ClinVar Miner

List of variants in gene RB1 studied for Hereditary cancer-predisposing syndrome

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 168
Download table as spreadsheet
NM_000321.2(RB1):c.-198G>A rs387906521
NM_000321.2(RB1):c.1024delA (p.Thr342Leufs) rs587778844
NM_000321.2(RB1):c.1027delC (p.Leu343Phefs) rs1131690873
NM_000321.2(RB1):c.1049+1G>A rs587776782
NM_000321.2(RB1):c.1060_1061delCA (p.Gln354Glufs) rs587778829
NM_000321.2(RB1):c.1064_1065delGA (p.Arg355Asnfs) rs1131690861
NM_000321.2(RB1):c.106delG (p.Asp36Thrfs) rs1131690913
NM_000321.2(RB1):c.1072C>T (p.Arg358Ter) rs121913301
NM_000321.2(RB1):c.1072_1074delCGAinsGG (p.Arg358Glyfs) rs1131690872
NM_000321.2(RB1):c.1128-2A>G rs1131690892
NM_000321.2(RB1):c.1129A>T (p.Thr377Ser) rs146897002
NM_000321.2(RB1):c.113G>A (p.Gly38Asp) rs766529534
NM_000321.2(RB1):c.1140C>T (p.Asn380=) rs117865557
NM_000321.2(RB1):c.1147C>T (p.Gln383Ter) rs1131690846
NM_000321.2(RB1):c.1156A>G (p.Met386Val) rs564780653
NM_000321.2(RB1):c.1180G>A (p.Asp394Asn) rs753350745
NM_000321.2(RB1):c.1215+1G>A rs587776783
NM_000321.2(RB1):c.1229delA (p.Asn410Ilefs) rs1131690897
NM_000321.2(RB1):c.1251_1252delAA (p.Arg418Serfs) rs1131690889
NM_000321.2(RB1):c.128C>G (p.Pro43Arg) rs1555279239
NM_000321.2(RB1):c.1306C>A (p.Gln436Lys) rs4151534
NM_000321.2(RB1):c.1318G>A (p.Glu440Lys) rs1060503078
NM_000321.2(RB1):c.1321dup (p.Ile441Asnfs) rs1131690875
NM_000321.2(RB1):c.1328C>A (p.Ser443Ter) rs1060503079
NM_000321.2(RB1):c.1333C>T (p.Arg445Ter) rs3092891
NM_000321.2(RB1):c.1345G>A (p.Gly449Arg) rs1131690851
NM_000321.2(RB1):c.1363C>T (p.Arg455Ter) rs121913302
NM_000321.2(RB1):c.1364G>C (p.Arg455Pro) rs769425649
NM_000321.2(RB1):c.137+1G>T rs1131690855
NM_000321.2(RB1):c.1372G>T (p.Glu458Ter) rs1131690884
NM_000321.2(RB1):c.1389+4A>C rs1131690879
NM_000321.2(RB1):c.1389+5G>A rs1131690859
NM_000321.2(RB1):c.1399C>T (p.Arg467Ter) rs398123331
NM_000321.2(RB1):c.1400_1403dup (p.Ser469Ilefs) rs1555286570
NM_000321.2(RB1):c.1410T>C (p.Ile470=) rs578226820
NM_000321.2(RB1):c.1411C>T (p.Gln471Ter) rs1354030520
NM_000321.2(RB1):c.1419delT (p.Phe473Leufs) rs1555286573
NM_000321.2(RB1):c.1421+12_1421+32delACTTTTAGTAAAAAATTTTTT rs587781256
NM_000321.2(RB1):c.1421+1G>C rs1131690886
NM_000321.2(RB1):c.1421+1delG rs1555286576
NM_000321.2(RB1):c.1421G>T (p.Ser474Ile) rs1555286575
NM_000321.2(RB1):c.1439_1441delACA (p.Asn480del) rs587776788
NM_000321.2(RB1):c.1447delC (p.His483Ilefs) rs1131690910
NM_000321.2(RB1):c.1464G>A (p.Ala488=) rs753520981
NM_000321.2(RB1):c.1466G>A (p.Cys489Tyr) rs1131690877
NM_000321.2(RB1):c.1474G>A (p.Glu492Lys) rs1060503084
NM_000321.2(RB1):c.1498+1G>A rs1131690909
NM_000321.2(RB1):c.1502_1514del13 (p.Ser501Ilefs) rs1131690856
NM_000321.2(RB1):c.1574C>A (p.Ala525Asp) rs4151539
NM_000321.2(RB1):c.1574C>G (p.Ala525Gly) rs4151539
NM_000321.2(RB1):c.1575delC (p.Phe526Leufs) rs1131690876
NM_000321.2(RB1):c.1596C>T (p.Ile532=) rs770728170
NM_000321.2(RB1):c.1617A>C (p.Glu539Asp) rs371031574
NM_000321.2(RB1):c.1632A>G (p.Arg544=) rs143948310
NM_000321.2(RB1):c.1654C>T (p.Arg552Ter) rs121913303
NM_000321.2(RB1):c.1666C>T (p.Arg556Ter) rs121913304
NM_000321.2(RB1):c.1675G>C (p.Glu559Gln) rs1131690869
NM_000321.2(RB1):c.1695+3A>C rs1131690870
NM_000321.2(RB1):c.1706delT (p.Leu569Tyrfs) rs1131690842
NM_000321.2(RB1):c.1707A>G (p.Leu569=) rs3092895
NM_000321.2(RB1):c.1735C>T (p.Arg579Ter) rs121913305
NM_000321.2(RB1):c.1770T>C (p.Cys590=) rs145310579
NM_000321.2(RB1):c.1800C>T (p.His600=) rs1555293650
NM_000321.2(RB1):c.1811delA (p.Asp604Valfs) rs1131690893
NM_000321.2(RB1):c.1814+2T>G rs1131690899
NM_000321.2(RB1):c.1814+4A>G rs1131690898
NM_000321.2(RB1):c.1861C>A (p.Arg621Ser) rs367578442
NM_000321.2(RB1):c.1861C>T (p.Arg621Cys) rs367578442
NM_000321.2(RB1):c.1960+5G>C rs587778871
NM_000321.2(RB1):c.1966C>T (p.Arg656Trp) rs142509759
NM_000321.2(RB1):c.1981C>T (p.Arg661Trp) rs137853294
NM_000321.2(RB1):c.19_21delCGAinsGG (p.Arg7Glyfs) rs1131690845
NM_000321.2(RB1):c.19dup (p.Arg7Profs) rs1131690852
NM_000321.2(RB1):c.2011_2014delTCTG (p.Glu672Thrfs) rs1131690885
NM_000321.2(RB1):c.2014G>T (p.Glu672Ter) rs1131690903
NM_000321.2(RB1):c.2053C>T (p.Gln685Ter) rs878853949
NM_000321.2(RB1):c.2055delG (p.Gln685Hisfs) rs1131690844
NM_000321.2(RB1):c.207T>C (p.His69=) rs759594127
NM_000321.2(RB1):c.2094G>C (p.Arg698Ser) rs1131690891
NM_000321.2(RB1):c.2104C>T (p.Gln702Ter) rs1131690865
NM_000321.2(RB1):c.2105A>G (p.Gln702Arg) rs1131690857
NM_000321.2(RB1):c.2107-1G>A rs587778860
NM_000321.2(RB1):c.2128_2132delGGCAT (p.Gly710Metfs) rs1131690896
NM_000321.2(RB1):c.2134T>C (p.Cys712Arg) rs137853296
NM_000321.2(RB1):c.219A>C (p.Arg73Ser) rs1131690854
NM_000321.2(RB1):c.219_220delAG (p.Arg73Serfs) rs587778862
NM_000321.2(RB1):c.2244G>A (p.Glu748=) rs1131690911
NM_000321.2(RB1):c.2299_2302delAATA (p.Asn767Phefs) rs1131690894
NM_000321.2(RB1):c.2325+1G>A rs1131690882
NM_000321.2(RB1):c.2325+1G>C rs1131690882
NM_000321.2(RB1):c.2325+5G>A rs886042249
NM_000321.2(RB1):c.2327C>A (p.Pro776His) rs912203557
NM_000321.2(RB1):c.2359C>T (p.Arg787Ter) rs137853293
NM_000321.2(RB1):c.2360G>A (p.Arg787Gln) rs748094394
NM_000321.2(RB1):c.2392C>T (p.Arg798Trp) rs187912365
NM_000321.2(RB1):c.2413_2420delTATATTTC (p.Tyr805Thrfs) rs1131690868
NM_000321.2(RB1):c.2439T>A (p.Tyr813Ter) rs774744607
NM_000321.2(RB1):c.2439T>G (p.Tyr813Ter) rs774744607
NM_000321.2(RB1):c.2455C>G (p.Leu819Val) rs375751988
NM_000321.2(RB1):c.2455C>T (p.Leu819=) rs375751988
NM_000321.2(RB1):c.2463A>G (p.Thr821=) rs370088029
NM_000321.2(RB1):c.2465delC (p.Pro822Glnfs) rs1131690866
NM_000321.2(RB1):c.2489+1G>A rs764754259
NM_000321.2(RB1):c.2489+1G>C rs764754259
NM_000321.2(RB1):c.2501C>A (p.Ser834Ter) rs1131690906
NM_000321.2(RB1):c.2513C>A (p.Ser838Ter) rs1131690908
NM_000321.2(RB1):c.2519G>A (p.Gly840Glu) rs1131690900
NM_000321.2(RB1):c.2520+1G>T rs587778850
NM_000321.2(RB1):c.2520+3_2520+6delGAGT rs1131690858
NM_000321.2(RB1):c.2520+5G>A rs1131690881
NM_000321.2(RB1):c.2533T>C (p.Phe845Leu) rs754183765
NM_000321.2(RB1):c.2559T>C (p.Cys853=) rs148327780
NM_000321.2(RB1):c.2566G>A (p.Asp856Asn) rs149359120
NM_000321.2(RB1):c.2570G>A (p.Arg857His) rs144668210
NM_000321.2(RB1):c.2626C>T (p.Arg876Cys) rs143105337
NM_000321.2(RB1):c.264+1G>A rs1131690907
NM_000321.2(RB1):c.264+5G>C rs1131690853
NM_000321.2(RB1):c.277C>T (p.Gln93Ter) rs1131690915
NM_000321.2(RB1):c.281dup (p.Lys95Glufs) rs1131690862
NM_000321.2(RB1):c.297G>A (p.Trp99Ter) rs794727481
NM_000321.2(RB1):c.367A>G (p.Asn123Asp) rs149800437
NM_000321.2(RB1):c.380+1G>A rs1131690902
NM_000321.2(RB1):c.380G>A (p.Ser127Asn) rs1131690843
NM_000321.2(RB1):c.380G>C (p.Ser127Thr) rs1131690843
NM_000321.2(RB1):c.411A>T (p.Glu137Asp) rs3092902
NM_000321.2(RB1):c.42C>T (p.Ala14=) rs148980395
NM_000321.2(RB1):c.434delA (p.Asp145Valfs) rs1131690912
NM_000321.2(RB1):c.443delT (p.Met148Serfs) rs1131690867
NM_000321.2(RB1):c.45_53delTGCCGCCGC (p.Ala16_Ala18del) rs572454921
NM_000321.2(RB1):c.496G>T (p.Glu166Ter) rs1131690874
NM_000321.2(RB1):c.500+1G>T rs1131690880
NM_000321.2(RB1):c.52G>T (p.Ala18Ser) rs528218090
NM_000321.2(RB1):c.539delC (p.Ser180Terfs) rs1131690871
NM_000321.2(RB1):c.549delT (p.Glu184Lysfs) rs1131690887
NM_000321.2(RB1):c.54_76dup (p.Pro26Argfs) rs1555279210
NM_000321.2(RB1):c.590C>A (p.Thr197Lys) rs1131690883
NM_000321.2(RB1):c.59C>T (p.Pro20Leu) rs587778637
NM_000321.2(RB1):c.607+1G>A rs587776789
NM_000321.2(RB1):c.607+1G>T rs587776789
NM_000321.2(RB1):c.607+2dup rs1131690895
NM_000321.2(RB1):c.608-4delT rs762805947
NM_000321.2(RB1):c.628G>T (p.Asp210Tyr) rs148992508
NM_000321.2(RB1):c.644C>A (p.Ser215Ter) rs768305224
NM_000321.2(RB1):c.681delT (p.Lys228Asnfs) rs1131690905
NM_000321.2(RB1):c.69G>A (p.Pro23=) rs746662122
NM_000321.2(RB1):c.702delG (p.Leu234Phefs) rs1131690878
NM_000321.2(RB1):c.709G>T (p.Glu237Ter) rs1131690904
NM_000321.2(RB1):c.718+5G>T rs1131690848
NM_000321.2(RB1):c.731_732delTAinsATC (p.Ile244Asnfs) rs1131690890
NM_000321.2(RB1):c.735delC (p.Ile246Leufs) rs1131690847
NM_000321.2(RB1):c.751C>T (p.Arg251Ter) rs1131690863
NM_000321.2(RB1):c.763C>T (p.Arg255Ter) rs587778842
NM_000321.2(RB1):c.78_80delGCC (p.Pro29del) rs587778823
NM_000321.2(RB1):c.78_80dup (p.Pro29_Glu30insPro) rs587778823
NM_000321.2(RB1):c.814A>G (p.Arg272Gly) rs1555284945
NM_000321.2(RB1):c.846delA (p.Glu282Aspfs) rs1131690849
NM_000321.2(RB1):c.857A>G (p.Asp286Gly) rs1131690864
NM_000321.2(RB1):c.862-2A>C rs1131690914
NM_000321.2(RB1):c.867A>C (p.Lys289Asn) rs1555285126
NM_000321.2(RB1):c.869delA (p.Asn290Metfs) rs1131690901
NM_000321.2(RB1):c.88G>C (p.Glu30Gln) rs1555279228
NM_000321.2(RB1):c.920C>T (p.Thr307Ile) rs183898408
NM_000321.2(RB1):c.929G>A (p.Gly310Glu) rs200844292
NM_000321.2(RB1):c.940-1G>A rs1131690860
NM_000321.2(RB1):c.958C>T (p.Arg320Ter) rs121913300
NM_000321.2(RB1):c.959G>A (p.Arg320Gln) rs760787104
NM_000321.2(RB1):c.964G>T (p.Glu322Ter) rs776534331
NM_000321.2(RB1):c.9_42dup (p.Ala15Glnfs) rs1555279195

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.