ClinVar Miner

List of variants in gene PTCH1 reported as pathogenic for Gorlin syndrome

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 106
Download table as spreadsheet
HGVS dbSNP
GRCh37/hg19 9q22.32(chr9:98207091-98210940)x1
NM_000264.3(PTCH1):c.3450-2_3483delAGGTATTTCTTTGCTGTGCTGGCGATCCTCACCATC
NM_000264.4(PTCH1):c.1348-14_1370del rs1554698613
NM_001083602.2(PTCH1):c.1000C>T (p.Gln334Ter)
NM_001083602.2(PTCH1):c.1008_1009AT[1] (p.Tyr337fs) rs1060502286
NM_001083602.2(PTCH1):c.1011T>G (p.Tyr337Ter) rs1432645175
NM_001083602.2(PTCH1):c.1018-1G>A rs1564051834
NM_001083602.2(PTCH1):c.1027C>T (p.Gln343Ter)
NM_001083602.2(PTCH1):c.1109dup (p.Asp370fs) rs1554698800
NM_001083602.2(PTCH1):c.1110del (p.Asp370fs) rs1060502295
NM_001083602.2(PTCH1):c.1124G>A (p.Arg375His) rs767273237
NM_001083602.2(PTCH1):c.1131del (p.Ser378fs) rs864622374
NM_001083602.2(PTCH1):c.1144_1147del (p.Leu382fs) rs1564051237
NM_001083602.2(PTCH1):c.1155_1158dup (p.Ala387fs) rs1564050405
NM_001083602.2(PTCH1):c.1166dup (p.Thr390fs)
NM_001083602.2(PTCH1):c.1214_1217TGGC[1] (p.Gly407fs) rs1564050178
NM_001083602.2(PTCH1):c.1287del (p.Phe429fs) rs1554698531
NM_001083602.2(PTCH1):c.1304A>G (p.Gln435Arg) rs863225054
NM_001083602.2(PTCH1):c.1328G>A (p.Gly443Asp) rs1060502268
NM_001083602.2(PTCH1):c.1385dup (p.Asn462fs) rs1554698258
NM_001083602.2(PTCH1):c.1393_1403del (p.Ile465fs) rs863225055
NM_001083602.2(PTCH1):c.1405-2A>G rs1064793921
NM_001083602.2(PTCH1):c.1417del (p.Glu473fs) rs878853847
NM_001083602.2(PTCH1):c.1427dup (p.Arg477fs)
NM_001083602.2(PTCH1):c.1453dup (p.Thr485fs) rs1554697928
NM_001083602.2(PTCH1):c.1506del (p.Ala503fs) rs776154605
NM_001083602.2(PTCH1):c.1511_1523del (p.Leu504fs) rs1554697839
NM_001083602.2(PTCH1):c.197-1G>A rs368869806
NM_001083602.2(PTCH1):c.205C>T (p.Arg69Ter) rs1131690986
NM_001083602.2(PTCH1):c.235C>T (p.Gln79Ter) rs1554702186
NM_001083602.2(PTCH1):c.2363-2A>G rs878853852
NM_001083602.2(PTCH1):c.2421C>G (p.Tyr807Ter) rs1554692291
NM_001083602.2(PTCH1):c.2441del (p.Gly814fs) rs1554692266
NM_001083602.2(PTCH1):c.250G>T (p.Glu84Ter) rs1344258746
NM_001083602.2(PTCH1):c.256_257del (p.Met86fs) rs1060502280
NM_001083602.2(PTCH1):c.2601del (p.Tyr868fs) rs863224484
NM_001083602.2(PTCH1):c.2604T>G (p.Tyr868Ter) rs1356231878
NM_001083602.2(PTCH1):c.2644_2651del (p.Trp882fs) rs863224485
NM_001083602.2(PTCH1):c.2733_2734insGTAGA (p.Leu912fs) rs1554691423
NM_001083602.2(PTCH1):c.2767G>T (p.Glu923Ter)
NM_001083602.2(PTCH1):c.2776G>T (p.Glu926Ter) rs1060502278
NM_001083602.2(PTCH1):c.2805T>A (p.Tyr935Ter) rs1060502298
NM_001083602.2(PTCH1):c.2927dup (p.Cys977fs) rs1554691354
NM_001083602.2(PTCH1):c.2954G>A (p.Trp985Ter) rs1060502301
NM_001083602.2(PTCH1):c.2970+2T>C rs786204056
NM_001083602.2(PTCH1):c.3089dup (p.Thr1031fs)
NM_001083602.2(PTCH1):c.3166_3167del (p.Met1056fs) rs1060502273
NM_001083602.2(PTCH1):c.3230_3231del (p.Gly1076_Ser1077insTer) rs1554690411
NM_001083602.2(PTCH1):c.3252-1G>A
NM_001083602.2(PTCH1):c.3252-2A>G rs863224443
NM_001083602.2(PTCH1):c.3262del (p.Ala1088fs) rs1060502264
NM_001083602.2(PTCH1):c.3290del (p.Gly1097fs) rs1564009755
NM_001083602.2(PTCH1):c.3342_3345delinsTCC (p.Tyr1115fs) rs1554689667
NM_001083602.2(PTCH1):c.3477T>A (p.Tyr1159Ter)
NM_001083602.2(PTCH1):c.381C>A (p.Tyr127Ter) rs1333346461
NM_001083602.2(PTCH1):c.387-1G>C rs1057520590
NM_001083602.2(PTCH1):c.392G>A (p.Trp131Ter) rs1064793922
NM_001083602.2(PTCH1):c.4-1649del rs751977093
NM_001083602.2(PTCH1):c.4-16_29del rs1554708795
NM_001083602.2(PTCH1):c.404del (p.His135fs) rs1554700742
NM_001083602.2(PTCH1):c.414C>G (p.Tyr138Ter) rs863224486
NM_001083602.2(PTCH1):c.417del (p.Lys139fs) rs1554700720
NM_001083602.2(PTCH1):c.429del (p.Ile144fs) rs1564058222
NM_001083602.2(PTCH1):c.454dup (p.Gln152fs) rs1564058147
NM_001083602.2(PTCH1):c.468T>A (p.Tyr156Ter) rs863224487
NM_001083602.2(PTCH1):c.510G>A (p.Trp170Ter) rs1060502287
NM_001083602.2(PTCH1):c.53_60del (p.Gln18fs)
NM_001083602.2(PTCH1):c.543C>A (p.Tyr181Ter) rs1060502281
NM_001083602.2(PTCH1):c.54_55GA[1] (p.Arg19fs) rs1554708771
NM_001083602.2(PTCH1):c.569G>A (p.Trp190Ter) rs1554700010
NM_001083602.2(PTCH1):c.570del (p.Arg189_Trp190insTer) rs1564055868
NM_001083602.2(PTCH1):c.58_59CT[1] (p.Leu21fs) rs864622212
NM_001083602.2(PTCH1):c.609_612del (p.Lys203_Lys204insTer) rs1131690969
NM_001083602.2(PTCH1):c.61_62del (p.Leu21fs) rs1554708760
NM_001083602.2(PTCH1):c.675C>G (p.Tyr225Ter) rs1564055606
NM_001083602.2(PTCH1):c.675del (p.Gly224_Tyr225insTer) rs1564055612
NM_001083602.2(PTCH1):c.688del (p.Cys230fs) rs1131690987
NM_001083602.2(PTCH1):c.723dup (p.Ala242fs) rs1554699837
NM_001083602.2(PTCH1):c.72_106del (p.Tyr27fs) rs864622583
NM_001083602.2(PTCH1):c.740C>G (p.Ser247Ter) rs1564055259
NM_001083602.2(PTCH1):c.747+1G>A rs863224444
NM_001083602.2(PTCH1):c.763del (p.Val256fs)
NM_001083602.2(PTCH1):c.772_778del (p.Asn258fs)
NM_001083602.2(PTCH1):c.804T>G (p.Tyr268Ter)
NM_001083602.2(PTCH1):c.81del (p.Cys26_Tyr27insTer) rs1554708753
NM_001083602.2(PTCH1):c.85C>T (p.Gln29Ter)
NM_001083602.2(PTCH1):c.870-2A>T rs1060502271
NM_001083602.2(PTCH1):c.883C>T (p.Gln295Ter) rs199476090
NM_001083602.2(PTCH1):c.895C>T (p.Gln299Ter) rs267606984
NM_001083602.2(PTCH1):c.92del (p.Asn31fs) rs1554708751
NM_001083602.2(PTCH1):c.92dup (p.Asn31fs)
NM_001083602.2(PTCH1):c.930del (p.Phe310fs)
NM_001083602.2(PTCH1):c.937dup (p.Tyr313fs) rs1554699216
NM_001083602.2(PTCH1):c.957del (p.Asn320fs) rs1060502297
NM_001083602.2(PTCH1):c.963G>A (p.Trp321Ter)
NM_001083602.2(PTCH1):c.98del (p.Gly33fs) rs1564088181
NM_001083602.2(PTCH1):c.992_999del (p.Glu331fs) rs1564053040
PTCH1, 1-BP DEL, 2583C
PTCH1, 1-BP INS, 1247T
PTCH1, 1-BP INS, 2000C
PTCH1, 11-BP DEL, NT2442
PTCH1, 1148G-A
PTCH1, 2-BP INS, 2047CT
PTCH1, 37-BP DEL, NT808
PTCH1, 9-BP INS, CODON 815, PRO-ASN-ILE INS
PTCH1, TRP129TER

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.