ClinVar Miner

List of variants in gene SMAD4 reported as pathogenic for Juvenile polyposis syndrome

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 103
Download table as spreadsheet
HGVS dbSNP
NC_000018.9:g.(?_48556583)_(48604847_?)del
NC_000018.9:g.(?_48573411)_(48604843_?)del
NC_000018.9:g.(?_48593389)_(48611412_?)del
NC_000018.9:g.(?_48602998)_(48604847_?)del
NM_005359.5(SMAD4):c.(?_-1)_(*1_?)del
NM_005359.5(SMAD4):c.(?_-17093)_(1659_?)del
NM_005359.5(SMAD4):c.1037delC (p.Pro346Leufs) rs377767343
NM_005359.5(SMAD4):c.1042_1043del (p.Val348Tyrfs) rs377767344
NM_005359.5(SMAD4):c.1058A>C (p.Tyr353Ser) rs377767346
NM_005359.5(SMAD4):c.1081C>A (p.Arg361Ser) rs80338963
NM_005359.5(SMAD4):c.1081C>T (p.Arg361Cys) rs80338963
NM_005359.5(SMAD4):c.1082G>A (p.Arg361His) rs377767347
NM_005359.5(SMAD4):c.1087T>C (p.Cys363Arg) rs377767348
NM_005359.5(SMAD4):c.1096C>T (p.Gln366Ter) rs1060500733
NM_005359.5(SMAD4):c.1113delC (p.His371Glnfs) rs377767352
NM_005359.5(SMAD4):c.1134_1135delAG (p.Arg378Serfs) rs1555686503
NM_005359.5(SMAD4):c.1138delA (p.Arg380Glyfs) rs1555686506
NM_005359.5(SMAD4):c.1139+1G>A rs377767354
NM_005359.5(SMAD4):c.1139G>A (p.Arg380Lys) rs377767353
NM_005359.5(SMAD4):c.1142T>A (p.Leu381Ter) rs863224507
NM_005359.5(SMAD4):c.1162C>T (p.Gln388Ter) rs80338964
NM_005359.5(SMAD4):c.1166_1167delTG (p.Leu389Terfs) rs1555686600
NM_005359.5(SMAD4):c.1168G>A (p.Glu390Lys) rs377767356
NM_005359.5(SMAD4):c.1193G>A (p.Trp398Ter) rs377767357
NM_005359.5(SMAD4):c.1198delA (p.Arg400Glyfs) rs1060500734
NM_005359.5(SMAD4):c.1206dupT (p.Ser403Terfs) rs878854765
NM_005359.5(SMAD4):c.1228_1229delCA (p.Gln410Glufs) rs1555686608
NM_005359.5(SMAD4):c.1236C>G (p.Tyr412Ter) rs121912577
NM_005359.5(SMAD4):c.1242delA (p.Asp415Thrfs) rs377767358
NM_005359.5(SMAD4):c.1245_1248delCAGA (p.Asp415Glufs) rs80338965
NM_005359.5(SMAD4):c.1268delG (p.Gly423Glufs) rs377767359
NM_005359.5(SMAD4):c.1308+2T>C rs1555686624
NM_005359.5(SMAD4):c.1324C>T (p.Gln442Ter) rs1555687378
NM_005359.5(SMAD4):c.1333C>T (p.Arg445Ter) rs377767360
NM_005359.5(SMAD4):c.1342C>T (p.Gln448Ter) rs377767361
NM_005359.5(SMAD4):c.1343_1365del (p.Gln448Argfs) rs377767362
NM_005359.5(SMAD4):c.1343_1367delAGCAGCAGGCGGCTACTGCACAAGC (p.Gln448Leufs) rs1568211187
NM_005359.5(SMAD4):c.1353_1354insGCTACTGCACAAGCTGCAGCAGCTGCCC (p.Gln461Argfs) rs786204125
NM_005359.5(SMAD4):c.1361_1364delCACA (p.Ala454Glufs) rs377767363
NM_005359.5(SMAD4):c.1407_1410dup (p.Gly471Profs) rs1555687386
NM_005359.5(SMAD4):c.1409_1410insCCCT (p.Gly471Profs) rs377767364
NM_005359.5(SMAD4):c.1409delC (p.Pro470Leufs) rs1555687387
NM_005359.5(SMAD4):c.1411_1435del (p.Gly471Leufs) rs377767365
NM_005359.5(SMAD4):c.1421delC (p.Ser474Terfs) rs377767366
NM_005359.5(SMAD4):c.1472G>T (p.Gly491Val) rs377767367
NM_005359.5(SMAD4):c.1478A>C (p.Asp493Ala) rs377767368
NM_005359.5(SMAD4):c.1498A>G (p.Ile500Val) rs281875322
NM_005359.5(SMAD4):c.1525T>A (p.Trp509Arg) rs377767369
NM_005359.5(SMAD4):c.1527G>A (p.Trp509Ter) rs377767370
NM_005359.5(SMAD4):c.1529G>T (p.Gly510Val) rs377767371
NM_005359.5(SMAD4):c.1529delG (p.Gly510Aspfs) rs1060500744
NM_005359.5(SMAD4):c.153dupA (p.Asp52Argfs) rs786203560
NM_005359.5(SMAD4):c.1544delG (p.Arg515Asnfs) rs377767372
NM_005359.5(SMAD4):c.1547_1550dupAGAG (p.Ser517Argfs) rs377767373
NM_005359.5(SMAD4):c.1547dupA (p.Ser517Glufs) rs587783060
NM_005359.5(SMAD4):c.1564_1565delCC (p.Pro522Leufs) rs377767374
NM_005359.5(SMAD4):c.1571G>T (p.Trp524Leu) rs377767375
NM_005359.5(SMAD4):c.1572G>A (p.Trp524Ter) rs1568211588
NM_005359.5(SMAD4):c.1587dup (p.His530Thrfs) rs377767376
NM_005359.5(SMAD4):c.1588delC (p.His530Thrfs) rs377767377
NM_005359.5(SMAD4):c.1597C>G (p.Leu533Val) rs377767381
NM_005359.5(SMAD4):c.1607dup (p.Asp537Argfs) rs377767384
NM_005359.5(SMAD4):c.189_197delAAATGGAGCins44 (p.?)
NM_005359.5(SMAD4):c.263_267delAAGGA (p.Lys88Ilefs) rs1060500739
NM_005359.5(SMAD4):c.373_374insAT (p.Ser125Asnfs) rs377767324
NM_005359.5(SMAD4):c.375_381dup (p.Val128Cysfs) rs377767325
NM_005359.5(SMAD4):c.403C>T (p.Arg135Ter) rs377767326
NM_005359.5(SMAD4):c.424+1G>A rs377767386
NM_005359.5(SMAD4):c.425-6A>G rs377767327
NM_005359.5(SMAD4):c.430_431delTC (p.Ser144Argfs) rs377767328
NM_005359.5(SMAD4):c.437T>A (p.Leu146Ter) rs377767329
NM_005359.5(SMAD4):c.443delT (p.Leu148Argfs)
NM_005359.5(SMAD4):c.461C>G (p.Ser154Ter) rs1555685624
NM_005359.5(SMAD4):c.516_527del (p.Ser173_Gly176del) rs377767330
NM_005359.5(SMAD4):c.533C>G (p.Ser178Ter) rs377767331
NM_005359.5(SMAD4):c.538C>T (p.Gln180Ter) rs377767332
NM_005359.5(SMAD4):c.585C>G (p.Tyr195Ter) rs1316902116
NM_005359.5(SMAD4):c.608delC (p.Pro203Hisfs) rs377767333
NM_005359.5(SMAD4):c.668-?_1659+?del
NM_005359.5(SMAD4):c.692dupG (p.Ser232Glnfs) rs377767334
NM_005359.5(SMAD4):c.69delG (p.Met24Cysfs)
NM_005359.5(SMAD4):c.728_735delGGCCTCAG (p.Gly243Alafs) rs1060500742
NM_005359.5(SMAD4):c.731_732insGCCC(p.Gln245Profs) rs377767335
NM_005359.5(SMAD4):c.788-?_1659+?del
NM_005359.5(SMAD4):c.831_832delAC (p.Pro278Terfs) rs377767336
NM_005359.5(SMAD4):c.906G>A (p.Trp302Ter) rs878854769
NM_005359.5(SMAD4):c.925_928dupGCAT (p.Phe310Cysfs) rs377767338
NM_005359.5(SMAD4):c.939dup (p.Ile314Hisfs) rs1568206602
NM_005359.5(SMAD4):c.970T>C (p.Cys324Arg) rs377767339
NM_005359.5(SMAD4):c.971delG (p.Cys324Phefs) rs377767340
NM_005359.5(SMAD4):c.982_983insT (p.Tyr328Leufs) rs377767341
NM_005359.5(SMAD4):c.989A>G (p.Glu330Gly) rs281875324
NM_005359.5:c.1194G>A
NM_005359.5:c.1249_1250delGA
NM_005359.5:c.1363C>T
NM_005359.5:c.247C>T
NM_005359.5:c.399C>A
NM_005359.6(SMAD4):c.1067dup (p.Ser357Phefs)
SMAD4, 1-BP INS
SMAD4, 2-BP DEL
SMAD4, 2-BP DEL, 959AC
SMAD4, 4-BP DEL, NT1372
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.