ClinVar Miner

List of variants in gene PTEN reported as uncertain significance by GeneDx

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 224
Download table as spreadsheet
HGVS dbSNP
NM_000314.4(PTEN):c.-1002C>T rs786202476
NM_000314.4(PTEN):c.-1013G>T rs786204923
NM_000314.4(PTEN):c.-845A>C rs786204861
NM_000314.4(PTEN):c.-846C>T rs786204860
NM_000314.4(PTEN):c.-848C>T rs1554889977
NM_000314.4(PTEN):c.-850C>T rs559145151
NM_000314.4(PTEN):c.-851G>A rs876661046
NM_000314.4(PTEN):c.-852T>A rs1554889968
NM_000314.4(PTEN):c.-854A>T rs1366254013
NM_000314.4(PTEN):c.-858C>G rs1034838800
NM_000314.4(PTEN):c.-859A>C rs876661029
NM_000314.4(PTEN):c.-859A>G rs876661029
NM_000314.4(PTEN):c.-861G>C rs587776675
NM_000314.4(PTEN):c.-862G>A rs587781706
NM_000314.4(PTEN):c.-863T>C rs1204891831
NM_000314.4(PTEN):c.-864C>T rs537241946
NM_000314.4(PTEN):c.-868G>C rs587782133
NM_000314.4(PTEN):c.-868G>T rs587782133
NM_000314.4(PTEN):c.-869C>T rs786204939
NM_000314.4(PTEN):c.-869_-863delCGGCGCT rs1554889947
NM_000314.4(PTEN):c.-872G>A rs960884250
NM_000314.4(PTEN):c.-890C>T rs1554889945
NM_000314.4(PTEN):c.-892T>C rs786204938
NM_000314.4(PTEN):c.-892delT rs1554889944
NM_000314.4(PTEN):c.-897C>G rs587781981
NM_000314.4(PTEN):c.-903_-882dup rs786204888
NM_000314.4(PTEN):c.-904C>A rs587779997
NM_000314.4(PTEN):c.-904_-903delCGinsGA rs1554889939
NM_000314.4(PTEN):c.-907T>G rs587779998
NM_000314.4(PTEN):c.-909T>G rs550385924
NM_000314.4(PTEN):c.-912T>C rs535142665
NM_000314.4(PTEN):c.-914G>C rs1255473880
NM_000314.4(PTEN):c.-915C>T rs1554889928
NM_000314.4(PTEN):c.-920G>A rs786204937
NM_000314.4(PTEN):c.-923C>T rs786204936
NM_000314.4(PTEN):c.-925G>A rs1554889925
NM_000314.4(PTEN):c.-927C>T rs1158800882
NM_000314.4(PTEN):c.-929G>A rs1554889924
NM_000314.4(PTEN):c.-932G>A rs889785939
NM_000314.4(PTEN):c.-933G>C rs786203419
NM_000314.4(PTEN):c.-940C>T rs1049705048
NM_000314.4(PTEN):c.-942G>A rs786204935
NM_000314.4(PTEN):c.-943C>T rs587779999
NM_000314.4(PTEN):c.-945G>C rs1064795081
NM_000314.4(PTEN):c.-946C>T rs567739104
NM_000314.4(PTEN):c.-953C>G rs1465513356
NM_000314.4(PTEN):c.-955C>A rs1355012894
NM_000314.4(PTEN):c.-955C>G rs1355012894
NM_000314.4(PTEN):c.-955C>T rs1355012894
NM_000314.4(PTEN):c.-956G>C rs786205433
NM_000314.4(PTEN):c.-963C>G rs1052921124
NM_000314.4(PTEN):c.-972C>T rs587781603
NM_000314.4(PTEN):c.-973T>A rs1554889906
NM_000314.4(PTEN):c.-985G>A rs960920744
NM_000314.4(PTEN):c.-986C>T rs876661007
NM_000314.4(PTEN):c.-989T>C rs786204924
NM_000314.4(PTEN):c.-992G>C rs972890157
NM_000314.4(PTEN):c.-993C>G rs587780002
NM_000314.4(PTEN):c.-994_-984dupTCGCCTCCCGC rs587782811
NM_000314.4(PTEN):c.-995C>T rs1554889892
NM_000314.4(PTEN):c.-997C>G rs876661279
NM_000314.4(PTEN):c.-997dupC rs876661265
NM_000314.4(PTEN):c.254-3_254-2delCA rs1064794169
NM_000314.4:c.-(1087_1062)delGCTCGCACCCAGAGCTACCGCTCTGC
NM_000314.4:c.-(903_882)dupGGGACTCTTTATGCGCTGCGGC
NM_000314.6(PTEN):c.-1020C>T rs1064794803
NM_000314.6(PTEN):c.-1027_-1023dup rs1342028958
NM_000314.6(PTEN):c.-1028C>G rs1064795849
NM_000314.6(PTEN):c.-1031C>T rs1064793240
NM_000314.6(PTEN):c.-856C>G rs587779996
NM_000314.6(PTEN):c.-866C>T rs1554889951
NM_000314.6(PTEN):c.-868_-846dup23 rs786204889
NM_000314.6(PTEN):c.-901_-883dup rs1554889937
NM_000314.6(PTEN):c.-903G>C rs1044322
NM_000314.6(PTEN):c.-906G>A rs1064796116
NM_000314.6(PTEN):c.-918G>A rs1064794193
NM_000314.6(PTEN):c.-921G>C rs786203676
NM_000314.6(PTEN):c.-945G>A rs1064795081
NM_000314.6(PTEN):c.-952C>A rs1064794865
NM_000314.6(PTEN):c.-965G>A rs1064794742
NM_000314.6(PTEN):c.-975G>A rs587780001
NM_000314.6(PTEN):c.-975G>T rs587780001
NM_000314.6(PTEN):c.-988C>T rs1064794113
NM_000314.7(PTEN):c.*5T>C rs1006891299
NM_000314.7(PTEN):c.*6T>C rs1064794975
NM_000314.7(PTEN):c.*7T>G rs1064794700
NM_000314.7(PTEN):c.-14A>G rs755295390
NM_000314.7(PTEN):c.-15C>T rs1064793241
NM_000314.7(PTEN):c.-16C>T rs1064793804
NM_000314.7(PTEN):c.-17G>T rs1064793744
NM_000314.7(PTEN):c.-17_-14del rs1064794174
NM_000314.7(PTEN):c.-1C>T rs770965327
NM_000314.7(PTEN):c.-25T>C rs786204909
NM_000314.7(PTEN):c.-26T>C rs750098228
NM_000314.7(PTEN):c.-28C>T rs764917503
NM_000314.7(PTEN):c.-32C>T rs376610243
NM_000314.7(PTEN):c.-32_-30CCT[1] rs749497048
NM_000314.7(PTEN):c.-39_-38TC[2] rs1064795965
NM_000314.7(PTEN):c.-663G>A rs1554890092
NM_000314.7(PTEN):c.-665G>A rs553371022
NM_000314.7(PTEN):c.-667C>T rs786204948
NM_000314.7(PTEN):c.-669_-667GGC[4] rs1376765196
NM_000314.7(PTEN):c.-670C>T rs1554890086
NM_000314.7(PTEN):c.-672T>C rs786204947
NM_000314.7(PTEN):c.-674C>A rs876661258
NM_000314.7(PTEN):c.-678C>T rs1131691255
NM_000314.7(PTEN):c.-682C>G rs1064793892
NM_000314.7(PTEN):c.-685G>A rs786204874
NM_000314.7(PTEN):c.-688G>A rs876661030
NM_000314.7(PTEN):c.-688G>C rs876661030
NM_000314.7(PTEN):c.-691C>T rs1554890066
NM_000314.7(PTEN):c.-695C>G rs1554890065
NM_000314.7(PTEN):c.-700G>A rs1554890059
NM_000314.7(PTEN):c.-703G>C rs1251019969
NM_000314.7(PTEN):c.-713G>A rs587779989
NM_000314.7(PTEN):c.-719G>A rs960387107
NM_000314.7(PTEN):c.-720C>T rs1554890055
NM_000314.7(PTEN):c.-727C>T rs786204870
NM_000314.7(PTEN):c.-729C>G rs786204869
NM_000314.7(PTEN):c.-730C>T rs886039462
NM_000314.7(PTEN):c.-731G>C rs1399617046
NM_000314.7(PTEN):c.-733G>A rs786205432
NM_000314.7(PTEN):c.-733dup rs786204891
NM_000314.7(PTEN):c.-734G>A rs886047384
NM_000314.7(PTEN):c.-734G>C rs886047384
NM_000314.7(PTEN):c.-739G>A rs888482160
NM_000314.7(PTEN):c.-740C>T rs1310141519
NM_000314.7(PTEN):c.-741G>A rs876661008
NM_000314.7(PTEN):c.-743C>T rs1554890027
NM_000314.7(PTEN):c.-748G>A rs994757335
NM_000314.7(PTEN):c.-752C>T rs1554890025
NM_000314.7(PTEN):c.-753A>G rs1554890021
NM_000314.7(PTEN):c.-763G>A rs876661267
NM_000314.7(PTEN):c.-764G>A rs587776674
NM_000314.7(PTEN):c.-767G>T rs587779991
NM_000314.7(PTEN):c.-769G>A rs1255704947
NM_000314.7(PTEN):c.-776G>C rs1064795132
NM_000314.7(PTEN):c.-779_-764dup rs1554890001
NM_000314.7(PTEN):c.-783G>T rs1036616021
NM_000314.7(PTEN):c.-784C>T rs1554890003
NM_000314.7(PTEN):c.-788G>A rs1554889999
NM_000314.7(PTEN):c.-790G>A rs876661209
NM_000314.7(PTEN):c.-794C>G rs786204942
NM_000314.7(PTEN):c.-796G>T rs786204941
NM_000314.7(PTEN):c.-797A>G rs577569375
NM_000314.7(PTEN):c.-798G>C rs587779992
NM_000314.7(PTEN):c.-7C>T rs1064795131
NM_000314.7(PTEN):c.-801G>A rs876661166
NM_000314.7(PTEN):c.-805G>A rs944586541
NM_000314.7(PTEN):c.-811A>G rs1554889993
NM_000314.7(PTEN):c.-813G>A rs876661178
NM_000314.7(PTEN):c.-814T>C rs1050226735
NM_000314.7(PTEN):c.-818A>G rs931643553
NM_000314.7(PTEN):c.-820C>A rs1064793784
NM_000314.7(PTEN):c.-821G>C rs587779993
NM_000314.7(PTEN):c.-821G>T rs587779993
NM_000314.7(PTEN):c.-827G>A rs978944900
NM_000314.7(PTEN):c.-832C>T rs1262674767
NM_000314.7(PTEN):c.-834C>T rs587779994
NM_000314.7(PTEN):c.-836C>T rs786204940
NM_000314.7(PTEN):c.-837C>G rs786201900
NM_000314.7(PTEN):c.-839C>T rs587781920
NM_000314.7(PTEN):c.-843T>C rs587779995
NM_000314.7(PTEN):c.-843_-841delinsCTT rs1554889983
NM_000314.7(PTEN):c.-909T>C rs550385924
NM_000314.7(PTEN):c.-975G>C rs587780001
NM_000314.7(PTEN):c.1018A>C (p.Asn340His) rs759852661
NM_000314.7(PTEN):c.1025A>C (p.Lys342Thr) rs1064794080
NM_000314.7(PTEN):c.1026G>A (p.Lys342=) rs398123314
NM_000314.7(PTEN):c.1052_1054del (p.Val351del) rs587780003
NM_000314.7(PTEN):c.1061C>A (p.Pro354Gln) rs375709098
NM_000314.7(PTEN):c.1066A>T (p.Asn356Tyr) rs587782345
NM_000314.7(PTEN):c.1069C>A (p.Pro357Thr) rs876661264
NM_000314.7(PTEN):c.1078A>G (p.Ser360Gly) rs587781273
NM_000314.7(PTEN):c.1093G>A (p.Val365Ile) rs758542021
NM_000314.7(PTEN):c.1105G>A (p.Val369Ile) rs587782224
NM_000314.7(PTEN):c.1171C>T (p.Pro391Ser) rs786203911
NM_000314.7(PTEN):c.1190A>G (p.His397Arg) rs876661021
NM_000314.7(PTEN):c.1206A>C (p.Lys402Asn) rs1064796017
NM_000314.7(PTEN):c.126_128dup (p.Glu43_Gly44insAsp) rs786204896
NM_000314.7(PTEN):c.136T>G (p.Tyr46Asp) rs1064793325
NM_000314.7(PTEN):c.160G>A (p.Val54Ile) rs786204916
NM_000314.7(PTEN):c.173A>G (p.Asp58Gly) rs1131691885
NM_000314.7(PTEN):c.206A>G (p.Asn69Ser) rs786204922
NM_000314.7(PTEN):c.244A>G (p.Asn82Asp) rs1064793242
NM_000314.7(PTEN):c.253+4_253+7del rs876659695
NM_000314.7(PTEN):c.349A>C (p.Asn117His) rs771310592
NM_000314.7(PTEN):c.350A>G (p.Asn117Ser) rs551221430
NM_000314.7(PTEN):c.358G>A (p.Ala120Thr) rs786204930
NM_000314.7(PTEN):c.422A>G (p.His141Arg) rs863224666
NM_000314.7(PTEN):c.42G>A (p.Arg14=) rs1064794513
NM_000314.7(PTEN):c.454C>T (p.Leu152=) rs1064795450
NM_000314.7(PTEN):c.492G>A (p.Lys164=) rs146629065
NM_000314.7(PTEN):c.527A>G (p.Tyr176Cys) rs757498880
NM_000314.7(PTEN):c.560A>G (p.Asp187Gly) rs786204943
NM_000314.7(PTEN):c.571G>C (p.Val191Leu) rs1060500130
NM_000314.7(PTEN):c.592_594ATG[1] (p.Met199del) rs1064793244
NM_000314.7(PTEN):c.59G>A (p.Gly20Glu) rs1064795967
NM_000314.7(PTEN):c.604A>T (p.Thr202Ser) rs786204944
NM_000314.7(PTEN):c.635-9A>G rs1057520628
NM_000314.7(PTEN):c.64G>C (p.Asp22His) rs876660420
NM_000314.7(PTEN):c.656A>C (p.Gln219Pro) rs1554825172
NM_000314.7(PTEN):c.664G>A (p.Val222Met) rs878853943
NM_000314.7(PTEN):c.673T>C (p.Tyr225His) rs876659433
NM_000314.7(PTEN):c.683A>G (p.Asn228Ser) rs748240670
NM_000314.7(PTEN):c.693C>T (p.Pro231=) rs1064795327
NM_000314.7(PTEN):c.700C>T (p.Arg234Trp) rs786201730
NM_000314.7(PTEN):c.721T>G (p.Phe241Val) rs1554825207
NM_000314.7(PTEN):c.730C>T (p.Pro244Ser) rs1064794675
NM_000314.7(PTEN):c.734A>C (p.Gln245Pro) rs1057518538
NM_000314.7(PTEN):c.74T>C (p.Leu25Ser) rs786204912
NM_000314.7(PTEN):c.79+7A>T rs374331677
NM_000314.7(PTEN):c.808A>G (p.Met270Val) rs1554825502
NM_000314.7(PTEN):c.841C>G (p.Pro281Ala) rs750705904
NM_000314.7(PTEN):c.869T>C (p.Val290Ala) rs876661234
NM_000314.7(PTEN):c.882T>G (p.Ser294Arg) rs143335584
NM_000314.7(PTEN):c.889G>T (p.Asp297Tyr) rs370064195
NM_000314.7(PTEN):c.892C>G (p.Gln298Glu) rs371387815
NM_000314.7(PTEN):c.914G>A (p.Ser305Asn) rs587780007
NM_000314.7(PTEN):c.922C>T (p.Arg308Cys) rs1064794436
NM_000314.7(PTEN):c.941A>C (p.Glu314Ala) rs1171478249
NM_000314.7(PTEN):c.947T>C (p.Leu316Pro) rs1064793345
NM_000314.7(PTEN):c.95T>C (p.Ile32Thr) rs1057518329
NM_000314.7(PTEN):c.984_998dup (p.Lys330_Asn334dup) rs1057518539

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.