ClinVar Miner

List of variants in gene PTEN reported as uncertain significance for Hereditary cancer-predisposing syndrome

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 305
Download table as spreadsheet
HGVS dbSNP
NC_000010.11:g.87863544G>C rs1554889925
NC_000010.11:g.87863563G>C rs1064796116
NC_000010.11:g.87863564dup rs1589594132
NC_000010.11:g.87863566G>T rs1044322
NC_000010.11:g.87863566_87863567insACTCTTTATGCGCTGCGGCAG rs1589594162
NC_000010.11:g.87863566_87863587del rs786204888
NC_000010.11:g.87863567G>A rs1159376330
NC_000010.11:g.87863568del rs1589594168
NC_000010.11:g.87863574_87863575del rs1589594181
NC_000010.11:g.87863608G>A rs587776675
NM_000314.4(PTEN):c.-868G>C rs587782133
NM_000314.4(PTEN):c.-897C>G rs587781981
NM_000314.4:c.-(1087_1062)delGCTCGCACCCAGAGCTACCGCTCTGC
NM_000314.4:c.-(903_882)dupGGGACTCTTTATGCGCTGCGGC
NM_000314.4:c.-862G>C rs587781706
NM_000314.6(PTEN):c.-862G>T rs587781706
NM_000314.6(PTEN):c.-868_-846dup23 rs786204889
NM_000314.6(PTEN):c.-887T>C rs587782793
NM_000314.6(PTEN):c.-906G>A rs1064796116
NM_000314.6(PTEN):c.-917G>A rs1469347068
NM_000314.6(PTEN):c.-918G>A rs1064794193
NM_000314.6(PTEN):c.-921G>A rs786203676
NM_000314.6(PTEN):c.-921G>C rs786203676
NM_000314.6(PTEN):c.-930G>A rs587781959
NM_000314.6(PTEN):c.-933G>A rs786203419
NM_000314.6(PTEN):c.-934G>C rs786203534
NM_000314.7(PTEN):c.*20G>T rs1564570557
NM_000314.7(PTEN):c.*3T>A rs1554826068
NM_000314.7(PTEN):c.-14A>G rs755295390
NM_000314.7(PTEN):c.-17_-14del rs1064794174
NM_000314.7(PTEN):c.-4A>G rs1564801632
NM_000314.7(PTEN):c.-6C>A rs1554890322
NM_000314.7(PTEN):c.-733dup rs786204891
NM_000314.7(PTEN):c.-765G>A rs587782580
NM_000314.7(PTEN):c.-770G>A rs786202516
NM_000314.7(PTEN):c.-771A>C rs587781883
NM_000314.7(PTEN):c.-795C>T rs1217530014
NM_000314.7(PTEN):c.-7C>A rs1064795131
NM_000314.7(PTEN):c.-7C>T rs1064795131
NM_000314.7(PTEN):c.-820C>A rs1064793784
NM_000314.7(PTEN):c.-831G>A rs587781938
NM_000314.7(PTEN):c.-834C>T rs587779994
NM_000314.7(PTEN):c.-835T>G rs587782253
NM_000314.7(PTEN):c.-837C>T rs786201900
NM_000314.7(PTEN):c.-839C>G rs587781920
NM_000314.7(PTEN):c.-8T>C rs749356977
NM_000314.7(PTEN):c.1001A>G (p.Asn334Ser) rs1206321984
NM_000314.7(PTEN):c.1002C>G (p.Asn334Lys) rs1554825620
NM_000314.7(PTEN):c.1010T>A (p.Phe337Tyr) rs1554825641
NM_000314.7(PTEN):c.1018A>G (p.Asn340Asp) rs759852661
NM_000314.7(PTEN):c.1026+6T>A rs1274425509
NM_000314.7(PTEN):c.1028T>G (p.Val343Gly) rs1564570264
NM_000314.7(PTEN):c.1033C>G (p.Leu345Val) rs1114167639
NM_000314.7(PTEN):c.1037A>G (p.Tyr346Cys) rs1554826026
NM_000314.7(PTEN):c.1051G>A (p.Val351Ile) rs1564570314
NM_000314.7(PTEN):c.1052_1054del (p.Val351del) rs587780003
NM_000314.7(PTEN):c.1054G>C (p.Glu352Gln) rs1554826034
NM_000314.7(PTEN):c.1061C>T (p.Pro354Leu) rs375709098
NM_000314.7(PTEN):c.1066A>G (p.Asn356Asp) rs587782345
NM_000314.7(PTEN):c.1066A>T (p.Asn356Tyr) rs587782345
NM_000314.7(PTEN):c.1067A>T (p.Asn356Ile) rs1564570353
NM_000314.7(PTEN):c.1069C>A (p.Pro357Thr) rs876661264
NM_000314.7(PTEN):c.1074G>C (p.Glu358Asp) rs876659464
NM_000314.7(PTEN):c.1079G>C (p.Ser360Thr) rs1060500127
NM_000314.7(PTEN):c.1081A>C (p.Ser361Arg) rs1472028496
NM_000314.7(PTEN):c.1087A>G (p.Thr363Ala) rs765416558
NM_000314.7(PTEN):c.1093G>A (p.Val365Ile) rs758542021
NM_000314.7(PTEN):c.1104T>A (p.Asp368Glu) rs35979531
NM_000314.7(PTEN):c.1105G>A (p.Val369Ile) rs587782224
NM_000314.7(PTEN):c.1115A>G (p.Asn372Ser) rs1370349057
NM_000314.7(PTEN):c.112C>A (p.Pro38Thr) rs587780004
NM_000314.7(PTEN):c.1130A>T (p.Tyr377Phe) rs751286806
NM_000314.7(PTEN):c.1171C>T (p.Pro391Ser) rs786203911
NM_000314.7(PTEN):c.1172C>A (p.Pro391His) rs1554826059
NM_000314.7(PTEN):c.1172C>T (p.Pro391Leu) rs1554826059
NM_000314.7(PTEN):c.1178A>G (p.Asp393Gly) rs1564570482
NM_000314.7(PTEN):c.1206A>C (p.Lys402Asn) rs1064796017
NM_000314.7(PTEN):c.123A>T (p.Arg41Ser) rs1554893806
NM_000314.7(PTEN):c.127G>A (p.Glu43Lys) rs1554893808
NM_000314.7(PTEN):c.130G>A (p.Gly44Ser) rs1554893812
NM_000314.7(PTEN):c.146A>G (p.Asn49Ser) rs992385562
NM_000314.7(PTEN):c.158T>A (p.Val53Glu) rs786203375
NM_000314.7(PTEN):c.160G>A (p.Val54Ile) rs786204916
NM_000314.7(PTEN):c.16A>G (p.Lys6Glu) rs1589596143
NM_000314.7(PTEN):c.170T>G (p.Leu57Trp) rs786202398
NM_000314.7(PTEN):c.172G>A (p.Asp58Asn) rs1554897255
NM_000314.7(PTEN):c.184A>G (p.Lys62Glu) rs1564826779
NM_000314.7(PTEN):c.190C>T (p.His64Tyr) rs587781535
NM_000314.7(PTEN):c.1A>G (p.Met1Val) rs1554890324
NM_000314.7(PTEN):c.206A>G (p.Asn69Ser) rs786204922
NM_000314.7(PTEN):c.209+3A>T rs786202612
NM_000314.7(PTEN):c.212G>T (p.Cys71Phe) rs1554897856
NM_000314.7(PTEN):c.229G>C (p.Asp77His) rs1554897867
NM_000314.7(PTEN):c.231C>A (p.Asp77Glu) rs755953294
NM_000314.7(PTEN):c.235G>T (p.Ala79Ser) rs202004587
NM_000314.7(PTEN):c.242T>A (p.Phe81Tyr) rs876661177
NM_000314.7(PTEN):c.253+3A>G rs1554897887
NM_000314.7(PTEN):c.253+4_253+7del rs876659695
NM_000314.7(PTEN):c.254T>G (p.Val85Gly) rs1114167658
NM_000314.7(PTEN):c.25G>A (p.Val9Ile) rs1564801672
NM_000314.7(PTEN):c.266C>T (p.Pro89Leu) rs1554898059
NM_000314.7(PTEN):c.271G>A (p.Glu91Lys) rs1554898062
NM_000314.7(PTEN):c.278A>C (p.His93Pro) rs121909238
NM_000314.7(PTEN):c.28A>G (p.Ser10Gly) rs572685299
NM_000314.7(PTEN):c.304A>C (p.Lys102Gln) rs786202944
NM_000314.7(PTEN):c.311T>A (p.Phe104Tyr) rs1564829958
NM_000314.7(PTEN):c.314G>A (p.Cys105Tyr) rs587782343
NM_000314.7(PTEN):c.319G>T (p.Asp107Tyr) rs57374291
NM_000314.7(PTEN):c.328C>G (p.Gln110Glu) rs1114167629
NM_000314.7(PTEN):c.329A>G (p.Gln110Arg) rs1564830013
NM_000314.7(PTEN):c.337A>C (p.Ser113Arg) rs1554898100
NM_000314.7(PTEN):c.347A>G (p.Asp116Gly) rs1564830054
NM_000314.7(PTEN):c.349A>C (p.Asn117His) rs771310592
NM_000314.7(PTEN):c.34A>G (p.Asn12Asp) rs1554890340
NM_000314.7(PTEN):c.350A>G (p.Asn117Ser) rs551221430
NM_000314.7(PTEN):c.353A>G (p.His118Arg) rs1554898107
NM_000314.7(PTEN):c.356T>G (p.Val119Gly) rs1554898113
NM_000314.7(PTEN):c.359C>T (p.Ala120Val) rs1114167647
NM_000314.7(PTEN):c.364A>G (p.Ile122Val) rs786202740
NM_000314.7(PTEN):c.36C>G (p.Asn12Lys) rs587781957
NM_000314.7(PTEN):c.376G>T (p.Ala126Ser) rs1554898129
NM_000314.7(PTEN):c.392C>G (p.Thr131Ser) rs397514560
NM_000314.7(PTEN):c.413A>G (p.Tyr138Cys) rs1554898159
NM_000314.7(PTEN):c.421C>T (p.His141Tyr) rs1060500129
NM_000314.7(PTEN):c.422A>C (p.His141Pro) rs863224666
NM_000314.7(PTEN):c.422A>G (p.His141Arg) rs863224666
NM_000314.7(PTEN):c.424C>T (p.Arg142Trp) rs746152219
NM_000314.7(PTEN):c.425G>A (p.Arg142Gln) rs753630034
NM_000314.7(PTEN):c.425G>C (p.Arg142Pro) rs753630034
NM_000314.7(PTEN):c.428G>A (p.Gly143Asp) rs786202047
NM_000314.7(PTEN):c.440A>G (p.Lys147Arg) rs757087471
NM_000314.7(PTEN):c.442G>A (p.Ala148Thr) rs876660321
NM_000314.7(PTEN):c.44G>C (p.Arg15Thr) rs398123324
NM_000314.7(PTEN):c.471A>G (p.Glu157=) rs1554898216
NM_000314.7(PTEN):c.472G>A (p.Val158Ile) rs1554898217
NM_000314.7(PTEN):c.488A>G (p.Lys163Arg) rs786202753
NM_000314.7(PTEN):c.492+3A>G rs1564830529
NM_000314.7(PTEN):c.492G>A (p.Lys164=) rs146629065
NM_000314.7(PTEN):c.493-7C>T rs1554900492
NM_000314.7(PTEN):c.496G>A (p.Val166Ile) rs780943695
NM_000314.7(PTEN):c.49C>G (p.Gln17Glu) rs786204910
NM_000314.7(PTEN):c.521A>G (p.Tyr174Cys) rs864622341
NM_000314.7(PTEN):c.527A>G (p.Tyr176Cys) rs757498880
NM_000314.7(PTEN):c.538T>C (p.Tyr180His) rs746280047
NM_000314.7(PTEN):c.539A>C (p.Tyr180Ser) rs1554900585
NM_000314.7(PTEN):c.549G>T (p.Lys183Asn) rs876659227
NM_000314.7(PTEN):c.551A>T (p.Asn184Ile) rs587781895
NM_000314.7(PTEN):c.560A>G (p.Asp187Gly) rs786204943
NM_000314.7(PTEN):c.56A>G (p.Asp19Gly) rs1554890392
NM_000314.7(PTEN):c.571G>T (p.Val191Leu) rs1060500130
NM_000314.7(PTEN):c.589A>C (p.Lys197Gln) rs1554900629
NM_000314.7(PTEN):c.595A>G (p.Met199Val) rs1434191423
NM_000314.7(PTEN):c.596T>A (p.Met199Lys) rs587781538
NM_000314.7(PTEN):c.596T>C (p.Met199Thr) rs587781538
NM_000314.7(PTEN):c.59G>T (p.Gly20Val) rs1064795967
NM_000314.7(PTEN):c.607A>G (p.Ile203Val) rs1564837997
NM_000314.7(PTEN):c.610C>G (p.Pro204Ala) rs786204868
NM_000314.7(PTEN):c.610C>T (p.Pro204Ser) rs786204868
NM_000314.7(PTEN):c.614T>C (p.Met205Thr) rs1185592373
NM_000314.7(PTEN):c.625G>A (p.Gly209Arg) rs765433422
NM_000314.7(PTEN):c.628A>G (p.Thr210Ala) rs1554900663
NM_000314.7(PTEN):c.633C>G (p.Cys211Trp) rs121909232
NM_000314.7(PTEN):c.635-7C>A rs1554825148
NM_000314.7(PTEN):c.635A>G (p.Asn212Ser) rs1554825156
NM_000314.7(PTEN):c.641A>C (p.Gln214Pro) rs1564566726
NM_000314.7(PTEN):c.64G>C (p.Asp22His) rs876660420
NM_000314.7(PTEN):c.656A>C (p.Gln219Pro) rs1554825172
NM_000314.7(PTEN):c.65A>G (p.Asp22Gly) rs1554890398
NM_000314.7(PTEN):c.670A>T (p.Ile224Leu) rs1554825177
NM_000314.7(PTEN):c.673T>C (p.Tyr225His) rs876659433
NM_000314.7(PTEN):c.683A>G (p.Asn228Ser) rs748240670
NM_000314.7(PTEN):c.698G>A (p.Arg233Gln) rs770025422
NM_000314.7(PTEN):c.700C>G (p.Arg234Gly) rs786201730
NM_000314.7(PTEN):c.700C>T (p.Arg234Trp) rs786201730
NM_000314.7(PTEN):c.701G>A (p.Arg234Gln) rs121909235
NM_000314.7(PTEN):c.715A>G (p.Met239Val) rs786201758
NM_000314.7(PTEN):c.723T>G (p.Phe241Leu) rs17849090
NM_000314.7(PTEN):c.72C>G (p.Asp24Glu) rs1320222638
NM_000314.7(PTEN):c.758T>A (p.Ile253Asn) rs1554825235
NM_000314.7(PTEN):c.75G>T (p.Leu25Phe) rs786201506
NM_000314.7(PTEN):c.771C>A (p.Phe257Leu) rs1554825245
NM_000314.7(PTEN):c.785A>C (p.Asn262Thr) rs763784377
NM_000314.7(PTEN):c.79+3A>G rs771928902
NM_000314.7(PTEN):c.79+4T>C rs1554890415
NM_000314.7(PTEN):c.79+7A>G rs374331677
NM_000314.7(PTEN):c.79+7A>T rs374331677
NM_000314.7(PTEN):c.80-5C>T rs1060503842
NM_000314.7(PTEN):c.802-3T>A rs587780712
NM_000314.7(PTEN):c.823G>A (p.Val275Ile) rs1410198544
NM_000314.7(PTEN):c.830C>T (p.Thr277Ile) rs398123329
NM_000314.7(PTEN):c.838A>G (p.Ile280Val) rs1474354667
NM_000314.7(PTEN):c.841C>G (p.Pro281Ala) rs750705904
NM_000314.7(PTEN):c.847C>G (p.Pro283Ala) rs876658988
NM_000314.7(PTEN):c.847C>T (p.Pro283Ser) rs876658988
NM_000314.7(PTEN):c.853G>A (p.Glu285Lys) rs1564568265
NM_000314.7(PTEN):c.859T>C (p.Ser287Pro) rs1554825526
NM_000314.7(PTEN):c.862G>A (p.Glu288Lys) rs1554825528
NM_000314.7(PTEN):c.881G>A (p.Ser294Asn) rs1175543698
NM_000314.7(PTEN):c.886T>C (p.Cys296Arg) rs786202207
NM_000314.7(PTEN):c.887G>A (p.Cys296Tyr) rs1060500121
NM_000314.7(PTEN):c.889G>C (p.Asp297His) rs370064195
NM_000314.7(PTEN):c.889G>T (p.Asp297Tyr) rs370064195
NM_000314.7(PTEN):c.892C>A (p.Gln298Lys) rs371387815
NM_000314.7(PTEN):c.896A>G (p.Glu299Gly) rs1554825550
NM_000314.7(PTEN):c.8C>T (p.Ala3Val) rs1564801650
NM_000314.7(PTEN):c.905G>A (p.Ser302Asn) rs745638189
NM_000314.7(PTEN):c.906C>G (p.Ser302Arg) rs876660906
NM_000314.7(PTEN):c.907A>G (p.Ile303Val) rs1114167660
NM_000314.7(PTEN):c.908T>G (p.Ile303Ser) rs772018727
NM_000314.7(PTEN):c.913A>G (p.Ser305Gly) rs775461980
NM_000314.7(PTEN):c.914G>A (p.Ser305Asn) rs587780007
NM_000314.7(PTEN):c.915T>G (p.Ser305Arg) rs876658345
NM_000314.7(PTEN):c.916A>G (p.Ile306Val) rs786203858
NM_000314.7(PTEN):c.919G>C (p.Glu307Gln) rs746930141
NM_000314.7(PTEN):c.920A>G (p.Glu307Gly) rs1197734477
NM_000314.7(PTEN):c.922C>T (p.Arg308Cys) rs1064794436
NM_000314.7(PTEN):c.923G>A (p.Arg308His) rs786201507
NM_000314.7(PTEN):c.929A>G (p.Asp310Gly) rs1564568473
NM_000314.7(PTEN):c.935A>G (p.Asp312Gly) rs863224667
NM_000314.7(PTEN):c.949G>A (p.Val317Ile) rs876658630
NM_000314.7(PTEN):c.974T>C (p.Leu325Pro) rs1114167654
NM_000314.7(PTEN):c.974T>G (p.Leu325Arg) rs1114167654
NM_000314.7(PTEN):c.988A>G (p.Lys330Glu) rs1554825607
NM_000314.7(PTEN):c.98T>C (p.Ile33Thr) rs1554893771
NM_000314.7(PTEN):c.998C>T (p.Ala333Val) rs1554825616
NM_000314.8(PTEN):c.*17A>C
NM_000314.8(PTEN):c.-752G>A rs1256922808
NM_000314.8(PTEN):c.-796C>A rs1217530014
NM_000314.8(PTEN):c.-821C>G rs1064793784
NM_000314.8(PTEN):c.-821C>T rs1064793784
NM_000314.8(PTEN):c.100G>C (p.Ala34Pro) rs1589617199
NM_000314.8(PTEN):c.1027-4C>G rs587782788
NM_000314.8(PTEN):c.1027-6C>A
NM_000314.8(PTEN):c.1031A>G (p.Lys344Arg)
NM_000314.8(PTEN):c.1036T>G (p.Tyr346Asp) rs1589669128
NM_000314.8(PTEN):c.1061C>A (p.Pro354Gln) rs375709098
NM_000314.8(PTEN):c.1078A>G (p.Ser360Gly) rs587781273
NM_000314.8(PTEN):c.1088C>T (p.Thr363Ile) rs750585255
NM_000314.8(PTEN):c.112C>T (p.Pro38Ser) rs587780004
NM_000314.8(PTEN):c.1133_1136del (p.Arg378fs) rs1064794878
NM_000314.8(PTEN):c.113C>T (p.Pro38Leu) rs1064796886
NM_000314.8(PTEN):c.1164G>C (p.Glu388Asp)
NM_000314.8(PTEN):c.1189C>T (p.His397Tyr) rs1589669413
NM_000314.8(PTEN):c.1190A>T (p.His397Leu) rs876661021
NM_000314.8(PTEN):c.1197A>C (p.Gln399His)
NM_000314.8(PTEN):c.11T>G (p.Ile4Ser)
NM_000314.8(PTEN):c.142A>G (p.Asn48Asp)
NM_000314.8(PTEN):c.165-5T>C rs1589640360
NM_000314.8(PTEN):c.166T>G (p.Phe56Val)
NM_000314.8(PTEN):c.191A>G (p.His64Arg) rs1589640471
NM_000314.8(PTEN):c.205A>C (p.Asn69His)
NM_000314.8(PTEN):c.207T>G (p.Asn69Lys) rs1589640559
NM_000314.8(PTEN):c.210-12C>A
NM_000314.8(PTEN):c.213T>G (p.Cys71Trp) rs1554897858
NM_000314.8(PTEN):c.233C>T (p.Thr78Ile)
NM_000314.8(PTEN):c.235G>A (p.Ala79Thr) rs202004587
NM_000314.8(PTEN):c.250A>G (p.Arg84Gly)
NM_000314.8(PTEN):c.253+8T>C
NM_000314.8(PTEN):c.254-5C>T rs1589645935
NM_000314.8(PTEN):c.273A>C (p.Glu91Asp) rs1589646019
NM_000314.8(PTEN):c.292C>G (p.Leu98Val) rs1589646090
NM_000314.8(PTEN):c.298C>G (p.Leu100Val) rs1589646100
NM_000314.8(PTEN):c.365T>G (p.Ile122Ser) rs1589646321
NM_000314.8(PTEN):c.41G>A (p.Arg14Lys) rs1589596246
NM_000314.8(PTEN):c.493-3C>G rs1589659297
NM_000314.8(PTEN):c.493-4C>A rs1057522555
NM_000314.8(PTEN):c.515G>C (p.Arg172Thr) rs1589659399
NM_000314.8(PTEN):c.556C>G (p.Leu186Val) rs1589659546
NM_000314.8(PTEN):c.55_56delinsTT (p.Asp19Phe) rs1589596354
NM_000314.8(PTEN):c.566G>C (p.Arg189Thr) rs1589659565
NM_000314.8(PTEN):c.586C>G (p.His196Asp) rs1589659615
NM_000314.8(PTEN):c.595A>T (p.Met199Leu)
NM_000314.8(PTEN):c.613A>G (p.Met205Val) rs776763121
NM_000314.8(PTEN):c.619A>T (p.Ser207Cys) rs1589659733
NM_000314.8(PTEN):c.637C>T (p.Pro213Ser) rs1589663135
NM_000314.8(PTEN):c.647T>C (p.Val216Ala) rs1589663156
NM_000314.8(PTEN):c.653G>C (p.Cys218Ser)
NM_000314.8(PTEN):c.659T>C (p.Leu220Pro)
NM_000314.8(PTEN):c.683A>T (p.Asn228Ile)
NM_000314.8(PTEN):c.685T>A (p.Ser229Thr) rs587781998
NM_000314.8(PTEN):c.716T>C (p.Met239Thr) rs786204871
NM_000314.8(PTEN):c.735G>C (p.Gln245His) rs1589663424
NM_000314.8(PTEN):c.754G>A (p.Asp252Asn) rs1589663499
NM_000314.8(PTEN):c.78C>G (p.Thr26=) rs786201280
NM_000314.8(PTEN):c.7G>A (p.Ala3Thr) rs1589596120
NM_000314.8(PTEN):c.80-12T>C
NM_000314.8(PTEN):c.802-13T>C
NM_000314.8(PTEN):c.834C>A (p.Phe278Leu) rs867171992
NM_000314.8(PTEN):c.838A>C (p.Ile280Leu) rs1474354667
NM_000314.8(PTEN):c.848C>T (p.Pro283Leu)
NM_000314.8(PTEN):c.868G>C (p.Val290Leu) rs35600253
NM_000314.8(PTEN):c.888T>G (p.Cys296Trp) rs1589665853
NM_000314.8(PTEN):c.892C>G (p.Gln298Glu) rs371387815
NM_000314.8(PTEN):c.89C>G (p.Pro30Arg) rs1589617164
NM_000314.8(PTEN):c.901G>A (p.Asp301Asn) rs758644748
NM_000314.8(PTEN):c.94_96ATT[1] (p.Ile33del) rs1554893765
NM_000314.8(PTEN):c.967A>C (p.Asn323His) rs1589666149
NM_000314.8(PTEN):c.971A>G (p.Asp324Gly) rs1589666167
NM_000314.8(PTEN):c.998C>A (p.Ala333Asp) rs1554825616
NM_001304718.2(PTEN):c.-447_-445dup rs587782641
NM_001304718.2(PTEN):c.-580_-578dup rs786204896
NM_001304718.2(PTEN):c.-64_-58delinsA rs1114167642
NM_001304718.2(PTEN):c.-661_-660delinsTC rs1114167679
NM_001304718.2(PTEN):c.-676_-674del rs1114167649
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.