ClinVar Miner

List of variants in gene SMAD4 studied for not provided

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 110
Download table as spreadsheet
HGVS dbSNP
NM_005359.5(SMAD4):c.-128+19C>T rs974217374
NM_005359.5(SMAD4):c.-128+6C>T rs1023427434
NM_005359.5(SMAD4):c.-39T>A rs1057523754
NM_005359.5(SMAD4):c.1002G>T (p.Gln334His) rs773598775
NM_005359.5(SMAD4):c.102A>G (p.Thr34=) rs146104321
NM_005359.5(SMAD4):c.1054G>A (p.Gly352Arg) rs121912581
NM_005359.5(SMAD4):c.1058A>G (p.Tyr353Cys)
NM_005359.5(SMAD4):c.1059C>G (p.Tyr353Ter) rs863224400
NM_005359.5(SMAD4):c.1081C>T (p.Arg361Cys) rs80338963
NM_005359.5(SMAD4):c.1082G>A (p.Arg361His) rs377767347
NM_005359.5(SMAD4):c.1086T>C (p.Phe362=) rs1801250
NM_005359.5(SMAD4):c.10_11delAT (p.Met4Valfs) rs1064796471
NM_005359.5(SMAD4):c.1106A>G (p.Asn369Ser) rs139569694
NM_005359.5(SMAD4):c.1134_1135delAG (p.Arg378Serfs) rs1555686503
NM_005359.5(SMAD4):c.1140-10T>C rs186332162
NM_005359.5(SMAD4):c.1140-10delT rs763877987
NM_005359.5(SMAD4):c.1140-1G>A rs1555686594
NM_005359.5(SMAD4):c.1155A>G (p.Lys385=) rs752938351
NM_005359.5(SMAD4):c.115delGinsAA (p.Ala39Asnfs) rs1555685014
NM_005359.5(SMAD4):c.1216G>A (p.Ala406Thr) rs794726995
NM_005359.5(SMAD4):c.1217C>T (p.Ala406Val) rs1064796102
NM_005359.5(SMAD4):c.1218G>A (p.Ala406=) rs145097078
NM_005359.5(SMAD4):c.1231_1232delAG (p.Ser411Leufs) rs730881952
NM_005359.5(SMAD4):c.1236C>T (p.Tyr412=) rs121912577
NM_005359.5(SMAD4):c.1239C>A (p.Tyr413Ter) rs730881954
NM_005359.5(SMAD4):c.1245_1248delCAGA (p.Asp415Glufs) rs80338965
NM_005359.5(SMAD4):c.1259G>A (p.Arg420His) rs1064793725
NM_005359.5(SMAD4):c.1333C>T (p.Arg445Ter) rs377767360
NM_005359.5(SMAD4):c.1338_1339delGA (p.Gln446Hisfs) rs730881957
NM_005359.5(SMAD4):c.1351_1375del25 (p.Ala451Leufs) rs587780124
NM_005359.5(SMAD4):c.1353G>A (p.Ala451=) rs1441353791
NM_005359.5(SMAD4):c.1358C>T (p.Thr453Ile) rs786205514
NM_005359.5(SMAD4):c.1392C>T (p.Ala464=) rs140487104
NM_005359.5(SMAD4):c.1422A>C (p.Ser474=) rs786201261
NM_005359.5(SMAD4):c.1486C>T (p.Arg496Cys) rs397518413
NM_005359.5(SMAD4):c.1492T>C (p.Leu498=) rs1057520520
NM_005359.5(SMAD4):c.1495T>C (p.Cys499Arg) rs1060500738
NM_005359.5(SMAD4):c.1498A>G (p.Ile500Val) rs281875322
NM_005359.5(SMAD4):c.1499T>C (p.Ile500Thr) rs281875321
NM_005359.5(SMAD4):c.1500A>G (p.Ile500Met) rs281875320
NM_005359.5(SMAD4):c.153dupA (p.Asp52Argfs) rs786203560
NM_005359.5(SMAD4):c.1547dupA (p.Ser517Glufs) rs587783060
NM_005359.5(SMAD4):c.1549_1550delAG (p.Ser517Hisfs) rs377767373
NM_005359.5(SMAD4):c.155A>T (p.Asp52Val) rs1057524809
NM_005359.5(SMAD4):c.1573A>G (p.Ile525Val) rs149755320
NM_005359.5(SMAD4):c.1608A>G (p.Leu536=) rs753128184
NM_005359.5(SMAD4):c.1634T>A (p.Ile545Asn) rs730881955
NM_005359.5(SMAD4):c.1647A>G (p.Gln549=) rs113545983
NM_005359.5(SMAD4):c.1651T>G (p.Leu551Val) rs1064793950
NM_005359.5(SMAD4):c.181A>G (p.Ile61Val) rs1064794204
NM_005359.5(SMAD4):c.1A>G (p.Met1Val) rs1064795777
NM_005359.5(SMAD4):c.20C>T (p.Thr7Met) rs372316981
NM_005359.5(SMAD4):c.21G>A (p.Thr7=) rs142292491
NM_005359.5(SMAD4):c.228A>G (p.Arg76=) rs587780556
NM_005359.5(SMAD4):c.249+20T>C
NM_005359.5(SMAD4):c.250-15C>T rs375910294
NM_005359.5(SMAD4):c.250-2A>G rs1555685142
NM_005359.5(SMAD4):c.263_267delAAGGA (p.Lys88Ilefs) rs1060500739
NM_005359.5(SMAD4):c.276T>C (p.His92=) rs762501162
NM_005359.5(SMAD4):c.326delTinsAAATATGAAC (p.Leu109_Cys443delinsGlnIleTer) rs727504151
NM_005359.5(SMAD4):c.332A>C (p.His111Pro) rs1064794363
NM_005359.5(SMAD4):c.354G>A (p.Ala118=) rs145988618
NM_005359.5(SMAD4):c.38A>G (p.Asn13Ser) rs281875323
NM_005359.5(SMAD4):c.390A>G (p.Pro130=) rs755862230
NM_005359.5(SMAD4):c.424+5G>A rs200772603
NM_005359.5(SMAD4):c.425-6A>G rs377767327
NM_005359.5(SMAD4):c.455-6A>G rs181178864
NM_005359.5(SMAD4):c.455C>A (p.Ala152Asp)
NM_005359.5(SMAD4):c.470T>C (p.Met157Thr) rs756675590
NM_005359.5(SMAD4):c.49C>T (p.Leu17=) rs1555684997
NM_005359.5(SMAD4):c.521C>A (p.Thr174Asn) rs138800446
NM_005359.5(SMAD4):c.525A>G (p.Glu175=) rs368528856
NM_005359.5(SMAD4):c.535A>G (p.Ile179Val) rs542392980
NM_005359.5(SMAD4):c.565C>T (p.Arg189Cys) rs140743238
NM_005359.5(SMAD4):c.573G>A (p.Ser191=) rs761936246
NM_005359.5(SMAD4):c.575C>T (p.Thr192Ile) rs587780792
NM_005359.5(SMAD4):c.582A>G (p.Thr194=) rs145805120
NM_005359.5(SMAD4):c.606C>G (p.Ala202=) rs780665234
NM_005359.5(SMAD4):c.607C>G (p.Pro203Ala) rs199809905
NM_005359.5(SMAD4):c.643C>T (p.Pro215Ser) rs1064793270
NM_005359.5(SMAD4):c.667+10A>G
NM_005359.5(SMAD4):c.669_691delTCAGCCTGCCAGTATACTGGGGG (p.Ser223Argfs) rs1064793271
NM_005359.5(SMAD4):c.677C>T (p.Ala226Val) rs539739051
NM_005359.5(SMAD4):c.682A>G (p.Ile228Val)
NM_005359.5(SMAD4):c.692G>C (p.Gly231Ala) rs759679579
NM_005359.5(SMAD4):c.693C>T (p.Gly231=) rs765597059
NM_005359.5(SMAD4):c.698A>G (p.His233Arg) rs1555685910
NM_005359.5(SMAD4):c.728_735delGGCCTCAG (p.Gly243Alafs) rs1060500742
NM_005359.5(SMAD4):c.746_747delAGinsCC (p.Gln249Pro) rs587782209
NM_005359.5(SMAD4):c.749A>G (p.Gln250Arg) rs879254159
NM_005359.5(SMAD4):c.752delA (p.Asn251Metfs) rs1555685925
NM_005359.5(SMAD4):c.787+7A>G rs779803439
NM_005359.5(SMAD4):c.790A>G (p.Ser264Gly) rs587780125
NM_005359.5(SMAD4):c.799A>C (p.Thr267Pro) rs1064793728
NM_005359.5(SMAD4):c.829A>G (p.Thr277Ala) rs1555685960
NM_005359.5(SMAD4):c.84A>G (p.Gln28=) rs778465458
NM_005359.5(SMAD4):c.852A>G (p.Gln284=) rs144378484
NM_005359.5(SMAD4):c.871C>T (p.His291Tyr) rs863224733
NM_005359.5(SMAD4):c.880A>G (p.Met294Val) rs7238500
NM_005359.5(SMAD4):c.884C>T (p.Pro295Leu) rs370176106
NM_005359.5(SMAD4):c.894C>T (p.Pro298=) rs781519690
NM_005359.5(SMAD4):c.903C>G (p.Tyr301Ter) rs746084369
NM_005359.5(SMAD4):c.905-9T>C rs1064795175
NM_005359.5(SMAD4):c.909T>G (p.Pro303=) rs141149381
NM_005359.5(SMAD4):c.914A>C (p.His305Pro) rs1555686072
NM_005359.5(SMAD4):c.917A>G (p.Asn306Ser) rs730881953
NM_005359.5(SMAD4):c.947A>G (p.Asn316Ser) rs377119288
NM_005359.5(SMAD4):c.954T>C (p.Pro318=) rs773615487
NM_005359.5(SMAD4):c.970T>C (p.Cys324Arg) rs377767339
NM_005359.5(SMAD4):c.989A>G (p.Glu330Gly) rs281875324

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.