):c.6575C>T (p.Ala2192Val) rs756301031
NM_006231.3(POLE):c.6576G>A (p.Ala2192=) rs368555884
NM_006231.3(POLE):c.6581A>G (p.Tyr2194Cys) rs1060500872
NM_006231.3(POLE):c.6581A>T (p.Tyr2194Phe)
NM_006231.3(POLE):c.6583G>A (p.Asp2195Asn) rs1472336573
NM_006231.3(POLE):c.6585_6587CTC[1] (p.Ser2197del) rs1188033351
NM_006231.3(POLE):c.658G>A (p.Asp220Asn) rs1060500824
NM_006231.3(POLE):c.6590C>T (p.Ser2197Phe) rs1489412079
NM_006231.3(POLE):c.6593C>A (p.Ala2198Asp) rs1555301083
NM_006231.3(POLE):c.6597C>A (p.Ile2199=) rs147611144
NM_006231.3(POLE):c.6597C>T (p.Ile2199=) rs147611144
NM_006231.3(POLE):c.6598G>A (p.Glu2200Lys) rs752113614
NM_006231.3(POLE):c.65A>T (p.Asp22Val) rs1060500864
NM_006231.3(POLE):c.6601A>G (p.Met2201Val) rs878854895
NM_006231.3(POLE):c.6605C>T (p.Thr2202Met) rs764457707
NM_006231.3(POLE):c.6606G>A (p.Thr2202=) rs11146982
NM_006231.3(POLE):c.6610G>A (p.Val2204Met)
NM_006231.3(POLE):c.6610G>T (p.Val2204Leu) rs1060500871
NM_006231.3(POLE):c.6613G>A (p.Glu2205Lys)
NM_006231.3(POLE):c.6623del (p.Gln2208fs) rs1555301070
NM_006231.3(POLE):c.6628A>C (p.Lys2210Gln) rs1284697545
NM_006231.3(POLE):c.662T>C (p.Met221Thr) rs755607944
NM_006231.3(POLE):c.6630G>A (p.Lys2210=) rs1555301066
NM_006231.3(POLE):c.6631C>T (p.Leu2211=) rs769635764
NM_006231.3(POLE):c.6632T>C (p.Leu2211Pro) rs1060500848
NM_006231.3(POLE):c.6639C>G (p.Ala2213=) rs1060504064
NM_006231.3(POLE):c.663G>T (p.Met221Ile)
NM_006231.3(POLE):c.663dup (p.Arg222fs) rs1555229694
NM_006231.3(POLE):c.6648G>A (p.Leu2216=) rs1555301052
NM_006231.3(POLE):c.664C>A (p.Arg222Ser)
NM_006231.3(POLE):c.664C>G (p.Arg222Gly) rs767503360
NM_006231.3(POLE):c.664C>T (p.Arg222Cys)
NM_006231.3(POLE):c.6651G>A (p.Gln2217=)
NM_006231.3(POLE):c.6651_6657+6delinsTGC rs1566308356
NM_006231.3(POLE):c.6655C>G (p.Leu2219Val)
NM_006231.3(POLE):c.6657+16C>T rs5745075
NM_006231.3(POLE):c.6657+7C>G rs746459362
NM_006231.3(POLE):c.6657+7C>T rs746459362
NM_006231.3(POLE):c.6657+8G>A rs777791883
NM_006231.3(POLE):c.6657+9T>C rs375333174
NM_006231.3(POLE):c.6658-12G>C rs1555300850
NM_006231.3(POLE):c.6658-19C>G rs5745081
NM_006231.3(POLE):c.6658-19C>T rs5745081
NM_006231.3(POLE):c.6658-1G>A rs1555300846
NM_006231.3(POLE):c.6658-200C>T
NM_006231.3(POLE):c.6658-2A>G
NM_006231.3(POLE):c.6658-7C>A rs531482240
NM_006231.3(POLE):c.6658-88G>A
NM_006231.3(POLE):c.6658G>A (p.Val2220Ile)
NM_006231.3(POLE):c.6658G>T (p.Val2220Phe) rs1060500804
NM_006231.3(POLE):c.665G>A (p.Arg222His) rs1060500862
NM_006231.3(POLE):c.6664C>G (p.Leu2222Val)
NM_006231.3(POLE):c.6664C>T (p.Leu2222=) rs1160915539
NM_006231.3(POLE):c.6665T>C (p.Leu2222Pro) rs1566307264
NM_006231.3(POLE):c.6666G>A (p.Leu2222=) rs777438368
NM_006231.3(POLE):c.6666G>C (p.Leu2222=) rs777438368
NM_006231.3(POLE):c.6668A>G (p.Lys2223Arg) rs367970442
NM_006231.3(POLE):c.666C>T (p.Arg222=) rs1357052511
NM_006231.3(POLE):c.6673C>T (p.Arg2225Cys) rs765125852
NM_006231.3(POLE):c.6674G>A (p.Arg2225His) rs538875477
NM_006231.3(POLE):c.6675C>G (p.Arg2225=) rs149973644
NM_006231.3(POLE):c.6675C>T (p.Arg2225=) rs149973644
NM_006231.3(POLE):c.6676G>A (p.Gly2226Arg) rs766291093
NM_006231.3(POLE):c.6678G>A (p.Gly2226=) rs1162754521
NM_006231.3(POLE):c.6679G>T (p.Val2227Leu) rs1060500843
NM_006231.3(POLE):c.667G>A (p.Glu223Lys) rs761757009
NM_006231.3(POLE):c.667_693del (p.Glu223_Arg231del) rs1272503308
NM_006231.3(POLE):c.6682_6684del (p.Lys2228del) rs878854896
NM_006231.3(POLE):c.6693C>T (p.Ser2231=) rs1483311551
NM_006231.3(POLE):c.6694A>G (p.Met2232Val)
NM_006231.3(POLE):c.6699T>C (p.Pro2233=) rs1057521409
NM_006231.3(POLE):c.669G>A (p.Glu223=) rs1035981192
NM_006231.3(POLE):c.6707G>C (p.Cys2236Ser)
NM_006231.3(POLE):c.6713G>A (p.Cys2238Tyr) rs1555300810
NM_006231.3(POLE):c.6714C>G (p.Cys2238Trp)
NM_006231.3(POLE):c.6714C>T (p.Cys2238=) rs200082120
NM_006231.3(POLE):c.6716C>T (p.Ala2239Val) rs190813054
NM_006231.3(POLE):c.6726C>T (p.Phe2242=) rs771312122
NM_006231.3(POLE):c.6727G>A (p.Ala2243Thr) rs747349009
NM_006231.3(POLE):c.672C>T (p.Tyr224=) rs376923206
NM_006231.3(POLE):c.6730C>T (p.Leu2244Phe) rs375741031
NM_006231.3(POLE):c.6734C>G (p.Thr2245Ser) rs747676884
NM_006231.3(POLE):c.673G>A (p.Asp225Asn) rs1166189035
NM_006231.3(POLE):c.6741C>T (p.His2247=) rs1414304090
NM_006231.3(POLE):c.6747+11_6747+14delCCTC rs1555300789
NM_006231.3(POLE):c.6747+2T>G rs1566307058
NM_006231.3(POLE):c.6747+4G>C
NM_006231.3(POLE):c.6747+5G>A rs1555300791
NM_006231.3(POLE):c.6748-11T>A rs552311764
NM_006231.3(POLE):c.6748G>C (p.Val2250Leu) rs756931710
NM_006231.3(POLE):c.6751T>C (p.Phe2251Leu) rs373768478
NM_006231.3(POLE):c.6754A>G (p.Met2252Val) rs759660507
NM_006231.3(POLE):c.6757G>A (p.Glu2253Lys)
NM_006231.3(POLE):c.6757G>C (p.Glu2253Gln) rs376140352
NM_006231.3(POLE):c.675T>C (p.Asp225=) rs1446922286
NM_006231.3(POLE):c.6761A>C (p.Gln2254Pro) rs1555300757
NM_006231.3(POLE):c.6762G>T (p.Gln2254His)
NM_006231.3(POLE):c.6763A>G (p.Ile2255Val) rs73155056
NM_006231.3(POLE):c.6763A>T (p.Ile2255Phe) rs73155056
NM_006231.3(POLE):c.6765C>G (p.Ile2255Met)
NM_006231.3(POLE):c.6765C>T (p.Ile2255=) rs376336585
NM_006231.3(POLE):c.6766G>A (p.Gly2256Arg) rs116323660
NM_006231.3(POLE):c.6767G>C (p.Gly2256Ala) rs749707316
NM_006231.3(POLE):c.6769A>C (p.Ile2257Leu) rs1566306858
NM_006231.3(POLE):c.6775C>T (p.Arg2259Trp) rs866548835
NM_006231.3(POLE):c.6776G>A (p.Arg2259Gln) rs762044635
NM_006231.3(POLE):c.6777G>C (p.Arg2259=) rs540203276
NM_006231.3(POLE):c.6777G>T (p.Arg2259=) rs540203276
NM_006231.3(POLE):c.6787C>T (p.Gln2263Ter) rs1060500830
NM_006231.3(POLE):c.6790C>A (p.His2264Asn) rs1555300733
NM_006231.3(POLE):c.6792C>G (p.His2264Gln)
NM_006231.3(POLE):c.6795C>T (p.Tyr2265=) rs142222159
NM_006231.3(POLE):c.6796G>A (p.Gly2266Ser) rs200911338
NM_006231.3(POLE):c.6801G>C (p.Met2267Ile) rs1555300726
NM_006231.3(POLE):c.6803C>T (p.Ser2268Leu) rs373791036
NM_006231.3(POLE):c.6804G>A (p.Ser2268=) rs544223319
NM_006231.3(POLE):c.680C>T (p.Pro227Leu) rs1060500784
NM_006231.3(POLE):c.6810C>T (p.Leu2270=) rs757092767
NM_006231.3(POLE):c.6817A>T (p.Thr2273Ser) rs73481453
NM_006231.3(POLE):c.6818C>T (p.Thr2273Ile) rs779145729
NM_006231.3(POLE):c.6820C>G (p.Leu2274Val) rs148788180
NM_006231.3(POLE):c.6831G>T (p.Leu2277=) rs145427269
NM_006231.3(POLE):c.6835C>T (p.Gln2279Ter) rs1555300713
NM_006231.3(POLE):c.6837G>A (p.Gln2279=) rs1195523886
NM_006231.3(POLE):c.683A>G (p.Tyr228Cys) rs1555229669
NM_006231.3(POLE):c.6842A>C (p.Asn2281Thr)
NM_006231.3(POLE):c.6844C>A (p.Pro2282Thr) rs760606145
NM_006231.3(POLE):c.6845C>T (p.Pro2282Leu) rs1555300711
NM_006231.3(POLE):c.6846A>C (p.Pro2282=) rs1369939692
NM_006231.3(POLE):c.6847C>G (p.Gln2283Glu) rs1267521228
NM_006231.3(POLE):c.6847C>T (p.Gln2283Ter) rs1267521228
NM_006231.3(POLE):c.6850C>A (p.Leu2284Met) rs1566306728
NM_006231.3(POLE):c.6851T>A (p.Leu2284Gln) rs1555300706
NM_006231.3(POLE):c.6853G>T (p.Gly2285Cys)
NM_006231.3(POLE):c.6854G>A (p.Gly2285Asp) rs1060500879
NM_006231.3(POLE):c.687C>T (p.His229=) rs770920362
NM_006231.3(POLE):c.688A>G (p.Ile230Val) rs1555229662
NM_006231.3(POLE):c.689T>G (p.Ile230Ser) rs1401947646
NM_006231.3(POLE):c.68A>G (p.Asp23Gly) rs765898876
NM_006231.3(POLE):c.691C>T (p.Arg231Cys) rs146592584
NM_006231.3(POLE):c.692G>A (p.Arg231His) rs1060500835
NM_006231.3(POLE):c.692G>T (p.Arg231Leu)
NM_006231.3(POLE):c.695T>C (p.Leu232Pro) rs748554882
NM_006231.3(POLE):c.706C>G (p.Leu236Val)
NM_006231.3(POLE):c.710A>C (p.Lys237Thr)
NM_006231.3(POLE):c.710A>G (p.Lys237Arg) rs879762286
NM_006231.3(POLE):c.712A>T (p.Ile238Phe) rs536684123
NM_006231.3(POLE):c.717C>T (p.His239=) rs567612169
NM_006231.3(POLE):c.718G>A (p.Val240Met) rs371882716
NM_006231.3(POLE):c.718G>C (p.Val240Leu) rs371882716
NM_006231.3(POLE):c.720+16T>C rs200320553
NM_006231.3(POLE):c.720+1G>A rs1060500808
NM_006231.3(POLE):c.720+3G>A rs1555229633
NM_006231.3(POLE):c.720+4A>C
NM_006231.3(POLE):c.720+6T>C rs751448342
NM_006231.3(POLE):c.720G>A (p.Val240=)
NM_006231.3(POLE):c.721-3C>T
NM_006231.3(POLE):c.721-4G>T rs765420775
NM_006231.3(POLE):c.721-54A>G
NM_006231.3(POLE):c.721-9_721-8delGT rs752682384
NM_006231.3(POLE):c.723T>A (p.Ala241=) rs144422646
NM_006231.3(POLE):c.724C>T (p.His242Tyr) rs148525573
NM_006231.3(POLE):c.725A>G (p.His242Arg) rs767612904
NM_006231.3(POLE):c.729G>A (p.Trp243Ter) rs1565977663
NM_006231.3(POLE):c.72C>T (p.Gly24=) rs61751359
NM_006231.3(POLE):c.734A>G (p.Asn245Ser)
NM_006231.3(POLE):c.737_753delinsA (p.Val246fs) rs1064792920
NM_006231.3(POLE):c.73G>A (p.Ala25Thr) rs773204331
NM_006231.3(POLE):c.73G>T (p.Ala25Ser) rs773204331
NM_006231.3(POLE):c.745C>T (p.Arg249Ter)
NM_006231.3(POLE):c.746G>A (p.Arg249Gln) rs1331349861
NM_006231.3(POLE):c.747A>G (p.Arg249=) rs1002061657
NM_006231.3(POLE):c.74C>T (p.Ala25Val) rs561834381
NM_006231.3(POLE):c.751A>T (p.Asn251Tyr) rs1392954149
NM_006231.3(POLE):c.755C>T (p.Ala252Val) rs5744751
NM_006231.3(POLE):c.758T>C (p.Phe253Ser) rs1555229581
NM_006231.3(POLE):c.761C>T (p.Pro254Leu) rs200211438
NM_006231.3(POLE):c.762G>A (p.Pro254=) rs371334601
NM_006231.3(POLE):c.763G>A (p.Val255Ile)
NM_006231.3(POLE):c.765A>G (p.Val255=) rs898919469
NM_006231.3(POLE):c.769A>G (p.Ile257Val)
NM_006231.3(POLE):c.76A>G (p.Thr26Ala) rs182282150
NM_006231.3(POLE):c.773C>T (p.Thr258Ile)
NM_006231.3(POLE):c.774C>G (p.Thr258=) rs149345392
NM_006231.3(POLE):c.775C>T (p.Arg259Cys) rs777638541
NM_006231.3(POLE):c.776G>A (p.Arg259His) rs61732929
NM_006231.3(POLE):c.776G>T (p.Arg259Leu)
NM_006231.3(POLE):c.778C>T (p.Arg260Ter) rs747946229
NM_006231.3(POLE):c.779G>A (p.Arg260Gln) rs5744752
NM_006231.3(POLE):c.780A>C (p.Arg260=) rs1555229573
NM_006231.3(POLE):c.781G>C (p.Asp261His)
NM_006231.3(POLE):c.785A>C (p.Asp262Ala) rs1060500852
NM_006231.3(POLE):c.786C>T (p.Asp262=) rs201223598
NM_006231.3(POLE):c.78T>C (p.Thr26=) rs1192817723
NM_006231.3(POLE):c.793G>C (p.Glu265Gln) rs1565977511
NM_006231.3(POLE):c.796C>T (p.Arg266Ter) rs767666219
NM_006231.3(POLE):c.797G>A (p.Arg266Gln) rs115786159
NM_006231.3(POLE):c.797G>T (p.Arg266Leu) rs115786159
NM_006231.3(POLE):c.7C>G (p.Leu3Val) rs1018143132
NM_006231.3(POLE):c.801+18del rs780928647
NM_006231.3(POLE):c.801+4A>G rs1565977480
NM_006231.3(POLE):c.801+62C>T
NM_006231.3(POLE):c.801+78A>G
NM_006231.3(POLE):c.802-1G>C rs1555229470
NM_006231.3(POLE):c.802-3C>T
NM_006231.3(POLE):c.802-5C>A rs376302620
NM_006231.3(POLE):c.802-6C>T rs754779082
NM_006231.3(POLE):c.802-71T>C
NM_006231.3(POLE):c.802-8C>A rs1429750584
NM_006231.3(POLE):c.802-9_802-8dup rs751381655
NM_006231.3(POLE):c.805C>G (p.Pro269Ala)
NM_006231.3(POLE):c.806del (p.Pro269fs) rs1435794183
NM_006231.3(POLE):c.808G>A (p.Val270Met) rs374237142
NM_006231.3(POLE):c.80C>T (p.Ser27Phe)
NM_006231.3(POLE):c.819A>G (p.Ala273=) rs1185171180
NM_006231.3(POLE):c.823G>C (p.Asp275His) rs879254218
NM_006231.3(POLE):c.824A>G (p.Asp275Gly)