ClinVar Miner

List of variants in gene combination RAD51D, RAD51L3-RFFL studied for Breast-ovarian cancer, familial 4

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 354
Download table as spreadsheet
HGVS dbSNP
NC_000017.11:g.(?_35099792)_(35103544_?)del
NC_000017.11:g.(?_35100947)_(35101042_?)del
NC_000017.11:g.(?_35100947)_(35119619_?)dup
NC_000017.11:g.(?_35103244)_(35119623_?)del
NC_000017.11:g.(?_35106380)_(35107453_?)del
NC_000017.11:g.(?_35118491)_(35118629_?)del
NC_000017.11:g.(?_35118491)_(35119623_?)del
NC_000017.11:g.(?_35118495)_(35119619_?)del
NM_002878.3(RAD51D):c.-238A>T rs188262287
NM_002878.3(RAD51D):c.-99T>C rs533209845
NM_002878.3(RAD51D):c.100G>A (p.Ala34Thr) rs1555570419
NM_002878.3(RAD51D):c.101C>T (p.Ala34Val) rs876658968
NM_002878.3(RAD51D):c.105C>T (p.Asp35=) rs1555570413
NM_002878.3(RAD51D):c.108G>A (p.Leu36=) rs755962971
NM_002878.3(RAD51D):c.109G>C (p.Glu37Gln) rs876659848
NM_002878.3(RAD51D):c.116T>G (p.Val39Gly)
NM_002878.3(RAD51D):c.126A>G (p.Lys42=) rs145361433
NM_002878.3(RAD51D):c.12C>G (p.Leu4=) rs786203193
NM_002878.3(RAD51D):c.131G>A (p.Gly44Asp) rs374730714
NM_002878.3(RAD51D):c.131G>C (p.Gly44Ala) rs374730714
NM_002878.3(RAD51D):c.131_144+24del38 rs1064795716
NM_002878.3(RAD51D):c.137C>G (p.Ser46Cys) rs587780102
NM_002878.3(RAD51D):c.141C>A (p.Tyr47Ter)
NM_002878.3(RAD51D):c.144+1_144+11delinsCC rs1555570397
NM_002878.3(RAD51D):c.144+3G>T rs761057565
NM_002878.3(RAD51D):c.144+8C>T rs1060504766
NM_002878.3(RAD51D):c.145-13G>T rs760867838
NM_002878.3(RAD51D):c.145-14G>C rs200470533
NM_002878.3(RAD51D):c.145-3C>T rs201974522
NM_002878.3(RAD51D):c.145-4G>A rs201361465
NM_002878.3(RAD51D):c.145-4_145-3delGCinsTT rs786202099
NM_002878.3(RAD51D):c.145-9C>T rs1555570311
NM_002878.3(RAD51D):c.146C>T (p.Ala49Val) rs140317560
NM_002878.3(RAD51D):c.148delC (p.Leu50Trpfs) rs1555570301
NM_002878.3(RAD51D):c.152T>C (p.Val51Ala) rs1060502962
NM_002878.3(RAD51D):c.163C>T (p.Arg55Trp) rs775268017
NM_002878.3(RAD51D):c.164G>A (p.Arg55Gln) rs151198586
NM_002878.3(RAD51D):c.165G>C (p.Arg55=) rs1555570292
NM_002878.3(RAD51D):c.171G>A (p.Leu57=) rs786202885
NM_002878.3(RAD51D):c.185C>A (p.Ser62Ter) rs374357106
NM_002878.3(RAD51D):c.185C>T (p.Ser62Leu) rs374357106
NM_002878.3(RAD51D):c.186G>A (p.Ser62=) rs746984258
NM_002878.3(RAD51D):c.195C>G (p.Pro65=) rs376616485
NM_002878.3(RAD51D):c.195C>T (p.Pro65=) rs376616485
NM_002878.3(RAD51D):c.196G>A (p.Val66Met) rs56026142
NM_002878.3(RAD51D):c.198G>T (p.Val66=) rs200810304
NM_002878.3(RAD51D):c.1A>G (p.Met1Val) rs561425038
NM_002878.3(RAD51D):c.1A>T (p.Met1Leu) rs561425038
NM_002878.3(RAD51D):c.202G>A (p.Gly68Ser) rs775045445
NM_002878.3(RAD51D):c.204C>A (p.Gly68=) rs764351040
NM_002878.3(RAD51D):c.204C>T (p.Gly68=) rs764351040
NM_002878.3(RAD51D):c.205G>A (p.Ala69Thr) rs763439048
NM_002878.3(RAD51D):c.208G>A (p.Asp70Asn) rs142189122
NM_002878.3(RAD51D):c.20G>A (p.Gly7Glu) rs1555570504
NM_002878.3(RAD51D):c.210_229delTCTCTACGAGGAACTGAAGA (p.Tyr72Hisfs) rs1555570266
NM_002878.3(RAD51D):c.216C>A (p.Tyr72Ter) rs148690585
NM_002878.3(RAD51D):c.216C>T (p.Tyr72=) rs148690585
NM_002878.3(RAD51D):c.217G>A (p.Glu73Lys) rs369946779
NM_002878.3(RAD51D):c.223C>T (p.Leu75=) rs746929682
NM_002878.3(RAD51D):c.229A>G (p.Thr77Ala) rs1555570264
NM_002878.3(RAD51D):c.22C>T (p.Leu8=) rs876659203
NM_002878.3(RAD51D):c.230C>T (p.Thr77Ile) rs777826765
NM_002878.3(RAD51D):c.231C>G (p.Thr77=) rs376670250
NM_002878.3(RAD51D):c.233C>T (p.Ser78Phe) rs1555570255
NM_002878.3(RAD51D):c.234C>T (p.Ser78=) rs9901455
NM_002878.3(RAD51D):c.234_235invCA (p.Thr79Ala)
NM_002878.3(RAD51D):c.241A>T (p.Ile81Phe)
NM_002878.3(RAD51D):c.250A>G (p.Thr84Ala) rs200018296
NM_002878.3(RAD51D):c.259G>A (p.Gly87Ser) rs767681165
NM_002878.3(RAD51D):c.263+1455delA rs979233150
NM_002878.3(RAD51D):c.263+1507_263+1509delTGC rs753760360
NM_002878.3(RAD51D):c.263+1509C>T rs201506572
NM_002878.3(RAD51D):c.263+1570T>A rs376472075
NM_002878.3(RAD51D):c.263+1588A>G rs180869630
NM_002878.3(RAD51D):c.263+1596T>C rs1057517631
NM_002878.3(RAD51D):c.263+1597C>A rs755753106
NM_002878.3(RAD51D):c.263+1605G>A rs147933658
NM_002878.3(RAD51D):c.263+1612delA rs750282687
NM_002878.3(RAD51D):c.263+1627C>T rs188981311
NM_002878.3(RAD51D):c.263+2T>C rs200564819
NM_002878.3(RAD51D):c.263+5G>A
NM_002878.3(RAD51D):c.263+7G>A rs56218020
NM_002878.3(RAD51D):c.264-14delT rs757481281
NM_002878.3(RAD51D):c.264-8G>A rs759532599
NM_002878.3(RAD51D):c.266T>C (p.Leu89Pro)
NM_002878.3(RAD51D):c.26G>C (p.Cys9Ser) rs140825795
NM_002878.3(RAD51D):c.26G>T (p.Cys9Phe) rs140825795
NM_002878.3(RAD51D):c.270_271dupTA (p.Lys91Ilefs) rs753862052
NM_002878.3(RAD51D):c.27C>T (p.Cys9=) rs200487648
NM_002878.3(RAD51D):c.286G>T (p.Gly96Cys) rs762951311
NM_002878.3(RAD51D):c.292T>A (p.Tyr98Asn) rs730881946
NM_002878.3(RAD51D):c.296C>T (p.Thr99Ile)
NM_002878.3(RAD51D):c.29C>T (p.Pro10Leu) rs759505297
NM_002878.3(RAD51D):c.301G>C (p.Glu101Gln) rs1060502951
NM_002878.3(RAD51D):c.305T>G (p.Val102Gly) rs1555568494
NM_002878.3(RAD51D):c.307A>G (p.Thr103Ala) rs781378161
NM_002878.3(RAD51D):c.314T>C (p.Ile105Thr) rs368838910
NM_002878.3(RAD51D):c.324C>T (p.Gly108=) rs758132417
NM_002878.3(RAD51D):c.326dupC (p.Gly110Argfs) rs730882119
NM_002878.3(RAD51D):c.330dupT (p.Ser111Terfs) rs786202434
NM_002878.3(RAD51D):c.332G>A (p.Ser111Asn) rs786203407
NM_002878.3(RAD51D):c.333C>A (p.Ser111Arg)
NM_002878.3(RAD51D):c.333C>T (p.Ser111=) rs369396909
NM_002878.3(RAD51D):c.335G>A (p.Gly112Asp) rs587782848
NM_002878.3(RAD51D):c.339A>C (p.Lys113Asn) rs786202507
NM_002878.3(RAD51D):c.33C>T (p.Gly11=) rs760444811
NM_002878.3(RAD51D):c.343C>T (p.Gln115Ter) rs1555568473
NM_002878.3(RAD51D):c.345+2T>C rs876659394
NM_002878.3(RAD51D):c.345+4C>T rs918947511
NM_002878.3(RAD51D):c.345+5A>G rs878854562
NM_002878.3(RAD51D):c.345+5A>T rs878854562
NM_002878.3(RAD51D):c.346-10C>T rs779972784
NM_002878.3(RAD51D):c.346-3C>A rs758583343
NM_002878.3(RAD51D):c.346-4C>G rs767328693
NM_002878.3(RAD51D):c.346-6C>A rs1555568392
NM_002878.3(RAD51D):c.346-7C>T rs1060504768
NM_002878.3(RAD51D):c.346-8A>G rs756059587
NM_002878.3(RAD51D):c.346-8A>T rs756059587
NM_002878.3(RAD51D):c.346-9C>A rs878854563
NM_002878.3(RAD51D):c.349T>A (p.Cys117Ser) rs786201358
NM_002878.3(RAD51D):c.34C>G (p.Leu12Val) rs773065220
NM_002878.3(RAD51D):c.351T>A (p.Cys117Ter) rs1555568382
NM_002878.3(RAD51D):c.355T>C (p.Cys119Arg) rs201313861
NM_002878.3(RAD51D):c.356G>A (p.Cys119Tyr) rs759730492
NM_002878.3(RAD51D):c.356G>C (p.Cys119Ser)
NM_002878.3(RAD51D):c.357_360delTATG (p.Cys119Trpfs) rs876658297
NM_002878.3(RAD51D):c.358A>C (p.Met120Leu) rs876659998
NM_002878.3(RAD51D):c.363delA (p.Ala122Glnfs) rs730881935
NM_002878.3(RAD51D):c.368A>G (p.Asn123Ser) rs918988936
NM_002878.3(RAD51D):c.374C>T (p.Ala125Val) rs1390812423
NM_002878.3(RAD51D):c.382C>T (p.Leu128=) rs1438461174
NM_002878.3(RAD51D):c.38C>T (p.Thr13Ile) rs1064795830
NM_002878.3(RAD51D):c.392A>G (p.Asn131Ser) rs1060502954
NM_002878.3(RAD51D):c.394G>A (p.Val132Ile) rs201141245
NM_002878.3(RAD51D):c.395T>A (p.Val132Asp) rs1555568342
NM_002878.3(RAD51D):c.39C>G (p.Thr13=) rs146448657
NM_002878.3(RAD51D):c.407A>G (p.Asp136Gly) rs768197423
NM_002878.3(RAD51D):c.409T>G (p.Ser137Ala) rs1555568327
NM_002878.3(RAD51D):c.40G>A (p.Glu14Lys) rs562456790
NM_002878.3(RAD51D):c.412A>C (p.Asn138His) rs141690729
NM_002878.3(RAD51D):c.412A>G (p.Asn138Asp) rs141690729
NM_002878.3(RAD51D):c.413A>G (p.Asn138Ser) rs201676898
NM_002878.3(RAD51D):c.419G>A (p.Gly140Glu) rs730881945
NM_002878.3(RAD51D):c.422T>C (p.Leu141Pro) rs780938875
NM_002878.3(RAD51D):c.431C>T (p.Ser144Phe) rs587781875
NM_002878.3(RAD51D):c.433C>T (p.Arg145Cys) rs755173206
NM_002878.3(RAD51D):c.434G>A (p.Arg145His) rs147264215
NM_002878.3(RAD51D):c.436C>T (p.Leu146Phe) rs371812219
NM_002878.3(RAD51D):c.438C>T (p.Leu146=) rs145452047
NM_002878.3(RAD51D):c.439C>T (p.Leu147Phe)
NM_002878.3(RAD51D):c.440_442delTCC (p.Leu147del) rs1555568303
NM_002878.3(RAD51D):c.445C>T (p.Leu149=) rs1555568301
NM_002878.3(RAD51D):c.451C>T (p.Gln151Ter) rs587781756
NM_002878.3(RAD51D):c.456T>C (p.Ala152=) rs921214343
NM_002878.3(RAD51D):c.461_462insTT (p.Gln155Serfs) rs1555568296
NM_002878.3(RAD51D):c.463C>T (p.Gln155Ter) rs1555568293
NM_002878.3(RAD51D):c.476A>G (p.Glu159Gly) rs1555568282
NM_002878.3(RAD51D):c.478C>G (p.Gln160Glu) rs1057521922
NM_002878.3(RAD51D):c.478C>T (p.Gln160Ter) rs1057521922
NM_002878.3(RAD51D):c.480+6G>A rs1057523143
NM_002878.3(RAD51D):c.480G>C (p.Gln160His)
NM_002878.3(RAD51D):c.481-10A>G rs1555568182
NM_002878.3(RAD51D):c.481-4T>G rs876659339
NM_002878.3(RAD51D):c.481-5T>G rs374382703
NM_002878.3(RAD51D):c.481-7G>A rs145832514
NM_002878.3(RAD51D):c.481-8C>T rs762247126
NM_002878.3(RAD51D):c.490C>G (p.Leu164Val) rs878854564
NM_002878.3(RAD51D):c.491T>C (p.Leu164Pro) rs769287847
NM_002878.3(RAD51D):c.493C>G (p.Arg165Gly) rs544654228
NM_002878.3(RAD51D):c.493C>T (p.Arg165Trp) rs544654228
NM_002878.3(RAD51D):c.494G>A (p.Arg165Gln) rs4796033
NM_002878.3(RAD51D):c.496A>G (p.Arg166Gly) rs1064793246
NM_002878.3(RAD51D):c.4G>A (p.Gly2Ser) rs372082751
NM_002878.3(RAD51D):c.507G>A (p.Val169=) rs1555568162
NM_002878.3(RAD51D):c.509T>C (p.Val170Ala) rs370679685
NM_002878.3(RAD51D):c.510G>A (p.Val170=) rs142134504
NM_002878.3(RAD51D):c.515C>T (p.Ala172Val)
NM_002878.3(RAD51D):c.532A>G (p.Met178Val) rs786202505
NM_002878.3(RAD51D):c.53A>G (p.Gln18Arg) rs546225564
NM_002878.3(RAD51D):c.541G>A (p.Val181Met) rs876658678
NM_002878.3(RAD51D):c.547C>T (p.Gln183Ter) rs587782695
NM_002878.3(RAD51D):c.549G>A (p.Gln183=) rs1555568122
NM_002878.3(RAD51D):c.54G>T (p.Gln18His) rs1331918329
NM_002878.3(RAD51D):c.550G>A (p.Glu184Lys) rs200009601
NM_002878.3(RAD51D):c.551A>T (p.Glu184Val) rs1060502960
NM_002878.3(RAD51D):c.556C>T (p.Arg186Ter) rs387906843
NM_002878.3(RAD51D):c.567G>A (p.Val189=) rs373975416
NM_002878.3(RAD51D):c.568G>A (p.Ala190Thr) rs80116829
NM_002878.3(RAD51D):c.56T>C (p.Leu19Pro) rs1044486334
NM_002878.3(RAD51D):c.570C>T (p.Ala190=) rs750479232
NM_002878.3(RAD51D):c.575A>G (p.Gln192Arg) rs876660090
NM_002878.3(RAD51D):c.576+1G>A rs781161543
NM_002878.3(RAD51D):c.577-10A>C rs1060504767
NM_002878.3(RAD51D):c.577-10A>G rs1060504767
NM_002878.3(RAD51D):c.577-7C>T rs1438561890
NM_002878.3(RAD51D):c.583G>A (p.Gly195Ser)
NM_002878.3(RAD51D):c.598G>A (p.Val200Met)
NM_002878.3(RAD51D):c.59T>G (p.Leu20Arg) rs1555570486
NM_002878.3(RAD51D):c.5G>A (p.Gly2Asp) rs763716638
NM_002878.3(RAD51D):c.5G>C (p.Gly2Ala) rs763716638
NM_002878.3(RAD51D):c.600G>T (p.Val200=) rs755393515
NM_002878.3(RAD51D):c.604G>A (p.Val202Met)
NM_002878.3(RAD51D):c.606G>C (p.Val202=) rs1555567627
NM_002878.3(RAD51D):c.607G>A (p.Val203Met) rs730881947
NM_002878.3(RAD51D):c.609_611delGGT (p.Val205del) rs730881944
NM_002878.3(RAD51D):c.615G>A (p.Val205=) rs1555567620
NM_002878.3(RAD51D):c.619T>C (p.Ser207Pro) rs372365287
NM_002878.3(RAD51D):c.620C>T (p.Ser207Leu) rs370228071
NM_002878.3(RAD51D):c.621G>A (p.Ser207=) rs749859221
NM_002878.3(RAD51D):c.621G>T (p.Ser207=) rs749859221
NM_002878.3(RAD51D):c.623T>C (p.Val208Ala) rs1064795673
NM_002878.3(RAD51D):c.625A>C (p.Thr209Pro) rs1555567603
NM_002878.3(RAD51D):c.627T>C (p.Thr209=) rs141545966
NM_002878.3(RAD51D):c.629C>A (p.Ala210Glu) rs376855484
NM_002878.3(RAD51D):c.629C>T (p.Ala210Val) rs376855484
NM_002878.3(RAD51D):c.630G>A (p.Ala210=) rs762585552
NM_002878.3(RAD51D):c.631G>A (p.Val211Met)
NM_002878.3(RAD51D):c.640C>T (p.Pro214Ser) rs1060502955
NM_002878.3(RAD51D):c.641C>A (p.Pro214Gln) rs910355512
NM_002878.3(RAD51D):c.641C>T (p.Pro214Leu)
NM_002878.3(RAD51D):c.649G>T (p.Gly217Ter) rs775365939
NM_002878.3(RAD51D):c.649_655delGGAGGTCinsTGAGGTT (p.Gly217Ter) rs587781527
NM_002878.3(RAD51D):c.655C>T (p.Gln219Ter) rs771007945
NM_002878.3(RAD51D):c.666A>G (p.Glu222=) rs114012742
NM_002878.3(RAD51D):c.667+9T>C rs772193051
NM_002878.3(RAD51D):c.668-2A>C
NM_002878.3(RAD51D):c.668-4G>A rs1001440122
NM_002878.3(RAD51D):c.668-9C>T rs1555567544
NM_002878.3(RAD51D):c.66C>T (p.Ser22=) rs876660902
NM_002878.3(RAD51D):c.673G>A (p.Ala225Thr) rs28363282
NM_002878.3(RAD51D):c.680T>C (p.Met227Thr) rs773485482
NM_002878.3(RAD51D):c.685C>T (p.Gln229Ter) rs1555567529
NM_002878.3(RAD51D):c.687G>C (p.Gln229His) rs1555567528
NM_002878.3(RAD51D):c.68A>G (p.His23Arg) rs990062370
NM_002878.3(RAD51D):c.690G>A (p.Leu230=) rs1555567526
NM_002878.3(RAD51D):c.694C>A (p.Arg232=) rs587780104
NM_002878.3(RAD51D):c.694C>T (p.Arg232Ter) rs587780104
NM_002878.3(RAD51D):c.695G>A (p.Arg232Gln) rs28363283
NM_002878.3(RAD51D):c.695G>C (p.Arg232Pro)
NM_002878.3(RAD51D):c.698A>G (p.Glu233Gly) rs28363284
NM_002878.3(RAD51D):c.6C>A (p.Gly2=) rs1255954226
NM_002878.3(RAD51D):c.6_13dup (p.Arg5Thrfs) rs1555570506
NM_002878.3(RAD51D):c.704A>T (p.Lys235Met) rs1040279995
NM_002878.3(RAD51D):c.70A>G (p.Arg24Gly) rs781611267
NM_002878.3(RAD51D):c.70A>T (p.Arg24Trp) rs781611267
NM_002878.3(RAD51D):c.713C>T (p.Ala238Val)
NM_002878.3(RAD51D):c.715C>G (p.Arg239Gly) rs770250516
NM_002878.3(RAD51D):c.715C>T (p.Arg239Trp) rs770250516
NM_002878.3(RAD51D):c.716G>A (p.Arg239Gln) rs780921112
NM_002878.3(RAD51D):c.724G>A (p.Gly242Ser)
NM_002878.3(RAD51D):c.726C>T (p.Gly242=) rs1555567496
NM_002878.3(RAD51D):c.728dupT (p.Met243Ilefs) rs1060502958
NM_002878.3(RAD51D):c.72G>T (p.Arg24Ser) rs28363257
NM_002878.3(RAD51D):c.734T>C (p.Val245Ala) rs1060502956
NM_002878.3(RAD51D):c.738+10C>A rs777453585
NM_002878.3(RAD51D):c.738+1G>A
NM_002878.3(RAD51D):c.739-10T>C rs199998187
NM_002878.3(RAD51D):c.739-3C>T rs1235042092
NM_002878.3(RAD51D):c.739-6delC rs1555567208
NM_002878.3(RAD51D):c.739-?_*1161del
NM_002878.3(RAD51D):c.739G>C (p.Val247Leu) rs1060502952
NM_002878.3(RAD51D):c.740_741dup (p.Thr248Terfs) rs1555567197
NM_002878.3(RAD51D):c.745A>G (p.Asn249Asp) rs730881949
NM_002878.3(RAD51D):c.748delC (p.His250Thrfs) rs587780105
NM_002878.3(RAD51D):c.751A>G (p.Ile251Val) rs540273429
NM_002878.3(RAD51D):c.757C>A (p.Arg253=) rs137886232
NM_002878.3(RAD51D):c.757C>T (p.Arg253Ter) rs137886232
NM_002878.3(RAD51D):c.758G>A (p.Arg253Gln) rs1060502963
NM_002878.3(RAD51D):c.75C>T (p.Ile25=) rs1555570482
NM_002878.3(RAD51D):c.763A>G (p.Arg255Gly) rs1060502953
NM_002878.3(RAD51D):c.764G>A (p.Arg255Lys) rs1056851142
NM_002878.3(RAD51D):c.765G>A (p.Arg255=) rs751833940
NM_002878.3(RAD51D):c.771C>T (p.Ser257=) rs146212490
NM_002878.3(RAD51D):c.772G>A (p.Gly258Arg) rs181695922
NM_002878.3(RAD51D):c.772_778delGGGAGGC (p.Gly258Serfs) rs1064795045
NM_002878.3(RAD51D):c.77A>G (p.Lys26Arg) rs1060502961
NM_002878.3(RAD51D):c.782A>C (p.Lys261Thr) rs1060502964
NM_002878.3(RAD51D):c.784C>A (p.Pro262Thr) rs1340405420
NM_002878.3(RAD51D):c.785C>T (p.Pro262Leu) rs730881950
NM_002878.3(RAD51D):c.792C>G (p.Leu264=) rs536544621
NM_002878.3(RAD51D):c.792C>T (p.Leu264=) rs536544621
NM_002878.3(RAD51D):c.793G>A (p.Gly265Arg) rs140285068
NM_002878.3(RAD51D):c.796C>T (p.Arg266Cys) rs587781813
NM_002878.3(RAD51D):c.797G>A (p.Arg266His) rs779808083
NM_002878.3(RAD51D):c.7G>A (p.Val3Met) rs758124349
NM_002878.3(RAD51D):c.802T>A (p.Trp268Arg) rs755965977
NM_002878.3(RAD51D):c.803G>A (p.Trp268Ter) rs750219200
NM_002878.3(RAD51D):c.80C>A (p.Thr27Lys) rs139642328
NM_002878.3(RAD51D):c.80C>T (p.Thr27Ile) rs139642328
NM_002878.3(RAD51D):c.81delA (p.Val28Trpfs) rs1064793952
NM_002878.3(RAD51D):c.823C>A (p.Arg275=) rs752780416
NM_002878.3(RAD51D):c.823C>T (p.Arg275Trp) rs752780416
NM_002878.3(RAD51D):c.824G>A (p.Arg275Gln) rs368914740
NM_002878.3(RAD51D):c.826A>C (p.Ile276Leu) rs1555567119
NM_002878.3(RAD51D):c.829C>G (p.Leu277Val) rs1285339297
NM_002878.3(RAD51D):c.83-3C>T rs1555570424
NM_002878.3(RAD51D):c.833T>C (p.Leu278Pro)
NM_002878.3(RAD51D):c.835G>A (p.Asp279Asn) rs765271127
NM_002878.3(RAD51D):c.839C>G (p.Thr280Ser) rs548111162
NM_002878.3(RAD51D):c.840C>T (p.Thr280=) rs751885496
NM_002878.3(RAD51D):c.842T>C (p.Ile281Thr) rs1060502957
NM_002878.3(RAD51D):c.843C>T (p.Ile281=) rs754455433
NM_002878.3(RAD51D):c.844G>A (p.Glu282Lys)
NM_002878.3(RAD51D):c.849A>C (p.Gly283=) rs766847072
NM_002878.3(RAD51D):c.854G>T (p.Gly285Val) rs878854565
NM_002878.3(RAD51D):c.85delG (p.Val29Trpfs) rs1057517586
NM_002878.3(RAD51D):c.862G>C (p.Gly288Arg) rs1391505912
NM_002878.3(RAD51D):c.864C>T (p.Gly288=) rs138557828
NM_002878.3(RAD51D):c.865G>A (p.Gly289Ser) rs587782129
NM_002878.3(RAD51D):c.868C>T (p.Arg290Trp) rs527964137
NM_002878.3(RAD51D):c.869G>A (p.Arg290Gln) rs773883374
NM_002878.3(RAD51D):c.871C>T (p.Arg291Cys) rs372038369
NM_002878.3(RAD51D):c.872G>A (p.Arg291His) rs150134822
NM_002878.3(RAD51D):c.873C>T (p.Arg291=) rs140848654
NM_002878.3(RAD51D):c.874A>G (p.Met292Val) rs1555567076
NM_002878.3(RAD51D):c.878C>A (p.Ala293Glu) rs769732230
NM_002878.3(RAD51D):c.878C>T (p.Ala293Val) rs769732230
NM_002878.3(RAD51D):c.879G>A (p.Ala293=) rs368209468
NM_002878.3(RAD51D):c.879G>C (p.Ala293=) rs368209468
NM_002878.3(RAD51D):c.879G>T (p.Ala293=) rs368209468
NM_002878.3(RAD51D):c.87_101dup (p.Leu36_Glu37insValSerAlaAspLeu) rs1555570417
NM_002878.3(RAD51D):c.883C>G (p.Leu295Val) rs752910287
NM_002878.3(RAD51D):c.885G>A (p.Leu295=) rs876659714
NM_002878.3(RAD51D):c.886G>T (p.Ala296Ser) rs374019782
NM_002878.3(RAD51D):c.888C>G (p.Ala296=) rs755177638
NM_002878.3(RAD51D):c.898C>T (p.Arg300Ter) rs750621215
NM_002878.3(RAD51D):c.898delC (p.Arg300Aspfs) rs786202251
NM_002878.3(RAD51D):c.899G>A (p.Arg300Gln) rs761290755
NM_002878.3(RAD51D):c.900A>G (p.Arg300=) rs370634278
NM_002878.3(RAD51D):c.901C>T (p.Gln301Ter) rs1060502959
NM_002878.3(RAD51D):c.904-11T>A rs374449943
NM_002878.3(RAD51D):c.904-2A>T rs1403784434
NM_002878.3(RAD51D):c.904-3C>T rs45478491
NM_002878.3(RAD51D):c.904-6_904-4delTTC rs779850240
NM_002878.3(RAD51D):c.905C>T (p.Pro302Leu) rs1555567003
NM_002878.3(RAD51D):c.90C>T (p.Asp30=) rs374725981
NM_002878.3(RAD51D):c.910G>T (p.Gly304Cys) rs759392029
NM_002878.3(RAD51D):c.911G>A (p.Gly304Asp) rs200615280
NM_002878.3(RAD51D):c.919G>A (p.Glu307Lys) rs115031549
NM_002878.3(RAD51D):c.922A>G (p.Met308Val) rs786201961
NM_002878.3(RAD51D):c.924_932delGGTAGACAT (p.Met308_Asp310del) rs1555566974
NM_002878.3(RAD51D):c.932T>A (p.Ile311Asn) rs145309168
NM_002878.3(RAD51D):c.932T>C (p.Ile311Thr) rs145309168
NM_002878.3(RAD51D):c.940T>C (p.Trp314Arg) rs587781878
NM_002878.3(RAD51D):c.944G>T (p.Gly315Val) rs786203144
NM_002878.3(RAD51D):c.94_95delGT (p.Val32Phefs) rs786203137
NM_002878.3(RAD51D):c.955C>T (p.Gln319Ter) rs794726988
NM_002878.3(RAD51D):c.955_959dup (p.Ala321Argfs) rs771998974
NM_002878.3(RAD51D):c.957G>A (p.Gln319=) rs147669627
NM_002878.3(RAD51D):c.966A>G (p.Thr322=) rs786203299
NM_002878.3(RAD51D):c.972G>T (p.Gln324His) rs762625437
NM_002878.3(RAD51D):c.973G>A (p.Gly325Ser) rs587780106
NM_002878.3(RAD51D):c.977A>C (p.Asp326Ala) rs1555566935
NM_002878.3(RAD51D):c.983C>T (p.Thr328Ile) rs138969595

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.