ClinVar Miner

List of variants in gene PTEN reported by GeneDx

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 454
Download table as spreadsheet
HGVS dbSNP
NC_000010.11:g.87931034C>T
NC_000010.11:g.87960892dup
NC_000010.11:g.87961239C>T
NM_000314.4(PTEN):c.-1002C>T rs786202476
NM_000314.4(PTEN):c.-1013G>T rs786204923
NM_000314.4(PTEN):c.-845A>C rs786204861
NM_000314.4(PTEN):c.-846C>T rs786204860
NM_000314.4(PTEN):c.-848C>T rs1554889977
NM_000314.4(PTEN):c.-850C>T rs559145151
NM_000314.4(PTEN):c.-851G>A rs876661046
NM_000314.4(PTEN):c.-852T>A rs1554889968
NM_000314.4(PTEN):c.-854A>T rs1366254013
NM_000314.4(PTEN):c.-858C>G rs1034838800
NM_000314.4(PTEN):c.-859A>C rs876661029
NM_000314.4(PTEN):c.-859A>G rs876661029
NM_000314.4(PTEN):c.-861G>C rs587776675
NM_000314.4(PTEN):c.-862G>A rs587781706
NM_000314.4(PTEN):c.-863T>C rs1204891831
NM_000314.4(PTEN):c.-864C>T rs537241946
NM_000314.4(PTEN):c.-868G>C rs587782133
NM_000314.4(PTEN):c.-868G>T rs587782133
NM_000314.4(PTEN):c.-869C>T rs786204939
NM_000314.4(PTEN):c.-869_-863delCGGCGCT rs1554889947
NM_000314.4(PTEN):c.-872G>A rs960884250
NM_000314.4(PTEN):c.-890C>T rs1554889945
NM_000314.4(PTEN):c.-892T>C rs786204938
NM_000314.4(PTEN):c.-892delT rs1554889944
NM_000314.4(PTEN):c.-897C>G rs587781981
NM_000314.4(PTEN):c.-903_-882dup rs786204888
NM_000314.4(PTEN):c.-904C>A rs587779997
NM_000314.4(PTEN):c.-904_-903delCGinsGA rs1554889939
NM_000314.4(PTEN):c.-907T>G rs587779998
NM_000314.4(PTEN):c.-909T>G rs550385924
NM_000314.4(PTEN):c.-912T>C rs535142665
NM_000314.4(PTEN):c.-914G>C rs1255473880
NM_000314.4(PTEN):c.-915C>T rs1554889928
NM_000314.4(PTEN):c.-920G>A rs786204937
NM_000314.4(PTEN):c.-923C>T rs786204936
NM_000314.4(PTEN):c.-925G>A rs1554889925
NM_000314.4(PTEN):c.-927C>T rs1158800882
NM_000314.4(PTEN):c.-929G>A rs1554889924
NM_000314.4(PTEN):c.-932G>A rs889785939
NM_000314.4(PTEN):c.-933G>C rs786203419
NM_000314.4(PTEN):c.-940C>T rs1049705048
NM_000314.4(PTEN):c.-942G>A rs786204935
NM_000314.4(PTEN):c.-943C>T rs587779999
NM_000314.4(PTEN):c.-945G>C rs1064795081
NM_000314.4(PTEN):c.-946C>T rs567739104
NM_000314.4(PTEN):c.-953C>G rs1465513356
NM_000314.4(PTEN):c.-955C>A rs1355012894
NM_000314.4(PTEN):c.-955C>G rs1355012894
NM_000314.4(PTEN):c.-955C>T rs1355012894
NM_000314.4(PTEN):c.-956G>C rs786205433
NM_000314.4(PTEN):c.-963C>G rs1052921124
NM_000314.4(PTEN):c.-972C>T rs587781603
NM_000314.4(PTEN):c.-973T>A rs1554889906
NM_000314.4(PTEN):c.-985G>A rs960920744
NM_000314.4(PTEN):c.-986C>T rs876661007
NM_000314.4(PTEN):c.-989T>C rs786204924
NM_000314.4(PTEN):c.-992G>C rs972890157
NM_000314.4(PTEN):c.-993C>G rs587780002
NM_000314.4(PTEN):c.-994_-984dupTCGCCTCCCGC rs587782811
NM_000314.4(PTEN):c.-995C>T rs1554889892
NM_000314.4(PTEN):c.-997C>G rs876661279
NM_000314.4(PTEN):c.-997dupC rs876661265
NM_000314.4(PTEN):c.254-3_254-2delCA rs1064794169
NM_000314.4:c.-(1087_1062)delGCTCGCACCCAGAGCTACCGCTCTGC
NM_000314.4:c.-(903_882)dupGGGACTCTTTATGCGCTGCGGC
NM_000314.6(PTEN):c.-1020C>T rs1064794803
NM_000314.6(PTEN):c.-1027_-1023dup rs1342028958
NM_000314.6(PTEN):c.-1028C>G rs1064795849
NM_000314.6(PTEN):c.-1031C>T rs1064793240
NM_000314.6(PTEN):c.-856C>G rs587779996
NM_000314.6(PTEN):c.-866C>T rs1554889951
NM_000314.6(PTEN):c.-868_-846dup23 rs786204889
NM_000314.6(PTEN):c.-901_-883dup rs1554889937
NM_000314.6(PTEN):c.-903G>A rs1044322
NM_000314.6(PTEN):c.-903G>C rs1044322
NM_000314.6(PTEN):c.-906G>A rs1064796116
NM_000314.6(PTEN):c.-918G>A rs1064794193
NM_000314.6(PTEN):c.-921G>C rs786203676
NM_000314.6(PTEN):c.-945G>A rs1064795081
NM_000314.6(PTEN):c.-952C>A rs1064794865
NM_000314.6(PTEN):c.-965G>A rs1064794742
NM_000314.6(PTEN):c.-975G>A rs587780001
NM_000314.6(PTEN):c.-975G>T rs587780001
NM_000314.6(PTEN):c.-988C>T rs1064794113
NM_000314.6(PTEN):c.165-13_165-10delGTTT rs786204877
NM_000314.6(PTEN):c.210-3dupT rs1064794464
NM_000314.6(PTEN):c.253+18_253+22delGTACT rs1554897892
NM_000314.6(PTEN):c.253+20_253+26delACTATGT rs1554897894
NM_000314.6(PTEN):c.802-18_802-14delCTTTT rs786204879
NM_000314.6(PTEN):c.802-23_802-13delCTTTTCTTTTT rs1064794381
NM_000314.6(PTEN):c.802-29_802-20delCTTTTTCTTT rs1064793331
NM_000314.7(PTEN):c.*10del rs756681683
NM_000314.7(PTEN):c.*5T>C rs1006891299
NM_000314.7(PTEN):c.*6T>C rs1064794975
NM_000314.7(PTEN):c.*7T>G rs1064794700
NM_000314.7(PTEN):c.-12A>T rs753142719
NM_000314.7(PTEN):c.-14A>G rs755295390
NM_000314.7(PTEN):c.-15C>T rs1064793241
NM_000314.7(PTEN):c.-16C>T rs1064793804
NM_000314.7(PTEN):c.-17G>T rs1064793744
NM_000314.7(PTEN):c.-17_-14del rs1064794174
NM_000314.7(PTEN):c.-1C>T rs770965327
NM_000314.7(PTEN):c.-25T>C rs786204909
NM_000314.7(PTEN):c.-26T>C rs750098228
NM_000314.7(PTEN):c.-28C>T rs764917503
NM_000314.7(PTEN):c.-32C>T rs376610243
NM_000314.7(PTEN):c.-32_-30CCT[1] rs749497048
NM_000314.7(PTEN):c.-39_-38TC[2] rs1064795965
NM_000314.7(PTEN):c.-662_-651del rs786204880
NM_000314.7(PTEN):c.-663G>A rs1554890092
NM_000314.7(PTEN):c.-665G>A rs553371022
NM_000314.7(PTEN):c.-667C>T rs786204948
NM_000314.7(PTEN):c.-669_-667GGC[4] rs1376765196
NM_000314.7(PTEN):c.-670C>T rs1554890086
NM_000314.7(PTEN):c.-672T>C rs786204947
NM_000314.7(PTEN):c.-674C>A rs876661258
NM_000314.7(PTEN):c.-678C>T rs1131691255
NM_000314.7(PTEN):c.-682C>G rs1064793892
NM_000314.7(PTEN):c.-685G>A rs786204874
NM_000314.7(PTEN):c.-688G>A rs876661030
NM_000314.7(PTEN):c.-688G>C rs876661030
NM_000314.7(PTEN):c.-691C>T rs1554890066
NM_000314.7(PTEN):c.-695C>G rs1554890065
NM_000314.7(PTEN):c.-700G>A rs1554890059
NM_000314.7(PTEN):c.-703G>C rs1251019969
NM_000314.7(PTEN):c.-713G>A rs587779989
NM_000314.7(PTEN):c.-719G>A rs960387107
NM_000314.7(PTEN):c.-720C>T rs1554890055
NM_000314.7(PTEN):c.-727C>T rs786204870
NM_000314.7(PTEN):c.-729C>G rs786204869
NM_000314.7(PTEN):c.-730C>T rs886039462
NM_000314.7(PTEN):c.-731G>C rs1399617046
NM_000314.7(PTEN):c.-733G>A rs786205432
NM_000314.7(PTEN):c.-733dup rs786204891
NM_000314.7(PTEN):c.-734G>A rs886047384
NM_000314.7(PTEN):c.-734G>C rs886047384
NM_000314.7(PTEN):c.-739G>A rs888482160
NM_000314.7(PTEN):c.-740C>T rs1310141519
NM_000314.7(PTEN):c.-741G>A rs876661008
NM_000314.7(PTEN):c.-743C>T rs1554890027
NM_000314.7(PTEN):c.-748G>A rs994757335
NM_000314.7(PTEN):c.-752C>T rs1554890025
NM_000314.7(PTEN):c.-753A>G rs1554890021
NM_000314.7(PTEN):c.-763G>A rs876661267
NM_000314.7(PTEN):c.-764G>A rs587776674
NM_000314.7(PTEN):c.-767G>T rs587779991
NM_000314.7(PTEN):c.-769G>A rs1255704947
NM_000314.7(PTEN):c.-776G>C rs1064795132
NM_000314.7(PTEN):c.-779_-764dup rs1554890001
NM_000314.7(PTEN):c.-783G>T rs1036616021
NM_000314.7(PTEN):c.-784C>T rs1554890003
NM_000314.7(PTEN):c.-788G>A rs1554889999
NM_000314.7(PTEN):c.-790G>A rs876661209
NM_000314.7(PTEN):c.-794C>G rs786204942
NM_000314.7(PTEN):c.-796G>T rs786204941
NM_000314.7(PTEN):c.-797A>G rs577569375
NM_000314.7(PTEN):c.-798G>C rs587779992
NM_000314.7(PTEN):c.-7C>T rs1064795131
NM_000314.7(PTEN):c.-801G>A rs876661166
NM_000314.7(PTEN):c.-805G>A rs944586541
NM_000314.7(PTEN):c.-811A>G rs1554889993
NM_000314.7(PTEN):c.-813G>A rs876661178
NM_000314.7(PTEN):c.-814T>C rs1050226735
NM_000314.7(PTEN):c.-818A>G rs931643553
NM_000314.7(PTEN):c.-820C>A rs1064793784
NM_000314.7(PTEN):c.-821G>C rs587779993
NM_000314.7(PTEN):c.-821G>T rs587779993
NM_000314.7(PTEN):c.-827G>A rs978944900
NM_000314.7(PTEN):c.-832C>T rs1262674767
NM_000314.7(PTEN):c.-834C>T rs587779994
NM_000314.7(PTEN):c.-836C>T rs786204940
NM_000314.7(PTEN):c.-837C>G rs786201900
NM_000314.7(PTEN):c.-839C>T rs587781920
NM_000314.7(PTEN):c.-843T>C rs587779995
NM_000314.7(PTEN):c.-843_-841delinsCTT rs1554889983
NM_000314.7(PTEN):c.-909T>C rs550385924
NM_000314.7(PTEN):c.-975G>C rs587780001
NM_000314.7(PTEN):c.1003C>T (p.Arg335Ter) rs121909231
NM_000314.7(PTEN):c.1008C>T (p.Tyr336=) rs786201816
NM_000314.7(PTEN):c.1018A>C (p.Asn340His) rs759852661
NM_000314.7(PTEN):c.1025A>C (p.Lys342Thr) rs1064794080
NM_000314.7(PTEN):c.1026+10A>G rs767777911
NM_000314.7(PTEN):c.1026G>A (p.Lys342=) rs398123314
NM_000314.7(PTEN):c.1027-12T>G rs1057521732
NM_000314.7(PTEN):c.1027-17A>T rs1057520355
NM_000314.7(PTEN):c.1027-1G>A rs1057517809
NM_000314.7(PTEN):c.1027-2A>G rs1085308041
NM_000314.7(PTEN):c.1027-4C>G rs587782788
NM_000314.7(PTEN):c.1029_1039del (p.Lys344fs) rs1064796236
NM_000314.7(PTEN):c.103A>G (p.Met35Val) rs876659443
NM_000314.7(PTEN):c.1052_1054del (p.Val351del) rs587780003
NM_000314.7(PTEN):c.1061C>A (p.Pro354Gln) rs375709098
NM_000314.7(PTEN):c.1066A>T (p.Asn356Tyr) rs587782345
NM_000314.7(PTEN):c.1069C>A (p.Pro357Thr) rs876661264
NM_000314.7(PTEN):c.1078A>G (p.Ser360Gly) rs587781273
NM_000314.7(PTEN):c.1093G>A (p.Val365Ile) rs758542021
NM_000314.7(PTEN):c.1104T>C (p.Asp368=) rs35979531
NM_000314.7(PTEN):c.1105G>A (p.Val369Ile) rs587782224
NM_000314.7(PTEN):c.1125T>C (p.Asp375=) rs1057524567
NM_000314.7(PTEN):c.112C>T (p.Pro38Ser) rs587780004
NM_000314.7(PTEN):c.1133_1136del (p.Arg378fs) rs1064794878
NM_000314.7(PTEN):c.113C>G (p.Pro38Arg) rs1064796886
NM_000314.7(PTEN):c.114T>G (p.Pro38=) rs748040144
NM_000314.7(PTEN):c.1161A>G (p.Pro387=) rs1057523975
NM_000314.7(PTEN):c.1170A>G (p.Glu390=) rs1057524010
NM_000314.7(PTEN):c.1171C>T (p.Pro391Ser) rs786203911
NM_000314.7(PTEN):c.117del (p.Glu40fs) rs786204895
NM_000314.7(PTEN):c.1190A>G (p.His397Arg) rs876661021
NM_000314.7(PTEN):c.1197A>G (p.Gln399=) rs374684043
NM_000314.7(PTEN):c.1206A>C (p.Lys402Asn) rs1064796017
NM_000314.7(PTEN):c.1212A>G (p.Ter404Trp) rs876660879
NM_000314.7(PTEN):c.126_128dup (p.Glu43_Gly44insAsp) rs786204896
NM_000314.7(PTEN):c.136T>G (p.Tyr46Asp) rs1064793325
NM_000314.7(PTEN):c.140G>A (p.Arg47Lys) rs1057518425
NM_000314.7(PTEN):c.160G>A (p.Val54Ile) rs786204916
NM_000314.7(PTEN):c.164+12T>C rs1057521654
NM_000314.7(PTEN):c.164+1G>T rs1554893835
NM_000314.7(PTEN):c.165-17G>C rs898943632
NM_000314.7(PTEN):c.165-1G>A rs786203847
NM_000314.7(PTEN):c.165-2A>G rs1085308043
NM_000314.7(PTEN):c.165-7T>C rs572375431
NM_000314.7(PTEN):c.173A>G (p.Asp58Gly) rs1131691885
NM_000314.7(PTEN):c.174T>C (p.Asp58=) rs769719835
NM_000314.7(PTEN):c.17_18del (p.Lys6fs) rs121913290
NM_000314.7(PTEN):c.19_20GA[1] (p.Glu7fs) rs786204881
NM_000314.7(PTEN):c.202T>C (p.Tyr68His) rs398123317
NM_000314.7(PTEN):c.206A>G (p.Asn69Ser) rs786204922
NM_000314.7(PTEN):c.209+17A>G rs1057520524
NM_000314.7(PTEN):c.209+1G>A rs1554897280
NM_000314.7(PTEN):c.209+2dup rs1064794925
NM_000314.7(PTEN):c.209+9_209+10delinsCC rs1060503841
NM_000314.7(PTEN):c.210-17T>C rs750987148
NM_000314.7(PTEN):c.210-1G>A rs1114167621
NM_000314.7(PTEN):c.210-6T>C rs1057521210
NM_000314.7(PTEN):c.210-7_210-3del rs587780544
NM_000314.7(PTEN):c.210-9T>C rs751744545
NM_000314.7(PTEN):c.216T>C (p.Ala72=) rs1057520862
NM_000314.7(PTEN):c.219_222dup (p.His75fs) rs786204898
NM_000314.7(PTEN):c.21_37del (p.Ile8fs) rs786204882
NM_000314.7(PTEN):c.222A>G (p.Arg74=) rs781542973
NM_000314.7(PTEN):c.228T>C (p.Tyr76=) rs1554897866
NM_000314.7(PTEN):c.228T>G (p.Tyr76Ter) rs1554897866
NM_000314.7(PTEN):c.234C>A (p.Thr78=) rs35917308
NM_000314.7(PTEN):c.234C>T (p.Thr78=) rs35917308
NM_000314.7(PTEN):c.235G>A (p.Ala79Thr) rs202004587
NM_000314.7(PTEN):c.242T>G (p.Phe81Cys) rs876661177
NM_000314.7(PTEN):c.244A>G (p.Asn82Asp) rs1064793242
NM_000314.7(PTEN):c.253+14T>A rs1057520635
NM_000314.7(PTEN):c.253+1G>A rs587776667
NM_000314.7(PTEN):c.253+1G>T rs587776667
NM_000314.7(PTEN):c.253+4_253+7del rs876659695
NM_000314.7(PTEN):c.254-17T>G rs1057520819
NM_000314.7(PTEN):c.254-1G>A rs1057520208
NM_000314.7(PTEN):c.254-2A>G rs786204926
NM_000314.7(PTEN):c.254-316T>C
NM_000314.7(PTEN):c.254-6C>T rs1057520525
NM_000314.7(PTEN):c.258A>G (p.Ala86=) rs587780710
NM_000314.7(PTEN):c.261A>G (p.Gln87=) rs149772796
NM_000314.7(PTEN):c.264T>A (p.Tyr88Ter) rs1554898056
NM_000314.7(PTEN):c.271_272delinsTTT (p.Glu91fs) rs1085307891
NM_000314.7(PTEN):c.286C>G (p.Pro96Ala) rs398123320
NM_000314.7(PTEN):c.286C>T (p.Pro96Ser) rs398123320
NM_000314.7(PTEN):c.287C>T (p.Pro96Leu) rs1554898074
NM_000314.7(PTEN):c.289C>T (p.Gln97Ter) rs786204928
NM_000314.7(PTEN):c.308_309del (p.Pro103fs) rs1554898088
NM_000314.7(PTEN):c.313_314TG[3] (p.Glu106fs) rs1554898090
NM_000314.7(PTEN):c.318del (p.Asp107fs) rs1554898092
NM_000314.7(PTEN):c.320A>T (p.Asp107Val) rs786204858
NM_000314.7(PTEN):c.321T>C (p.Asp107=) rs372876243
NM_000314.7(PTEN):c.321del (p.Asp109fs) rs786204899
NM_000314.7(PTEN):c.323T>C (p.Leu108Pro) rs1064793243
NM_000314.7(PTEN):c.335T>C (p.Leu112Pro) rs121909230
NM_000314.7(PTEN):c.342A>G (p.Glu114=)
NM_000314.7(PTEN):c.349A>C (p.Asn117His) rs771310592
NM_000314.7(PTEN):c.350A>G (p.Asn117Ser) rs551221430
NM_000314.7(PTEN):c.352_353del (p.His118fs) rs876661060
NM_000314.7(PTEN):c.358G>A (p.Ala120Thr) rs786204930
NM_000314.7(PTEN):c.360A>C (p.Ala120=) rs759485888
NM_000314.7(PTEN):c.367C>T (p.His123Tyr) rs786204931
NM_000314.7(PTEN):c.368A>G (p.His123Arg) rs121909222
NM_000314.7(PTEN):c.369C>T (p.His123=) rs1085308045
NM_000314.7(PTEN):c.370T>C (p.Cys124Arg) rs121909223
NM_000314.7(PTEN):c.379G>A (p.Gly127Arg) rs587781255
NM_000314.7(PTEN):c.380del (p.Gly127fs) rs1554898132
NM_000314.7(PTEN):c.385G>A (p.Gly129Arg) rs786204929
NM_000314.7(PTEN):c.386G>A (p.Gly129Glu) rs121909218
NM_000314.7(PTEN):c.388C>T (p.Arg130Ter) rs121909224
NM_000314.7(PTEN):c.389G>A (p.Arg130Gln) rs121909229
NM_000314.7(PTEN):c.389G>T (p.Arg130Leu) rs121909229
NM_000314.7(PTEN):c.392_393dup (p.Gly132fs) rs886041816
NM_000314.7(PTEN):c.395G>A (p.Gly132Asp) rs121909241
NM_000314.7(PTEN):c.395G>T (p.Gly132Val) rs121909241
NM_000314.7(PTEN):c.39_40del (p.Arg14fs) rs587776671
NM_000314.7(PTEN):c.401T>G (p.Met134Arg) rs1085308046
NM_000314.7(PTEN):c.403A>G (p.Ile135Val) rs587782360
NM_000314.7(PTEN):c.405dup (p.Cys136fs) rs398123323
NM_000314.7(PTEN):c.406T>C (p.Cys136Arg) rs786201044
NM_000314.7(PTEN):c.407G>A (p.Cys136Tyr) rs786204859
NM_000314.7(PTEN):c.40A>G (p.Arg14Gly) rs1085308047
NM_000314.7(PTEN):c.414T>G (p.Tyr138Ter) rs1554898161
NM_000314.7(PTEN):c.417A>G (p.Leu139=) rs1057520407
NM_000314.7(PTEN):c.422A>G (p.His141Arg) rs863224666
NM_000314.7(PTEN):c.42G>A (p.Arg14=) rs1064794513
NM_000314.7(PTEN):c.430A>T (p.Lys144Ter) rs1057520622
NM_000314.7(PTEN):c.437T>A (p.Leu146Ter) rs786204933
NM_000314.7(PTEN):c.444A>C (p.Ala148=) rs778663292
NM_000314.7(PTEN):c.44G>A (p.Arg15Lys) rs398123324
NM_000314.7(PTEN):c.454C>T (p.Leu152=) rs1064795450
NM_000314.7(PTEN):c.456A>G (p.Leu152=) rs779626613
NM_000314.7(PTEN):c.45A>T (p.Arg15Ser) rs1064794096
NM_000314.7(PTEN):c.46T>G (p.Tyr16Asp) rs1064796078
NM_000314.7(PTEN):c.46dup (p.Tyr16fs) rs786204883
NM_000314.7(PTEN):c.479C>T (p.Thr160Ile) rs1554898225
NM_000314.7(PTEN):c.47dup (p.Tyr16Ter) rs876661009
NM_000314.7(PTEN):c.487A>T (p.Lys163Ter) rs1554898235
NM_000314.7(PTEN):c.48T>A (p.Tyr16Ter) rs587782187
NM_000314.7(PTEN):c.48T>C (p.Tyr16=) rs587782187
NM_000314.7(PTEN):c.491del (p.Lys164fs) rs786204900
NM_000314.7(PTEN):c.492+14T>A rs1057523132
NM_000314.7(PTEN):c.492+14dup rs1064793690
NM_000314.7(PTEN):c.492+16A>G rs1057522052
NM_000314.7(PTEN):c.492+217C>T
NM_000314.7(PTEN):c.492+292T>C
NM_000314.7(PTEN):c.492+2T>C rs1554898244
NM_000314.7(PTEN):c.492G>A (p.Lys164=) rs146629065
NM_000314.7(PTEN):c.493-13T>C rs1554900488
NM_000314.7(PTEN):c.493-19T>C rs1554900486
NM_000314.7(PTEN):c.493-1G>A rs786204862
NM_000314.7(PTEN):c.493-2A>G rs587781784
NM_000314.7(PTEN):c.493-4C>T rs1057522555
NM_000314.7(PTEN):c.493G>A (p.Gly165Arg) rs587782603
NM_000314.7(PTEN):c.50_51del (p.Gln17fs) rs587781912
NM_000314.7(PTEN):c.511C>T (p.Gln171Ter) rs786204864
NM_000314.7(PTEN):c.513G>A (p.Gln171=) rs1554900546
NM_000314.7(PTEN):c.517C>T (p.Arg173Cys) rs121913293
NM_000314.7(PTEN):c.518G>A (p.Arg173His) rs121913294
NM_000314.7(PTEN):c.521A>G (p.Tyr174Cys) rs864622341
NM_000314.7(PTEN):c.527A>G (p.Tyr176Cys) rs757498880
NM_000314.7(PTEN):c.528T>C (p.Tyr176=) rs1057522285
NM_000314.7(PTEN):c.547_549delinsT (p.Leu182_Lys183insTer) rs786204890
NM_000314.7(PTEN):c.560A>G (p.Asp187Gly) rs786204943
NM_000314.7(PTEN):c.571G>C (p.Val191Leu) rs1060500130
NM_000314.7(PTEN):c.577C>T (p.Leu193=) rs772631069
NM_000314.7(PTEN):c.578T>C (p.Leu193Pro) rs1554900620
NM_000314.7(PTEN):c.579G>A (p.Leu193=) rs568851024
NM_000314.7(PTEN):c.585del (p.His196fs) rs786204901
NM_000314.7(PTEN):c.585dup (p.His196fs) rs786204901
NM_000314.7(PTEN):c.592_594ATG[1] (p.Met199del) rs1064793244
NM_000314.7(PTEN):c.599T>C (p.Phe200Ser) rs786204867
NM_000314.7(PTEN):c.59G>A (p.Gly20Glu) rs1064795967
NM_000314.7(PTEN):c.604A>T (p.Thr202Ser) rs786204944
NM_000314.7(PTEN):c.610C>G (p.Pro204Ala) rs786204868
NM_000314.7(PTEN):c.633C>G (p.Cys211Trp) rs121909232
NM_000314.7(PTEN):c.634+17C>T rs1057522469
NM_000314.7(PTEN):c.634+5G>A rs138336847
NM_000314.7(PTEN):c.635-14A>G rs758742080
NM_000314.7(PTEN):c.635-18A>G rs1057520441
NM_000314.7(PTEN):c.635-1G>C rs876661024
NM_000314.7(PTEN):c.635-6A>G rs1009588340
NM_000314.7(PTEN):c.635-9A>G rs1057520628
NM_000314.7(PTEN):c.640C>T (p.Gln214Ter) rs121909227
NM_000314.7(PTEN):c.64G>C (p.Asp22His) rs876660420
NM_000314.7(PTEN):c.656A>C (p.Gln219Pro) rs1554825172
NM_000314.7(PTEN):c.664G>A (p.Val222Met) rs878853943
NM_000314.7(PTEN):c.673T>C (p.Tyr225His) rs876659433
NM_000314.7(PTEN):c.675T>C (p.Tyr225=) rs1057520900
NM_000314.7(PTEN):c.675T>G (p.Tyr225Ter) rs1057520900
NM_000314.7(PTEN):c.683A>G (p.Asn228Ser) rs748240670
NM_000314.7(PTEN):c.693C>T (p.Pro231=) rs1064795327
NM_000314.7(PTEN):c.697C>T (p.Arg233Ter) rs121909219
NM_000314.7(PTEN):c.700C>T (p.Arg234Trp) rs786201730
NM_000314.7(PTEN):c.702_703delinsC (p.Glu235fs) rs1131691831
NM_000314.7(PTEN):c.70G>T (p.Asp24Tyr) rs786201995
NM_000314.7(PTEN):c.70del (p.Asp24fs) rs1554890405
NM_000314.7(PTEN):c.711G>A (p.Lys237=) rs773353820
NM_000314.7(PTEN):c.720C>T (p.Tyr240=) rs190070312
NM_000314.7(PTEN):c.721T>G (p.Phe241Val) rs1554825207
NM_000314.7(PTEN):c.730C>T (p.Pro244Ser) rs1064794675
NM_000314.7(PTEN):c.734A>C (p.Gln245Pro) rs1057518538
NM_000314.7(PTEN):c.737C>T (p.Pro246Leu) rs587782350
NM_000314.7(PTEN):c.738G>A (p.Pro246=) rs774364894
NM_000314.7(PTEN):c.739_740insAT (p.Leu247fs) rs786204902
NM_000314.7(PTEN):c.740T>G (p.Leu247Ter) rs1057519368
NM_000314.7(PTEN):c.741dup (p.Pro248fs) rs587782341
NM_000314.7(PTEN):c.744del (p.Val249fs) rs1554825224
NM_000314.7(PTEN):c.74T>C (p.Leu25Ser) rs786204912
NM_000314.7(PTEN):c.750T>A (p.Cys250Ter) rs767623493
NM_000314.7(PTEN):c.758_761del (p.Ile253fs) rs786204903
NM_000314.7(PTEN):c.763dup (p.Val255fs) rs1554825240
NM_000314.7(PTEN):c.76A>C (p.Thr26Pro) rs876661010
NM_000314.7(PTEN):c.771_772del (p.Phe258fs) rs786204904
NM_000314.7(PTEN):c.781C>T (p.Gln261Ter) rs730882131
NM_000314.7(PTEN):c.783G>A (p.Gln261=) rs760146269
NM_000314.7(PTEN):c.78C>A (p.Thr26=) rs786201280
NM_000314.7(PTEN):c.78C>T (p.Thr26=) rs786201280
NM_000314.7(PTEN):c.79+7A>G rs374331677
NM_000314.7(PTEN):c.79+7A>T rs374331677
NM_000314.7(PTEN):c.80-11A>G rs776590293
NM_000314.7(PTEN):c.80-1G>C rs786204914
NM_000314.7(PTEN):c.800del (p.Lys267fs) rs121913289
NM_000314.7(PTEN):c.801+15T>C rs1057520830
NM_000314.7(PTEN):c.801+1G>A rs786204873
NM_000314.7(PTEN):c.801+9T>C rs1060503839
NM_000314.7(PTEN):c.802-12T>C rs587781129
NM_000314.7(PTEN):c.802-17T>C rs1057520419
NM_000314.7(PTEN):c.802-207T>C
NM_000314.7(PTEN):c.802-2A>T rs587782455
NM_000314.7(PTEN):c.802-51_802-14del rs557364463
NM_000314.7(PTEN):c.802-6T>G rs1057522284
NM_000314.7(PTEN):c.802-9T>G rs1057520354
NM_000314.7(PTEN):c.808A>G (p.Met270Val) rs1554825502
NM_000314.7(PTEN):c.80A>C (p.Tyr27Ser) rs886041877
NM_000314.7(PTEN):c.822G>A (p.Trp274Ter) rs587782607
NM_000314.7(PTEN):c.831A>G (p.Thr277=) rs376886779
NM_000314.7(PTEN):c.841C>G (p.Pro281Ala) rs750705904
NM_000314.7(PTEN):c.855A>G (p.Glu285=) rs751888926
NM_000314.7(PTEN):c.85_88del (p.Tyr29fs) rs786204894
NM_000314.7(PTEN):c.865_866insTTCT (p.Lys289fs) rs1554825530
NM_000314.7(PTEN):c.869T>C (p.Val290Ala) rs876661234
NM_000314.7(PTEN):c.870A>G (p.Val290=) rs529155918
NM_000314.7(PTEN):c.870del (p.Glu291fs) rs886041332
NM_000314.7(PTEN):c.875del (p.Asn292fs) rs786204905
NM_000314.7(PTEN):c.875dup (p.Asn292fs) rs786204905
NM_000314.7(PTEN):c.882T>G (p.Ser294Arg) rs143335584
NM_000314.7(PTEN):c.884_885insTT (p.Cys296fs) rs587780006
NM_000314.7(PTEN):c.884dup (p.Cys296fs) rs587780006
NM_000314.7(PTEN):c.885A>G (p.Leu295=) rs587780713
NM_000314.7(PTEN):c.889G>T (p.Asp297Tyr) rs370064195
NM_000314.7(PTEN):c.892C>G (p.Gln298Glu) rs371387815
NM_000314.7(PTEN):c.892C>T (p.Gln298Ter) rs371387815
NM_000314.7(PTEN):c.892del (p.Gln298fs) rs786204884
NM_000314.7(PTEN):c.899_903del (p.Ile300fs) rs1064796067
NM_000314.7(PTEN):c.900C>T (p.Ile300=) rs550122918
NM_000314.7(PTEN):c.914G>A (p.Ser305Asn) rs587780007
NM_000314.7(PTEN):c.919G>T (p.Glu307Ter) rs746930141
NM_000314.7(PTEN):c.922C>T (p.Arg308Cys) rs1064794436
NM_000314.7(PTEN):c.928_929insGTGCA (p.Asp310fs) rs786204906
NM_000314.7(PTEN):c.93C>T (p.Asn31=) rs1170214930
NM_000314.7(PTEN):c.941A>C (p.Glu314Ala) rs1171478249
NM_000314.7(PTEN):c.942_943AT[1] (p.Tyr315fs) rs1064796128
NM_000314.7(PTEN):c.945T>A (p.Tyr315Ter) rs876661058
NM_000314.7(PTEN):c.947T>C (p.Leu316Pro) rs1064793345
NM_000314.7(PTEN):c.947del (p.Leu316fs) rs1085307612
NM_000314.7(PTEN):c.94_96ATT[1] (p.Ile33del) rs1554893765
NM_000314.7(PTEN):c.955dup (p.Thr319fs) rs786204892
NM_000314.7(PTEN):c.95T>C (p.Ile32Thr) rs1057518329
NM_000314.7(PTEN):c.964A>T (p.Lys322Ter) rs786202004
NM_000314.7(PTEN):c.968dup (p.Asn323fs) rs121913291
NM_000314.7(PTEN):c.984_998dup (p.Lys330_Asn334dup) rs1057518539
NM_000314.7(PTEN):c.987_990del (p.Asn329fs) rs587782304
NM_001126049.1(KLLN):c.-956G>T rs34149102

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.