ClinVar Miner

List of variants in gene RB1 reported as likely pathogenic by Integrated Genetics/Laboratory Corporation of America

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 6
Download table as spreadsheet
NM_000321.2(RB1):c.1390-2A>G rs1555286568
NM_000321.2(RB1):c.1400_1403dup (p.Ser469fs) rs1555286570
NM_000321.2(RB1):c.1411C>T (p.Gln471Ter) rs1354030520
NM_000321.2(RB1):c.1419del (p.Phe473fs) rs1555286573
NM_000321.2(RB1):c.1421+12_1421+32delACTTTTAGTAAAAAATTTTTT rs587781256
NM_000321.2(RB1):c.1421G>T (p.Ser474Ile) rs1555286575

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.