ClinVar Miner

List of variants in gene RECQL4 reported as likely pathogenic for Rothmund-Thomson syndrome

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 2
Download table as spreadsheet
NM_004260.3(RECQL4):c.2336_2357delACCGGCCAGATGTGCGGGCTGT (p.Asp779Glyfs) rs1554898257
NM_004260.3(RECQL4):c.3293_3294insGCAGGATGAGGAGCGCAGCA (p.Arg1099Glnfs) rs1554896308

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.