ClinVar Miner

List of variants in gene RB1 reported as pathogenic by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 72
Download table as spreadsheet
HGVS dbSNP
NC_000013.11:g.(?_48307274)_(48349029_?)del
NC_000013.11:g.(?_48342599)_(48345199_?)del
NC_000013.11:g.(?_48464992)_(48465374_?)del
NM_000321.2(RB1):c.1072C>T (p.Arg358Ter) rs121913301
NM_000321.2(RB1):c.1154T>G (p.Leu385Ter) rs878853947
NM_000321.2(RB1):c.1183C>T (p.Gln395Ter)
NM_000321.2(RB1):c.1215+1G>A rs587776783
NM_000321.2(RB1):c.1239_1240delAA (p.Ser414Tyrfs) rs1555286220
NM_000321.2(RB1):c.1278dup (p.Lys427Terfs) rs1555286236
NM_000321.2(RB1):c.1328C>A (p.Ser443Ter) rs1060503079
NM_000321.2(RB1):c.1332+1G>A rs587778846
NM_000321.2(RB1):c.1332G>C (p.Gln444His) rs1555286250
NM_000321.2(RB1):c.1333-2A>G rs1555286503
NM_000321.2(RB1):c.1333C>T (p.Arg445Ter) rs3092891
NM_000321.2(RB1):c.1345G>A (p.Gly449Arg) rs1131690851
NM_000321.2(RB1):c.1363C>T (p.Arg455Ter) rs121913302
NM_000321.2(RB1):c.1390-2A>G rs1555286568
NM_000321.2(RB1):c.1399C>T (p.Arg467Ter) rs398123331
NM_000321.2(RB1):c.1422-1G>A rs1461382798
NM_000321.2(RB1):c.1445_1446delTT (p.Phe482Serfs)
NM_000321.2(RB1):c.1458delA (p.Leu486Phefs) rs1555286611
NM_000321.2(RB1):c.1499-2A>C
NM_000321.2(RB1):c.1633_1640delGAAATGAT (p.Glu545Lysfs) rs1555286695
NM_000321.2(RB1):c.1654C>T (p.Arg552Ter) rs121913303
NM_000321.2(RB1):c.1666C>T (p.Arg556Ter) rs121913304
NM_000321.2(RB1):c.1673_1674dupTG (p.Glu559Trpfs) rs1555286707
NM_000321.2(RB1):c.1696-12T>G rs1060503088
NM_000321.2(RB1):c.1735C>T (p.Arg579Ter) rs121913305
NM_000321.2(RB1):c.1789C>T (p.Gln597Ter)
NM_000321.2(RB1):c.1959dup (p.Val654Serfs)
NM_000321.2(RB1):c.1960G>C (p.Val654Leu) rs483352690
NM_000321.2(RB1):c.1981C>T (p.Arg661Trp) rs137853294
NM_000321.2(RB1):c.2029G>T (p.Glu677Ter) rs1060503067
NM_000321.2(RB1):c.2053C>T (p.Gln685Ter) rs878853949
NM_000321.2(RB1):c.2065C>T (p.Gln689Ter)
NM_000321.2(RB1):c.2106+2T>C
NM_000321.2(RB1):c.2172dup (p.Val725Cysfs)
NM_000321.2(RB1):c.2194_2197delCCTC (p.Pro732Metfs) rs1060503075
NM_000321.2(RB1):c.219_220delAG (p.Arg73Serfs) rs587778862
NM_000321.2(RB1):c.2211G>T (p.Glu737Asp) rs587776787
NM_000321.2(RB1):c.2247_2248insAA (p.Asp750Lysfs) rs1555294600
NM_000321.2(RB1):c.2325+1G>A rs1131690882
NM_000321.2(RB1):c.2359C>T (p.Arg787Ter) rs137853293
NM_000321.2(RB1):c.2450_2453delAAGGinsTTT (p.Glu817Valfs) rs1555294626
NM_000321.2(RB1):c.2513C>G (p.Ser838Ter)
NM_000321.2(RB1):c.2520+1G>T rs587778850
NM_000321.2(RB1):c.2520+5G>T
NM_000321.2(RB1):c.283A>T (p.Lys95Ter) rs1555282775
NM_000321.2(RB1):c.297_298insA (p.Gly100Argfs)
NM_000321.2(RB1):c.36delC (p.Ala13Profs)
NM_000321.2(RB1):c.376delA (p.Ile126Serfs) rs886042357
NM_000321.2(RB1):c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC (p.Ala13Thrfs) rs1064792974
NM_000321.2(RB1):c.380+3A>T rs1555282811
NM_000321.2(RB1):c.388A>T (p.Lys130Ter)
NM_000321.2(RB1):c.45_70dup (p.Pro24Leufs)
NM_000321.2(RB1):c.465_468dup (p.Val157Terfs)
NM_000321.2(RB1):c.510delA (p.Glu170Aspfs) rs1555283482
NM_000321.2(RB1):c.54_73dup (p.Pro25Argfs) rs1555279212
NM_000321.2(RB1):c.54_76dup (p.Pro26Argfs) rs1555279210
NM_000321.2(RB1):c.607+1G>T rs587776789
NM_000321.2(RB1):c.751C>T (p.Arg251Ter) rs1131690863
NM_000321.2(RB1):c.763C>T (p.Arg255Ter) rs587778842
NM_000321.2(RB1):c.772_776delAACAG (p.Asn258Glufs)
NM_000321.2(RB1):c.800delT (p.Leu267Glnfs)
NM_000321.2(RB1):c.83delC (p.Pro28Leufs)
NM_000321.2(RB1):c.861G>A (p.Glu287=) rs1555284956
NM_000321.2(RB1):c.861G>C (p.Glu287Asp) rs1555284956
NM_000321.2(RB1):c.869delA (p.Asn290Metfs) rs1131690901
NM_000321.2(RB1):c.940-1G>A rs1131690860
NM_000321.2(RB1):c.951_954delTTCT (p.Ser318Asnfs)
NM_000321.2(RB1):c.958C>T (p.Arg320Ter) rs121913300
NM_000321.2(RB1):c.967G>T (p.Glu323Ter) rs1060503077

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.