ClinVar Miner

List of variants in gene SMAD4

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 897
Download table as spreadsheet
HGVS dbSNP
NC_000018.10:g.51046614G>A
NC_000018.10:g.51047430T>C
NC_000018.10:g.51047510A>G
NC_000018.10:g.51047595del
NC_000018.10:g.51055231C>A
NC_000018.10:g.51058118C>T
NC_000018.10:g.51058593T>G
NC_000018.10:g.51065586A>T
NC_000018.10:g.51066763G>A
NC_000018.10:g.51076571G>C
NC_000018.10:g.51077033T>C
NC_000018.9:g.(?_48556583)_(48556993_?)del
NC_000018.9:g.(?_48556583)_(48603156_?)dup
NC_000018.9:g.(?_48556583)_(48604847_?)del
NC_000018.9:g.(?_48556583)_(48604847_?)dup
NC_000018.9:g.(?_48573411)_(48604843_?)del
NC_000018.9:g.(?_48593389)_(48611412_?)del
NC_000018.9:g.(?_48602998)_(48604847_?)del
NC_000018.9:g.(?_48603008)_(48611412_?)dup
NM_005359.5(SMAD4):c.(?_-1)_(*1_?)del
NM_005359.5(SMAD4):c.(?_-1)_249+?dup
NM_005359.5(SMAD4):c.(?_-17093)_(1659_?)del
NM_005359.5(SMAD4):c.(?_-538)_1139+?del
NM_005359.5(SMAD4):c.*1067G>A rs542839921
NM_005359.5(SMAD4):c.*1169_*1173delCCATC rs138404813
NM_005359.5(SMAD4):c.*1177G>A rs886053899
NM_005359.5(SMAD4):c.*1179T>C rs10470
NM_005359.5(SMAD4):c.*1187A>G rs181664459
NM_005359.5(SMAD4):c.*11C>T rs11663402
NM_005359.5(SMAD4):c.*1277G>T rs886053900
NM_005359.5(SMAD4):c.*12G>A rs148687037
NM_005359.5(SMAD4):c.*13T>C rs1039813805
NM_005359.5(SMAD4):c.*1457C>T rs886053901
NM_005359.5(SMAD4):c.*14T>C rs989027869
NM_005359.5(SMAD4):c.*14T>G rs989027869
NM_005359.5(SMAD4):c.*1512dupT rs755827115
NM_005359.5(SMAD4):c.*1564_*1567delAATA rs886053903
NM_005359.5(SMAD4):c.*1801A>G rs886053904
NM_005359.5(SMAD4):c.*1812T>G rs557065270
NM_005359.5(SMAD4):c.*1820T>G rs141309481
NM_005359.5(SMAD4):c.*1864C>A rs561442548
NM_005359.5(SMAD4):c.*1866A>G rs4940037
NM_005359.5(SMAD4):c.*1G>A rs1555687622
NM_005359.5(SMAD4):c.*1G>C rs1555687622
NM_005359.5(SMAD4):c.*202A>G rs765823244
NM_005359.5(SMAD4):c.*2122A>G rs149424787
NM_005359.5(SMAD4):c.*218A>G rs886053895
NM_005359.5(SMAD4):c.*2353C>T rs550660083
NM_005359.5(SMAD4):c.*2354G>A rs886053905
NM_005359.5(SMAD4):c.*2361A>G rs143842829
NM_005359.5(SMAD4):c.*241T>C rs886053896
NM_005359.5(SMAD4):c.*2461C>T rs886053906
NM_005359.5(SMAD4):c.*2488T>A rs148190627
NM_005359.5(SMAD4):c.*2630A>G rs768569083
NM_005359.5(SMAD4):c.*2674A>G rs886053907
NM_005359.5(SMAD4):c.*2682T>C rs557955183
NM_005359.5(SMAD4):c.*2693A>G rs778780100
NM_005359.5(SMAD4):c.*2707_*2711delCTTTA rs769541605
NM_005359.5(SMAD4):c.*2793T>G rs886053909
NM_005359.5(SMAD4):c.*2796G>T rs4939651
NM_005359.5(SMAD4):c.*2914C>T rs147352474
NM_005359.5(SMAD4):c.*2962C>T rs543699844
NM_005359.5(SMAD4):c.*2968delT rs574286440
NM_005359.5(SMAD4):c.*2989A>G rs139526377
NM_005359.5(SMAD4):c.*30A>C rs767288576
NM_005359.5(SMAD4):c.*3109T>C rs886053910
NM_005359.5(SMAD4):c.*3186T>C rs886053911
NM_005359.5(SMAD4):c.*3286A>T rs886053912
NM_005359.5(SMAD4):c.*334C>T rs534790830
NM_005359.5(SMAD4):c.*3398A>G rs182735651
NM_005359.5(SMAD4):c.*3506C>T rs886053913
NM_005359.5(SMAD4):c.*3638T>G rs886053914
NM_005359.5(SMAD4):c.*3763C>T rs571174422
NM_005359.5(SMAD4):c.*3843G>A rs886053915
NM_005359.5(SMAD4):c.*3878dupT rs373831598
NM_005359.5(SMAD4):c.*4085C>A rs886053917
NM_005359.5(SMAD4):c.*412A>G rs28403611
NM_005359.5(SMAD4):c.*4378T>G rs540039847
NM_005359.5(SMAD4):c.*4587_*4590delGAGA rs374333786
NM_005359.5(SMAD4):c.*4643T>C rs369040052
NM_005359.5(SMAD4):c.*4748C>T rs375580807
NM_005359.5(SMAD4):c.*4862A>G rs139595540
NM_005359.5(SMAD4):c.*4867dupT rs571773833
NM_005359.5(SMAD4):c.*4987T>C rs188228460
NM_005359.5(SMAD4):c.*4991dupT rs886053919
NM_005359.5(SMAD4):c.*4C>A rs1555687625
NM_005359.5(SMAD4):c.*5004_*5005dupTT rs113155703
NM_005359.5(SMAD4):c.*5080A>G rs532965680
NM_005359.5(SMAD4):c.*5083G>A rs145596898
NM_005359.5(SMAD4):c.*5096C>A rs761008429
NM_005359.5(SMAD4):c.*5131A>G rs12456284
NM_005359.5(SMAD4):c.*5170C>T rs117142232
NM_005359.5(SMAD4):c.*5235C>G rs755051361
NM_005359.5(SMAD4):c.*5259A>T rs139414609
NM_005359.5(SMAD4):c.*5419T>C rs146551171
NM_005359.5(SMAD4):c.*5530T>C rs886053921
NM_005359.5(SMAD4):c.*5535A>G rs75712226
NM_005359.5(SMAD4):c.*5535_*5540delACGCGC rs147193925
NM_005359.5(SMAD4):c.*5535_*5545delACGCGCGCGCGinsGCGCACA rs886053923
NM_005359.5(SMAD4):c.*5535_*5547delACGCGCGCGCGCAinsGCG rs886053924
NM_005359.5(SMAD4):c.*5535_*5549delACGCGCGCGCGCACAinsG rs886053925
NM_005359.5(SMAD4):c.*5543_*5546dupGCGC rs68159021
NM_005359.5(SMAD4):c.*5545G>A rs752846586
NM_005359.5(SMAD4):c.*5545_*5546delGC rs68159021
NM_005359.5(SMAD4):c.*5546_*5547insGCAC rs1555688055
NM_005359.5(SMAD4):c.*5546_*5547insGCACAC rs1555688055
NM_005359.5(SMAD4):c.*5546_*5547insGCACACAC rs1555688055
NM_005359.5(SMAD4):c.*5546_*5547insGCACACACAC rs1555688055
NM_005359.5(SMAD4):c.*5551A>G rs202140561
NM_005359.5(SMAD4):c.*5564_*5577dupCACACACACACACA rs56017493
NM_005359.5(SMAD4):c.*5570_*5577dupCACACACA rs56017493
NM_005359.5(SMAD4):c.*5572_*5577delCACACA rs56017493
NM_005359.5(SMAD4):c.*5574_*5577delCACA rs56017493
NM_005359.5(SMAD4):c.*5576C>G rs886053930
NM_005359.5(SMAD4):c.*5576_*5577delCA rs56017493
NM_005359.5(SMAD4):c.*5576_*5577dupCA rs56017493
NM_005359.5(SMAD4):c.*5578G>C rs867684157
NM_005359.5(SMAD4):c.*5627G>A rs185010226
NM_005359.5(SMAD4):c.*5637_*5640delACAC rs368759758
NM_005359.5(SMAD4):c.*5691_*5693delTAT rs374306389
NM_005359.5(SMAD4):c.*5757dupT rs886053931
NM_005359.5(SMAD4):c.*5791C>T rs886053932
NM_005359.5(SMAD4):c.*5801T>C rs577928234
NM_005359.5(SMAD4):c.*5863_*5867delGAAAA rs78989198
NM_005359.5(SMAD4):c.*5874C>T rs886053933
NM_005359.5(SMAD4):c.*5985A>G rs886053934
NM_005359.5(SMAD4):c.*5994A>C rs3819122
NM_005359.5(SMAD4):c.*6009G>C rs181250637
NM_005359.5(SMAD4):c.*6057G>T rs886053935
NM_005359.5(SMAD4):c.*6162_*6165delGATT rs886053936
NM_005359.5(SMAD4):c.*6353delT rs573785159
NM_005359.5(SMAD4):c.*6408C>T rs557992238
NM_005359.5(SMAD4):c.*6423G>C rs2282544
NM_005359.5(SMAD4):c.*6492A>T rs569819237
NM_005359.5(SMAD4):c.*6513C>T rs76020793
NM_005359.5(SMAD4):c.*6586C>T rs534182161
NM_005359.5(SMAD4):c.*6588C>G rs186324049
NM_005359.5(SMAD4):c.*685A>C rs16952798
NM_005359.5(SMAD4):c.*7_*8del rs1176679575
NM_005359.5(SMAD4):c.*81T>G rs886053894
NM_005359.5(SMAD4):c.*837A>G rs886053897
NM_005359.5(SMAD4):c.*850G>A rs886053898
NM_005359.5(SMAD4):c.-109C>G rs757567812
NM_005359.5(SMAD4):c.-11A>C rs1057522345
NM_005359.5(SMAD4):c.-127-135A>C rs181270148
NM_005359.5(SMAD4):c.-127-3318A>G rs191217645
NM_005359.5(SMAD4):c.-127-3T>A rs746840014
NM_005359.5(SMAD4):c.-127-4835G>A rs146792006
NM_005359.5(SMAD4):c.-127-4838G>A rs145288509
NM_005359.5(SMAD4):c.-128+12A>G rs886053891
NM_005359.5(SMAD4):c.-128+16_-128+18delCCCinsTT rs1064794420
NM_005359.5(SMAD4):c.-128+1995A>G rs869312651
NM_005359.5(SMAD4):c.-128+19C>T rs974217374
NM_005359.5(SMAD4):c.-128+19delC rs1555683797
NM_005359.5(SMAD4):c.-128+263G>C rs149534722
NM_005359.5(SMAD4):c.-128+3139C>T rs75913646
NM_005359.5(SMAD4):c.-128+540A>G rs142196376
NM_005359.5(SMAD4):c.-128+6C>T rs1023427434
NM_005359.5(SMAD4):c.-128+759G>A rs9961921
NM_005359.5(SMAD4):c.-133G>A rs1012501055
NM_005359.5(SMAD4):c.-135G>A rs1057524686
NM_005359.5(SMAD4):c.-148C>T rs896378489
NM_005359.5(SMAD4):c.-15G>A rs1555684975
NM_005359.5(SMAD4):c.-20A>C rs1057520801
NM_005359.5(SMAD4):c.-233G>C rs886053890
NM_005359.5(SMAD4):c.-28T>C rs762899211
NM_005359.5(SMAD4):c.-313C>A rs886053889
NM_005359.5(SMAD4):c.-333C>A rs886053888
NM_005359.5(SMAD4):c.-39T>A rs1057523754
NM_005359.5(SMAD4):c.-3C>A rs886053892
NM_005359.5(SMAD4):c.-3C>G rs886053892
NM_005359.5(SMAD4):c.-476C>A rs886053887
NM_005359.5(SMAD4):c.-495C>G rs886053886
NM_005359.5(SMAD4):c.-503_-501delACA rs886053885
NM_005359.5(SMAD4):c.-53_-48delAATTGC rs1064795555
NM_005359.5(SMAD4):c.-9C>G rs864622289
NM_005359.5(SMAD4):c.1002G>T (p.Gln334His) rs773598775
NM_005359.5(SMAD4):c.1005A>G (p.Val335=) rs878854762
NM_005359.5(SMAD4):c.1006G>C (p.Gly336Arg) rs878854763
NM_005359.5(SMAD4):c.1007G>A (p.Gly336Glu) rs1060500732
NM_005359.5(SMAD4):c.1008A>G (p.Gly336=) rs1555686461
NM_005359.5(SMAD4):c.1009G>C (p.Glu337Gln) rs1555686464
NM_005359.5(SMAD4):c.1014A>G (p.Thr338=) rs1057520443
NM_005359.5(SMAD4):c.1023delT (p.Pro342Leufs) rs1555686469
NM_005359.5(SMAD4):c.102A>G (p.Thr34=) rs146104321
NM_005359.5(SMAD4):c.1035C>T (p.Cys345=) rs1555686471
NM_005359.5(SMAD4):c.1037delC (p.Pro346Leufs) rs377767343
NM_005359.5(SMAD4):c.1039A>G (p.Ile347Val) rs747360831
NM_005359.5(SMAD4):c.1042_1043del (p.Val348Tyrfs) rs377767344
NM_005359.5(SMAD4):c.1046C>T (p.Thr349Ile) rs564408927
NM_005359.5(SMAD4):c.104T>C (p.Phe35Ser) rs786202127
NM_005359.5(SMAD4):c.1051G>A (p.Asp351Asn) rs1057519739
NM_005359.5(SMAD4):c.1051G>C (p.Asp351His) rs1057519739
NM_005359.5(SMAD4):c.1052A>T (p.Asp351Val) rs1060500741
NM_005359.5(SMAD4):c.1054G>A (p.Gly352Arg) rs121912581
NM_005359.5(SMAD4):c.1055G>A (p.Gly352Glu) rs377767345
NM_005359.5(SMAD4):c.1058A>C (p.Tyr353Ser) rs377767346
NM_005359.5(SMAD4):c.1058A>G (p.Tyr353Cys)
NM_005359.5(SMAD4):c.1059C>G (p.Tyr353Ter) rs863224400
NM_005359.5(SMAD4):c.1059C>T (p.Tyr353=) rs863224400
NM_005359.5(SMAD4):c.1065C>A (p.Asp355Glu) rs1057519740
NM_005359.5(SMAD4):c.1072G>T (p.Gly358Ter) rs121912576
NM_005359.5(SMAD4):c.1075G>C (p.Gly359Arg) rs1555686486
NM_005359.5(SMAD4):c.1081C>A (p.Arg361Ser) rs80338963
NM_005359.5(SMAD4):c.1081C>G (p.Arg361Gly) rs80338963
NM_005359.5(SMAD4):c.1081C>T (p.Arg361Cys) rs80338963
NM_005359.5(SMAD4):c.1082G>A (p.Arg361His) rs377767347
NM_005359.5(SMAD4):c.1082G>C (p.Arg361Pro) rs377767347
NM_005359.5(SMAD4):c.1082G>T (p.Arg361Leu) rs377767347
NM_005359.5(SMAD4):c.1086T>C (p.Phe362=) rs1801250
NM_005359.5(SMAD4):c.1087T>C (p.Cys363Arg) rs377767348
NM_005359.5(SMAD4):c.1088G>A (p.Cys363Tyr) rs876660556
NM_005359.5(SMAD4):c.1088_1090delGTT (p.Cys363del) rs377767349
NM_005359.5(SMAD4):c.1090T>C (p.Leu364=) rs1568208261
NM_005359.5(SMAD4):c.1091T>G (p.Leu364Trp) rs377767350
NM_005359.5(SMAD4):c.1096C>T (p.Gln366Ter) rs1060500733
NM_005359.5(SMAD4):c.1098A>G (p.Gln366=) rs990054989
NM_005359.5(SMAD4):c.10_11delAT (p.Met4Valfs) rs1064796471
NM_005359.5(SMAD4):c.1102_1103delTC (p.Ser368Glnfs) rs377767351
NM_005359.5(SMAD4):c.1106A>G (p.Asn369Ser) rs139569694
NM_005359.5(SMAD4):c.1113delC (p.His371Glnfs) rs377767352
NM_005359.5(SMAD4):c.1124C>T (p.Ala375Val) rs1555686499
NM_005359.5(SMAD4):c.1125C>T (p.Ala375=) rs1060504023
NM_005359.5(SMAD4):c.1126A>G (p.Ile376Val) rs1555686501
NM_005359.5(SMAD4):c.1131G>C (p.Glu377Asp) rs1568208287
NM_005359.5(SMAD4):c.1134_1135delAG (p.Arg378Serfs) rs1555686503
NM_005359.5(SMAD4):c.1138A>T (p.Arg380Trp) rs1568208291
NM_005359.5(SMAD4):c.1138delA (p.Arg380Glyfs) rs1555686506
NM_005359.5(SMAD4):c.1139+10G>A rs1324590608
NM_005359.5(SMAD4):c.1139+10G>C rs1324590608
NM_005359.5(SMAD4):c.1139+13T>A rs752709023
NM_005359.5(SMAD4):c.1139+17C>T rs1568208314
NM_005359.5(SMAD4):c.1139+1G>A rs377767354
NM_005359.5(SMAD4):c.1139+2dupT rs1555686510
NM_005359.5(SMAD4):c.1139+3A>G rs786202607
NM_005359.5(SMAD4):c.1139G>A (p.Arg380Lys) rs377767353
NM_005359.5(SMAD4):c.1140-10T>A rs186332162
NM_005359.5(SMAD4):c.1140-10T>C rs186332162
NM_005359.5(SMAD4):c.1140-10delT rs763877987
NM_005359.5(SMAD4):c.1140-11T>A rs1224777335
NM_005359.5(SMAD4):c.1140-16C>A rs1057521669
NM_005359.5(SMAD4):c.1140-19delT rs1555686591
NM_005359.5(SMAD4):c.1140-1G>A rs1555686594
NM_005359.5(SMAD4):c.1140-2A>C rs1568208715
NM_005359.5(SMAD4):c.1140-36_1140-19del18 rs1064795613
NM_005359.5(SMAD4):c.1140-3A>C rs956212866
NM_005359.5(SMAD4):c.1140-4T>C rs1057521045
NM_005359.5(SMAD4):c.1140G>A (p.Arg380=) rs1060504025
NM_005359.5(SMAD4):c.1142T>A (p.Leu381Ter) rs863224507
NM_005359.5(SMAD4):c.1148T>A (p.Ile383Lys) rs377767355
NM_005359.5(SMAD4):c.1148T>C (p.Ile383Thr) rs377767355
NM_005359.5(SMAD4):c.1155A>G (p.Lys385=) rs752938351
NM_005359.5(SMAD4):c.1156G>A (p.Gly386Ser) rs1057519962
NM_005359.5(SMAD4):c.1156G>T (p.Gly386Cys) rs1057519962
NM_005359.5(SMAD4):c.1157G>A (p.Gly386Asp) rs121912580
NM_005359.5(SMAD4):c.1157G>C (p.Gly386Ala) rs121912580
NM_005359.5(SMAD4):c.1157G>T (p.Gly386Val) rs121912580
NM_005359.5(SMAD4):c.1159G>A (p.Val387Met) rs1010877617
NM_005359.5(SMAD4):c.115delGinsAA (p.Ala39Asnfs) rs1555685014
NM_005359.5(SMAD4):c.1162C>T (p.Gln388Ter) rs80338964
NM_005359.5(SMAD4):c.1166_1167delTG (p.Leu389Terfs) rs1555686600
NM_005359.5(SMAD4):c.1168G>A (p.Glu390Lys) rs377767356
NM_005359.5(SMAD4):c.1173T>C (p.Cys391=) rs1555686601
NM_005359.5(SMAD4):c.118A>G (p.Ile40Val) rs878854764
NM_005359.5(SMAD4):c.1193G>A (p.Trp398Ter) rs377767357
NM_005359.5(SMAD4):c.1198delA (p.Arg400Glyfs) rs1060500734
NM_005359.5(SMAD4):c.1200G>T (p.Arg400Ser) rs876658516
NM_005359.5(SMAD4):c.1201dup (p.Cys401Leufs) rs1555686604
NM_005359.5(SMAD4):c.1206T>A (p.Leu402=) rs758696549
NM_005359.5(SMAD4):c.1206dupT (p.Ser403Terfs) rs878854765
NM_005359.5(SMAD4):c.1215C>T (p.His405=) rs751732234
NM_005359.5(SMAD4):c.1216G>A (p.Ala406Thr) rs794726995
NM_005359.5(SMAD4):c.1217C>T (p.Ala406Val) rs1064796102
NM_005359.5(SMAD4):c.1218G>A (p.Ala406=) rs145097078
NM_005359.5(SMAD4):c.1219G>C (p.Val407Leu) rs147621330
NM_005359.5(SMAD4):c.1226T>C (p.Val409Ala) rs1555686607
NM_005359.5(SMAD4):c.1228_1229delCA (p.Gln410Glufs) rs1555686608
NM_005359.5(SMAD4):c.1231_1232delAG (p.Ser411Leufs) rs730881952
NM_005359.5(SMAD4):c.1236C>G (p.Tyr412Ter) rs121912577
NM_005359.5(SMAD4):c.1236C>T (p.Tyr412=) rs121912577
NM_005359.5(SMAD4):c.1239C>A (p.Tyr413Ter) rs730881954
NM_005359.5(SMAD4):c.1239_1241delCTT (p.Tyr413_Asp552del) rs1555686610
NM_005359.5(SMAD4):c.1242delA (p.Asp415Thrfs) rs377767358
NM_005359.5(SMAD4):c.1242dupA (p.Asp415Argfs) rs786201200
NM_005359.5(SMAD4):c.1245_1248delCAGA (p.Asp415Glufs) rs80338965
NM_005359.5(SMAD4):c.1248A>G (p.Arg416=) rs786202472
NM_005359.5(SMAD4):c.1254T>G (p.Ala418=) rs1186154913
NM_005359.5(SMAD4):c.1257G>C (p.Gly419=) rs1303474905
NM_005359.5(SMAD4):c.1258C>T (p.Arg420Cys) rs1367209662
NM_005359.5(SMAD4):c.1259G>A (p.Arg420His) rs1064793725
NM_005359.5(SMAD4):c.1259_1260insCG (p.Ala421Valfs) rs730881956
NM_005359.5(SMAD4):c.1263A>G (p.Ala421=) rs1406947861
NM_005359.5(SMAD4):c.1268delG (p.Gly423Glufs) rs377767359
NM_005359.5(SMAD4):c.126T>C (p.Ser42=) rs1057523114
NM_005359.5(SMAD4):c.1271dup (p.Asp424Glufs) rs1555686616
NM_005359.5(SMAD4):c.1276G>A (p.Val426Ile) rs1555686617
NM_005359.5(SMAD4):c.127T>G (p.Leu43Val) rs863224731
NM_005359.5(SMAD4):c.1280A>G (p.His427Arg) rs1555686619
NM_005359.5(SMAD4):c.1283A>C (p.Lys428Thr) rs1555686620
NM_005359.5(SMAD4):c.1287C>G (p.Ile429Met) rs1555686621
NM_005359.5(SMAD4):c.1287C>T (p.Ile429=) rs1555686621
NM_005359.5(SMAD4):c.1295G>A (p.Ser432Asn) rs770301659
NM_005359.5(SMAD4):c.1299A>G (p.Ala433=) rs370558697
NM_005359.5(SMAD4):c.1308+10A>G rs1060504024
NM_005359.5(SMAD4):c.1308+11A>C rs773719398
NM_005359.5(SMAD4):c.1308+1G>A rs587781618
NM_005359.5(SMAD4):c.1308+1G>T rs587781618
NM_005359.5(SMAD4):c.1308+2398T>G rs79208698
NM_005359.5(SMAD4):c.1308+2T>C rs1555686624
NM_005359.5(SMAD4):c.1308+4116C>T rs869312653
NM_005359.5(SMAD4):c.1308+4A>T rs1555686626
NM_005359.5(SMAD4):c.1308+623C>T rs146176832
NM_005359.5(SMAD4):c.1308+9C>A rs1057522058
NM_005359.5(SMAD4):c.1309-16T>C rs1555687375
NM_005359.5(SMAD4):c.1309-1G>A rs1555687377
NM_005359.5(SMAD4):c.1309-5A>G rs1568211170
NM_005359.5(SMAD4):c.1309G>A (p.Val437Ile) rs1568211172
NM_005359.5(SMAD4):c.1310T>G (p.Val437Gly) rs786203940
NM_005359.5(SMAD4):c.1311C>G (p.Val437=) rs751539807
NM_005359.5(SMAD4):c.1324C>T (p.Gln442Ter) rs1555687378
NM_005359.5(SMAD4):c.1326G>A (p.Gln442=) rs1568211178
NM_005359.5(SMAD4):c.1326G>C (p.Gln442His) rs1568211178
NM_005359.5(SMAD4):c.132A>G (p.Val44=) rs965942065
NM_005359.5(SMAD4):c.1333C>T (p.Arg445Ter) rs377767360
NM_005359.5(SMAD4):c.1338_1339delGA (p.Gln446Hisfs) rs730881957
NM_005359.5(SMAD4):c.1339A>C (p.Met447Leu) rs1568211184
NM_005359.5(SMAD4):c.1342C>T (p.Gln448Ter) rs377767361
NM_005359.5(SMAD4):c.1343_1365del (p.Gln448Argfs) rs377767362
NM_005359.5(SMAD4):c.1343_1367delAGCAGCAGGCGGCTACTGCACAAGC (p.Gln448Leufs) rs1568211187
NM_005359.5(SMAD4):c.1345C>T (p.Gln449Ter) rs587781359
NM_005359.5(SMAD4):c.1349_1376del28 (p.Gln450Leufs) rs876660720
NM_005359.5(SMAD4):c.1349_1376dup (p.Ala460Glyfs) rs876660720
NM_005359.5(SMAD4):c.1351_1375del25 (p.Ala451Leufs) rs587780124
NM_005359.5(SMAD4):c.1353G>A (p.Ala451=) rs1441353791
NM_005359.5(SMAD4):c.1353_1354insGCTACTGCACAAGCTGCAGCAGCTGCCC (p.Gln461Argfs) rs786204125
NM_005359.5(SMAD4):c.1358C>T (p.Thr453Ile) rs786205514
NM_005359.5(SMAD4):c.1361_1364delCACA (p.Ala454Glufs) rs377767363
NM_005359.5(SMAD4):c.1371A>G (p.Ala457=) rs750933193
NM_005359.5(SMAD4):c.138G>A (p.Lys46=) rs1555685022
NM_005359.5(SMAD4):c.1392C>A (p.Ala464=) rs140487104
NM_005359.5(SMAD4):c.1392C>T (p.Ala464=) rs140487104
NM_005359.5(SMAD4):c.1393G>A (p.Val465Met) rs786201798
NM_005359.5(SMAD4):c.1393G>T (p.Val465Leu) rs786201798
NM_005359.5(SMAD4):c.1395G>A (p.Val465=) rs1057521215
NM_005359.5(SMAD4):c.1403A>G (p.Asn468Ser) rs569981255
NM_005359.5(SMAD4):c.1405A>G (p.Ile469Val) rs876658851
NM_005359.5(SMAD4):c.1407_1410dup (p.Gly471Profs) rs1555687386
NM_005359.5(SMAD4):c.1409_1410insCCCT (p.Gly471Profs) rs377767364
NM_005359.5(SMAD4):c.1409delC (p.Pro470Leufs) rs1555687387
NM_005359.5(SMAD4):c.1411_1435del (p.Gly471Leufs) rs377767365
NM_005359.5(SMAD4):c.1418delG (p.Gly473Aspfs) rs1555687388
NM_005359.5(SMAD4):c.1421delC (p.Ser474Terfs) rs377767366
NM_005359.5(SMAD4):c.1422A>C (p.Ser474=) rs786201261
NM_005359.5(SMAD4):c.1423G>C (p.Val475Leu) rs864622428
NM_005359.5(SMAD4):c.1438C>T (p.Pro480Ser) rs1555687390
NM_005359.5(SMAD4):c.1440A>G (p.Pro480=) rs1555687392
NM_005359.5(SMAD4):c.1444A>G (p.Ile482Val) rs864622736
NM_005359.5(SMAD4):c.1447+16A>G rs776280713
NM_005359.5(SMAD4):c.1447+17T>C rs1024598107
NM_005359.5(SMAD4):c.1447+1G>A rs377767387
NM_005359.5(SMAD4):c.1447+2T>C rs1060500740
NM_005359.5(SMAD4):c.1447+3A>T rs754526507
NM_005359.5(SMAD4):c.1447+4A>G
NM_005359.5(SMAD4):c.1447+4dupA rs1555687399
NM_005359.5(SMAD4):c.1447+9G>A rs878854766
NM_005359.5(SMAD4):c.1448-10T>C rs1284568919
NM_005359.5(SMAD4):c.1448-113T>C rs145011178
NM_005359.5(SMAD4):c.1448-18C>T rs1568211501
NM_005359.5(SMAD4):c.1448-3T>A rs1555687536
NM_005359.5(SMAD4):c.1448-5G>C rs587781640
NM_005359.5(SMAD4):c.1448-6T>C rs1085307437
NM_005359.5(SMAD4):c.1448G>A (p.Ser483Asn) rs786204060
NM_005359.5(SMAD4):c.1449T>G (p.Ser483Arg) rs745598003
NM_005359.5(SMAD4):c.144G>A (p.Lys48=) rs1057523437
NM_005359.5(SMAD4):c.1452G>C (p.Leu484=) rs1555687538
NM_005359.5(SMAD4):c.1461T>A (p.Ala487=) rs769607309
NM_005359.5(SMAD4):c.1464T>C (p.Ala488=) rs1555687539
NM_005359.5(SMAD4):c.1472G>T (p.Gly491Val) rs377767367
NM_005359.5(SMAD4):c.1473T>C (p.Gly491=) rs1207826883
NM_005359.5(SMAD4):c.1477G>C (p.Asp493His) rs121912578
NM_005359.5(SMAD4):c.1478A>C (p.Asp493Ala) rs377767368
NM_005359.5(SMAD4):c.1479T>C (p.Asp493=) rs1568211528
NM_005359.5(SMAD4):c.147G>A (p.Glu49=) rs1555685024
NM_005359.5(SMAD4):c.1485T>G (p.Leu495=) rs1555687550
NM_005359.5(SMAD4):c.1486C>T (p.Arg496Cys) rs397518413
NM_005359.5(SMAD4):c.1487G>A (p.Arg496His) rs876660045
NM_005359.5(SMAD4):c.1489C>T (p.Arg497Cys) rs762118751
NM_005359.5(SMAD4):c.1492T>C (p.Leu498=) rs1057520520
NM_005359.5(SMAD4):c.1494A>G (p.Leu498=) rs772479430
NM_005359.5(SMAD4):c.1495T>C (p.Cys499Arg) rs1060500738
NM_005359.5(SMAD4):c.1498A>G (p.Ile500Val) rs281875322
NM_005359.5(SMAD4):c.1499T>C (p.Ile500Thr) rs281875321
NM_005359.5(SMAD4):c.1500A>G (p.Ile500Met) rs281875320
NM_005359.5(SMAD4):c.1501C>A (p.Leu501Ile) rs1555687568
NM_005359.5(SMAD4):c.150A>G (p.Lys50=) rs749503989
NM_005359.5(SMAD4):c.1512delT (p.Phe505Leufs) rs864622252
NM_005359.5(SMAD4):c.1516G>A (p.Val506Met) rs1060500746
NM_005359.5(SMAD4):c.1523G>A (p.Gly508Asp) rs1555687572
NM_005359.5(SMAD4):c.1525T>A (p.Trp509Arg) rs377767369
NM_005359.5(SMAD4):c.1525T>G (p.Trp509Gly) rs377767369
NM_005359.5(SMAD4):c.1527G>A (p.Trp509Ter) rs377767370
NM_005359.5(SMAD4):c.1529G>T (p.Gly510Val) rs377767371
NM_005359.5(SMAD4):c.1529delG (p.Gly510Aspfs) rs1060500744
NM_005359.5(SMAD4):c.1530A>G (p.Gly510=) rs1568211560
NM_005359.5(SMAD4):c.1532C>T (p.Pro511Leu) rs773367516
NM_005359.5(SMAD4):c.1533G>A (p.Pro511=) rs1057523968
NM_005359.5(SMAD4):c.1533G>T (p.Pro511=) rs1057523968
NM_005359.5(SMAD4):c.1534G>A (p.Asp512Asn) rs1555687578
NM_005359.5(SMAD4):c.153delA (p.Asp52Metfs) rs786203560
NM_005359.5(SMAD4):c.153dupA (p.Asp52Argfs) rs786203560
NM_005359.5(SMAD4):c.1543A>T (p.Arg515Ter) rs121912579
NM_005359.5(SMAD4):c.1544delG (p.Arg515Asnfs) rs377767372
NM_005359.5(SMAD4):c.1545A>G (p.Arg515=) rs760840557
NM_005359.5(SMAD4):c.1547A>G (p.Gln516Arg) rs786202496
NM_005359.5(SMAD4):c.1547_1550dupAGAG (p.Ser517Argfs) rs377767373
NM_005359.5(SMAD4):c.1547dupA (p.Ser517Glufs) rs587783060
NM_005359.5(SMAD4):c.1549_1550delAG (p.Ser517Hisfs) rs377767373
NM_005359.5(SMAD4):c.1554C>T (p.Ile518=) rs876660438
NM_005359.5(SMAD4):c.155A>T (p.Asp52Val) rs1057524809
NM_005359.5(SMAD4):c.1561A>C (p.Thr521Pro) rs786203930
NM_005359.5(SMAD4):c.1562C>T (p.Thr521Ile) rs876659840
NM_005359.5(SMAD4):c.1564_1565delCC (p.Pro522Leufs) rs377767374
NM_005359.5(SMAD4):c.1566T>G (p.Pro522=) rs1555687593
NM_005359.5(SMAD4):c.1571G>T (p.Trp524Leu) rs377767375
NM_005359.5(SMAD4):c.1571_1574delGGATins19 (p.?)
NM_005359.5(SMAD4):c.1572G>A (p.Trp524Ter) rs1568211588
NM_005359.5(SMAD4):c.1573A>G (p.Ile525Val) rs149755320
NM_005359.5(SMAD4):c.1585T>C (p.Leu529=) rs1555687596
NM_005359.5(SMAD4):c.1585_1586dupTT (p.Leu529Phefs) rs876660150
NM_005359.5(SMAD4):c.1586_1587dup (p.His530Tyrfs) rs1555687599
NM_005359.5(SMAD4):c.1587dup (p.His530Thrfs) rs377767376
NM_005359.5(SMAD4):c.1588delC (p.His530Thrfs) rs377767377
NM_005359.5(SMAD4):c.1591C>T (p.Arg531Trp)
NM_005359.5(SMAD4):c.1594delG (p.Ala532Profs) rs377767378
NM_005359.5(SMAD4):c.1596C>T (p.Ala532=) rs765606080
NM_005359.5(SMAD4):c.1596_1597delCCinsT (p.Leu533Serfs) rs377767379
NM_005359.5(SMAD4):c.1596delC (p.Leu533Serfs) rs377767380
NM_005359.5(SMAD4):c.1597C>G (p.Leu533Val) rs377767381
NM_005359.5(SMAD4):c.1597C>T (p.Leu533Phe) rs377767381
NM_005359.5(SMAD4):c.1598T>C (p.Leu533Pro) rs377767382
NM_005359.5(SMAD4):c.1598T>G (p.Leu533Arg) rs377767382
NM_005359.5(SMAD4):c.159A>G (p.Glu53=) rs768796731
NM_005359.5(SMAD4):c.1600C>T (p.Gln534Ter) rs377767383
NM_005359.5(SMAD4):c.1606C>T (p.Leu536=) rs587780790
NM_005359.5(SMAD4):c.1607dup (p.Asp537Argfs) rs377767384
NM_005359.5(SMAD4):c.1608A>G (p.Leu536=) rs753128184
NM_005359.5(SMAD4):c.1609G>T (p.Asp537Tyr) rs1057519741
NM_005359.5(SMAD4):c.160T>C (p.Leu54=) rs1053158497
NM_005359.5(SMAD4):c.1610A>G (p.Asp537Gly) rs1555687605
NM_005359.5(SMAD4):c.1611C>T (p.Asp537=) rs369598262
NM_005359.5(SMAD4):c.1612G>T (p.Glu538Ter) rs1568211615
NM_005359.5(SMAD4):c.1612_1625del (p.Glu538Hisfs) rs377767385
NM_005359.5(SMAD4):c.1616_1631del16insCA (p.Val539Alafs) rs1568211617
NM_005359.5(SMAD4):c.1632G>A (p.Pro544=) rs549489716
NM_005359.5(SMAD4):c.1632G>C (p.Pro544=) rs549489716
NM_005359.5(SMAD4):c.1634T>A (p.Ile545Asn) rs730881955
NM_005359.5(SMAD4):c.1635T>G (p.Ile545Met) rs200595795
NM_005359.5(SMAD4):c.1641C>T (p.Asp547=) rs1057523337
NM_005359.5(SMAD4):c.1642C>G (p.Pro548Ala) rs876658866
NM_005359.5(SMAD4):c.1644A>G (p.Pro548=) rs756795016
NM_005359.5(SMAD4):c.1645C>T (p.Gln549Ter) rs1555687613
NM_005359.5(SMAD4):c.1647A>G (p.Gln549=) rs113545983
NM_005359.5(SMAD4):c.1647delA (p.Gln549Hisfs) rs1555687615
NM_005359.5(SMAD4):c.1651T>G (p.Leu551Val) rs1064793950
NM_005359.5(SMAD4):c.1653A>G (p.Leu551=) rs199526820
NM_005359.5(SMAD4):c.168T>A (p.Ser56=) rs1333506128
NM_005359.5(SMAD4):c.16A>G (p.Ile6Val) rs1376500870
NM_005359.5(SMAD4):c.172A>G (p.Ile58Val) rs786204166
NM_005359.5(SMAD4):c.175A>G (p.Thr59Ala) rs587781977
NM_005359.5(SMAD4):c.177A>G (p.Thr59=) rs774480995
NM_005359.5(SMAD4):c.179C>T (p.Ala60Val) rs1555685030
NM_005359.5(SMAD4):c.181A>C (p.Ile61Leu) rs1064794204
NM_005359.5(SMAD4):c.181A>G (p.Ile61Val) rs1064794204
NM_005359.5(SMAD4):c.183A>C (p.Ile61=) rs761937143
NM_005359.5(SMAD4):c.189A>G (p.Thr63=) rs1555685033
NM_005359.5(SMAD4):c.189_197delAAATGGAGCins44 (p.?)
NM_005359.5(SMAD4):c.192T>C (p.Asn64=) rs1555685037
NM_005359.5(SMAD4):c.198T>C (p.Ala66=) rs1568203034
NM_005359.5(SMAD4):c.1A>G (p.Met1Val) rs1064795777
NM_005359.5(SMAD4):c.209A>C (p.Lys70Thr) rs1555685038
NM_005359.5(SMAD4):c.209A>G (p.Lys70Arg) rs1555685038
NM_005359.5(SMAD4):c.20C>T (p.Thr7Met) rs372316981
NM_005359.5(SMAD4):c.21G>A (p.Thr7=) rs142292491
NM_005359.5(SMAD4):c.21G>T (p.Thr7=) rs142292491
NM_005359.5(SMAD4):c.228A>G (p.Arg76=) rs587780556
NM_005359.5(SMAD4):c.231A>G (p.Thr77=) rs760990830
NM_005359.5(SMAD4):c.23A>G (p.Asn8Ser) rs876658568
NM_005359.5(SMAD4):c.249+10A>C rs752243771
NM_005359.5(SMAD4):c.249+14G>A rs777811251
NM_005359.5(SMAD4):c.249+20T>C
NM_005359.5(SMAD4):c.249+21dup rs1568203059
NM_005359.5(SMAD4):c.249+24A>G rs77389132
NM_005359.5(SMAD4):c.249+6T>A
NM_005359.5(SMAD4):c.249+9T>C rs770523387
NM_005359.5(SMAD4):c.249_249+6dup rs1555685040
NM_005359.5(SMAD4):c.250-14G>A rs1180310843
NM_005359.5(SMAD4):c.250-15C>T rs375910294
NM_005359.5(SMAD4):c.250-1G>C rs1555685149
NM_005359.5(SMAD4):c.250-2A>G rs1555685142
NM_005359.5(SMAD4):c.250-3T>C rs1555685140
NM_005359.5(SMAD4):c.250-589A>G rs869312650
NM_005359.5(SMAD4):c.250-5T>C rs1232598459
NM_005359.5(SMAD4):c.255T>G (p.Ala85=) rs1555685152
NM_005359.5(SMAD4):c.260G>C (p.Arg87Pro) rs1060500735
NM_005359.5(SMAD4):c.261G>A (p.Arg87=) rs1057520857
NM_005359.5(SMAD4):c.263_267delAAGGA (p.Lys88Ilefs) rs1060500739
NM_005359.5(SMAD4):c.264A>G (p.Lys88=) rs1555685155
NM_005359.5(SMAD4):c.26C>T (p.Thr9Ile) rs1555684986
NM_005359.5(SMAD4):c.275_276delAT (p.His92Argfs) rs1555685156
NM_005359.5(SMAD4):c.276T>C (p.His92=) rs762501162
NM_005359.5(SMAD4):c.279G>C (p.Val93=) rs1568203425
NM_005359.5(SMAD4):c.27A>G (p.Thr9=) rs1360609728
NM_005359.5(SMAD4):c.289C>T (p.Arg97Cys) rs1555685158
NM_005359.5(SMAD4):c.290G>A (p.Arg97His) rs1555685159
NM_005359.5(SMAD4):c.290G>T (p.Arg97Leu) rs1555685159
NM_005359.5(SMAD4):c.294C>T (p.Leu98=) rs202126703
NM_005359.5(SMAD4):c.297G>A (p.Trp99Ter) rs876660079
NM_005359.5(SMAD4):c.298A>C (p.Arg100=) rs751154230
NM_005359.5(SMAD4):c.302G>A (p.Trp101Ter) rs377767323
NM_005359.5(SMAD4):c.304C>G (p.Pro102Ala) rs1568203445
NM_005359.5(SMAD4):c.315C>T (p.His105=) rs1555685161
NM_005359.5(SMAD4):c.319A>G (p.Asn107Asp) rs1555685162
NM_005359.5(SMAD4):c.31A>G (p.Thr11Ala) rs587780791
NM_005359.5(SMAD4):c.320A>G (p.Asn107Ser) rs1555685163
NM_005359.5(SMAD4):c.325C>T (p.Leu109=) rs1248541873
NM_005359.5(SMAD4):c.326delTinsAAATATGAAC (p.Leu109_Cys443delinsGlnIleTer) rs727504151
NM_005359.5(SMAD4):c.327A>G (p.Leu109=) rs1555685165
NM_005359.5(SMAD4):c.332A>C (p.His111Pro) rs1064794363
NM_005359.5(SMAD4):c.333T>A (p.His111Gln) rs1568203454
NM_005359.5(SMAD4):c.336T>A (p.Val112=) rs1328102060
NM_005359.5(SMAD4):c.339A>G (p.Lys113=) rs1568203460
NM_005359.5(SMAD4):c.340T>A (p.Tyr114Asn) rs1555685170
NM_005359.5(SMAD4):c.342T>C (p.Tyr114=) rs757211048
NM_005359.5(SMAD4):c.344G>A (p.Cys115Tyr) rs876659844
NM_005359.5(SMAD4):c.351T>C (p.Tyr117=) rs1555685176
NM_005359.5(SMAD4):c.354G>A (p.Ala118=) rs145988618
NM_005359.5(SMAD4):c.366A>G (p.Lys122=) rs1057524633
NM_005359.5(SMAD4):c.367T>C (p.Cys123Arg) rs1568203472
NM_005359.5(SMAD4):c.369T>C (p.Cys123=) rs140926102
NM_005359.5(SMAD4):c.372T>C (p.Asp124=) rs1555685178
NM_005359.5(SMAD4):c.373_374insAT (p.Ser125Asnfs) rs377767324
NM_005359.5(SMAD4):c.375T>C (p.Ser125=) rs863224401
NM_005359.5(SMAD4):c.375_381dup (p.Val128Cysfs) rs377767325
NM_005359.5(SMAD4):c.378C>T (p.Val126=) rs1555685181
NM_005359.5(SMAD4):c.380G>A (p.Cys127Tyr) rs1555685182
NM_005359.5(SMAD4):c.384G>A (p.Val128=) rs1555685184
NM_005359.5(SMAD4):c.387T>C (p.Asn129=) rs150229208
NM_005359.5(SMAD4):c.388C>T (p.Pro130Ser) rs1555685186
NM_005359.5(SMAD4):c.38A>G (p.Asn13Ser) rs281875323
NM_005359.5(SMAD4):c.390A>G (p.Pro130=) rs755862230
NM_005359.5(SMAD4):c.394C>T (p.His132Tyr) rs1060500743
NM_005359.5(SMAD4):c.399C>T (p.Tyr133=) rs779069779
NM_005359.5(SMAD4):c.39T>C (p.Asn13=) rs376371717
NM_005359.5(SMAD4):c.403C>T (p.Arg135Ter) rs377767326
NM_005359.5(SMAD4):c.411A>G (p.Val137=) rs201296880
NM_005359.5(SMAD4):c.424+12_424+13delTT rs749922210
NM_005359.5(SMAD4):c.424+14G>A rs1057523947
NM_005359.5(SMAD4):c.424+165A>G rs182981059
NM_005359.5(SMAD4):c.424+19C>A rs1004249434
NM_005359.5(SMAD4):c.424+1G>A rs377767386
NM_005359.5(SMAD4):c.424+5G>A rs200772603
NM_005359.5(SMAD4):c.424+6T>C rs771456293
NM_005359.5(SMAD4):c.425-17C>T rs767419859
NM_005359.5(SMAD4):c.425-5T>C rs1555685238
NM_005359.5(SMAD4):c.425-6A>G rs377767327
NM_005359.5(SMAD4):c.425-8C>T rs1555685237
NM_005359.5(SMAD4):c.427C>T (p.Leu143Phe) rs1568203595
NM_005359.5(SMAD4):c.430_431delTC (p.Ser144Argfs) rs377767328
NM_005359.5(SMAD4):c.432A>C (p.Ser144=) rs1568203600
NM_005359.5(SMAD4):c.437T>A (p.Leu146Ter) rs377767329
NM_005359.5(SMAD4):c.442C>G (p.Leu148Val) rs1568203602
NM_005359.5(SMAD4):c.443delT (p.Leu148Argfs)
NM_005359.5(SMAD4):c.449G>A (p.Ser150Asn) rs750355699
NM_005359.5(SMAD4):c.454+20C>T rs758615780
NM_005359.5(SMAD4):c.454+291T>A rs182939830
NM_005359.5(SMAD4):c.454+2T>C rs1555685248
NM_005359.5(SMAD4):c.454+7A>C rs755891338
NM_005359.5(SMAD4):c.454+8A>T rs864622099
NM_005359.5(SMAD4):c.455-1921T>G rs869312652
NM_005359.5(SMAD4):c.455-43A>T rs149541014
NM_005359.5(SMAD4):c.455-6A>G rs181178864
NM_005359.5(SMAD4):c.455-8C>T rs1057520412
NM_005359.5(SMAD4):c.455C>A (p.Ala152Asp) rs1568204964
NM_005359.5(SMAD4):c.45C>T (p.Ala15=) rs1555684991
NM_005359.5(SMAD4):c.460T>G (p.Ser154Ala) rs864622209
NM_005359.5(SMAD4):c.461C>G (p.Ser154Ter) rs1555685624
NM_005359.5(SMAD4):c.463A>G (p.Ser155Gly) rs1057519259
NM_005359.5(SMAD4):c.464G>A (p.Ser155Asn) rs199790852
NM_005359.5(SMAD4):c.466A>T (p.Met156Leu) rs534355764
NM_005359.5(SMAD4):c.469_471delATG (p.Met157del) rs786201939
NM_005359.5(SMAD4):c.470T>C (p.Met157Thr) rs756675590
NM_005359.5(SMAD4):c.471G>A (p.Met157Ile) rs780716382
NM_005359.5(SMAD4):c.472G>T (p.Val158Leu) rs1555685628
NM_005359.5(SMAD4):c.474G>A (p.Val158=) rs749594930
NM_005359.5(SMAD4):c.479A>G (p.Asp160Gly) rs1555685629
NM_005359.5(SMAD4):c.47G>C (p.Cys16Ser) rs1555684993
NM_005359.5(SMAD4):c.483A>G (p.Glu161=) rs786201120
NM_005359.5(SMAD4):c.484T>C (p.Tyr162His) rs786203155
NM_005359.5(SMAD4):c.486T>C (p.Tyr162=) rs1057523970
NM_005359.5(SMAD4):c.491A>G (p.His164Arg) rs876660058
NM_005359.5(SMAD4):c.49C>T (p.Leu17=) rs1555684997
NM_005359.5(SMAD4):c.4G>A (p.Asp2Asn) rs1555684979
NM_005359.5(SMAD4):c.503G>A (p.Gly168Glu) rs1555685631
NM_005359.5(SMAD4):c.507G>A (p.Gln169=) rs876659426
NM_005359.5(SMAD4):c.510A>G (p.Pro170=) rs144226135
NM_005359.5(SMAD4):c.512C>T (p.Ser171Leu) rs1568205010
NM_005359.5(SMAD4):c.516G>A (p.Leu172=) rs1392368498
NM_005359.5(SMAD4):c.516_527del (p.Ser173_Gly176del) rs377767330
NM_005359.5(SMAD4):c.519C>T (p.Ser173=) rs778576111
NM_005359.5(SMAD4):c.521C>A (p.Thr174Asn) rs138800446
NM_005359.5(SMAD4):c.525A>G (p.Glu175=) rs368528856
NM_005359.5(SMAD4):c.530A>C (p.His177Pro) rs1568205026
NM_005359.5(SMAD4):c.533C>G (p.Ser178Ter) rs377767331
NM_005359.5(SMAD4):c.535A>G (p.Ile179Val) rs542392980
NM_005359.5(SMAD4):c.535A>T (p.Ile179Phe) rs542392980
NM_005359.5(SMAD4):c.538C>T (p.Gln180Ter) rs377767332
NM_005359.5(SMAD4):c.547C>G (p.Gln183Glu) rs1555685645
NM_005359.5(SMAD4):c.554C>A (p.Pro185Gln) rs770798845
NM_005359.5(SMAD4):c.554C>T (p.Pro185Leu) rs770798845
NM_005359.5(SMAD4):c.556C>G (p.Pro186Ala) rs1555685648
NM_005359.5(SMAD4):c.55A>G (p.Ile19Val) rs1568202964
NM_005359.5(SMAD4):c.560G>A (p.Ser187Asn) rs927620013
NM_005359.5(SMAD4):c.565C>A (p.Arg189Ser) rs140743238
NM_005359.5(SMAD4):c.565C>G (p.Arg189Gly) rs140743238
NM_005359.5(SMAD4):c.565C>T (p.Arg189Cys) rs140743238
NM_005359.5(SMAD4):c.566G>A (p.Arg189His) rs759288477
NM_005359.5(SMAD4):c.566G>T (p.Arg189Leu) rs759288477
NM_005359.5(SMAD4):c.568G>T (p.Ala190Ser) rs61751988
NM_005359.5(SMAD4):c.570A>C (p.Ala190=) rs200717327
NM_005359.5(SMAD4):c.573G>A (p.Ser191=) rs761936246
NM_005359.5(SMAD4):c.575C>T (p.Thr192Ile) rs587780792
NM_005359.5(SMAD4):c.580A>G (p.Thr194Ala) rs1432058632
NM_005359.5(SMAD4):c.580A>T (p.Thr194Ser) rs1432058632
NM_005359.5(SMAD4):c.582A>G (p.Thr194=) rs145805120
NM_005359.5(SMAD4):c.584A>G (p.Tyr195Cys) rs1555685656
NM_005359.5(SMAD4):c.585C>G (p.Tyr195Ter) rs1316902116
NM_005359.5(SMAD4):c.585C>T (p.Tyr195=) rs1316902116
NM_005359.5(SMAD4):c.586A>G (p.Ser196Gly) rs946539148
NM_005359.5(SMAD4):c.58G>T (p.Val20Leu) rs1568202971
NM_005359.5(SMAD4):c.591C>G (p.Thr197=) rs1464524083
NM_005359.5(SMAD4):c.593C>G (p.Pro198Arg) rs1189715258
NM_005359.5(SMAD4):c.594A>C (p.Pro198=) rs547278031
NM_005359.5(SMAD4):c.599T>C (p.Leu200Pro) rs786203737
NM_005359.5(SMAD4):c.606C>G (p.Ala202=) rs780665234
NM_005359.5(SMAD4):c.607C>G (p.Pro203Ala) rs199809905
NM_005359.5(SMAD4):c.608delC (p.Pro203Hisfs) rs377767333
NM_005359.5(SMAD4):c.60G>A (p.Val20=) rs1057520442
NM_005359.5(SMAD4):c.614A>C (p.Glu205Ala) rs748615724
NM_005359.5(SMAD4):c.615G>A (p.Glu205=) rs1555685667
NM_005359.5(SMAD4):c.615G>T (p.Glu205Asp) rs1555685667
NM_005359.5(SMAD4):c.620A>G (p.Asn207Ser) rs1568205077
NM_005359.5(SMAD4):c.621T>C (p.Asn207=) rs1452122852
NM_005359.5(SMAD4):c.625A>G (p.Thr209Ala) rs1555685670
NM_005359.5(SMAD4):c.627C>T (p.Thr209=) rs905151346
NM_005359.5(SMAD4):c.628A>G (p.Ser210Gly) rs1568205087
NM_005359.5(SMAD4):c.62A>G (p.His21Arg) rs1280706054
NM_005359.5(SMAD4):c.632C>G (p.Thr211Ser) rs1555685671
NM_005359.5(SMAD4):c.633T>C (p.Thr211=) rs1060504027
NM_005359.5(SMAD4):c.634G>A (p.Ala212Thr) rs863224732
NM_005359.5(SMAD4):c.638A>G (p.Asn213Ser) rs757977781
NM_005359.5(SMAD4):c.639C>T (p.Asn213=) rs878854767
NM_005359.5(SMAD4):c.63T>C (p.His21=) rs1555685004
NM_005359.5(SMAD4):c.641T>A (p.Phe214Tyr) rs1060500736
NM_005359.5(SMAD4):c.643C>T (p.Pro215Ser) rs1064793270
NM_005359.5(SMAD4):c.644C>G (p.Pro215Arg) rs777495692
NM_005359.5(SMAD4):c.647A>G (p.Asn216Ser) rs138386557
NM_005359.5(SMAD4):c.650T>G (p.Ile217Ser) rs1555685674
NM_005359.5(SMAD4):c.651T>A (p.Ile217=) rs997151197
NM_005359.5(SMAD4):c.651T>G (p.Ile217Met) rs997151197
NM_005359.5(SMAD4):c.652C>G (p.Pro218Ala) rs1345146274
NM_005359.5(SMAD4):c.661T>A (p.Ser221Thr) rs1568205115
NM_005359.5(SMAD4):c.664A>G (p.Thr222Ala) rs770461626
NM_005359.5(SMAD4):c.667+10A>G
NM_005359.5(SMAD4):c.667+12A>C rs1555685677
NM_005359.5(SMAD4):c.667+17G>A rs370726274
NM_005359.5(SMAD4):c.667+20G>T rs547532436
NM_005359.5(SMAD4):c.667+22_667+24delAGT rs753440205
NM_005359.5(SMAD4):c.667+299T>C rs869312648
NM_005359.5(SMAD4):c.667+3G>A rs757971589
NM_005359.5(SMAD4):c.667+54T>C rs371193569
NM_005359.5(SMAD4):c.667+6T>C rs1060500745
NM_005359.5(SMAD4):c.667+9T>C rs776523203
NM_005359.5(SMAD4):c.667A>G (p.Ser223Gly) rs1568205121
NM_005359.5(SMAD4):c.668-1111A>G rs140846022
NM_005359.5(SMAD4):c.668-11T>G rs1469889617
NM_005359.5(SMAD4):c.668-16C>A rs775498596
NM_005359.5(SMAD4):c.668-19T>G rs1555685896
NM_005359.5(SMAD4):c.668-3T>C rs1568206021
NM_005359.5(SMAD4):c.668-6C>G rs748992694
NM_005359.5(SMAD4):c.668-7C>T rs1060504028
NM_005359.5(SMAD4):c.668-?_1659+?del
NM_005359.5(SMAD4):c.668G>T (p.Ser223Ile) rs774334251
NM_005359.5(SMAD4):c.669_691delTCAGCCTGCCAGTATACTGGGGG (p.Ser223Argfs) rs1064793271
NM_005359.5(SMAD4):c.671A>T (p.Gln224Leu) rs587780793
NM_005359.5(SMAD4):c.675_676delTGinsCC (p.Ala226Pro) rs1568206030
NM_005359.5(SMAD4):c.677C>T (p.Ala226Val) rs539739051
NM_005359.5(SMAD4):c.679A>G (p.Ser227Gly) rs1443767329
NM_005359.5(SMAD4):c.682A>G (p.Ile228Val) rs1280682459
NM_005359.5(SMAD4):c.684A>C (p.Ile228=) rs1555685906
NM_005359.5(SMAD4):c.688G>C (p.Gly230Arg) rs1568206043
NM_005359.5(SMAD4):c.692G>C (p.Gly231Ala) rs759679579
NM_005359.5(SMAD4):c.692dupG (p.Ser232Glnfs) rs377767334
NM_005359.5(SMAD4):c.693C>T (p.Gly231=) rs765597059
NM_005359.5(SMAD4):c.697C>A (p.His233Asn) rs552880257
NM_005359.5(SMAD4):c.698A>G (p.His233Arg) rs1555685910
NM_005359.5(SMAD4):c.699T>C (p.His233=) rs367964910
NM_005359.5(SMAD4):c.69delG (p.Met24Cysfs)
NM_005359.5(SMAD4):c.700A>C (p.Ser234Arg) rs758642067
NM_005359.5(SMAD4):c.700A>G (p.Ser234Gly) rs758642067
NM_005359.5(SMAD4):c.702T>G (p.Ser234Arg) rs1555685911
NM_005359.5(SMAD4):c.705A>G (p.Glu235=) rs1555685912
NM_005359.5(SMAD4):c.706G>A (p.Gly236Arg) rs876658788
NM_005359.5(SMAD4):c.707G>A (p.Gly236Glu) rs1568206062
NM_005359.5(SMAD4):c.70A>G (p.Met24Val) rs876659391
NM_005359.5(SMAD4):c.715C>G (p.Gln239Glu) rs1163381283
NM_005359.5(SMAD4):c.716A>T (p.Gln239Leu) rs1555685916
NM_005359.5(SMAD4):c.728_735delGGCCTCAG (p.Gly243Alafs) rs1060500742
NM_005359.5(SMAD4):c.731_732insGCCC(p.Gln245Profs) rs377767335
NM_005359.5(SMAD4):c.736C>A (p.Pro246Thr) rs876659967
NM_005359.5(SMAD4):c.741A>G (p.Gly247=) rs1555685919
NM_005359.5(SMAD4):c.743A>T (p.Gln248Leu) rs751985298
NM_005359.5(SMAD4):c.745C>G (p.Gln249Glu) rs1370953444
NM_005359.5(SMAD4):c.746_747delAGinsCC (p.Gln249Pro) rs587782209
NM_005359.5(SMAD4):c.749A>G (p.Gln250Arg) rs879254159
NM_005359.5(SMAD4):c.750G>A (p.Gln250=) rs1555685922
NM_005359.5(SMAD4):c.752A>G (p.Asn251Ser) rs1555685926
NM_005359.5(SMAD4):c.752delA (p.Asn251Metfs) rs1555685925
NM_005359.5(SMAD4):c.755G>T (p.Gly252Val) rs878854768
NM_005359.5(SMAD4):c.756A>G (p.Gly252=) rs1244121412
NM_005359.5(SMAD4):c.75C>T (p.Cys25=) rs1555685008
NM_005359.5(SMAD4):c.760A>G (p.Thr254Ala) rs1284924848
NM_005359.5(SMAD4):c.763G>T (p.Gly255Cys) rs1555685930
NM_005359.5(SMAD4):c.768G>A (p.Gln256=) rs755677513
NM_005359.5(SMAD4):c.776C>T (p.Thr259Ile) rs786202113
NM_005359.5(SMAD4):c.777T>C (p.Thr259=) rs1555685935
NM_005359.5(SMAD4):c.779A>C (p.Tyr260Ser) rs1555685937
NM_005359.5(SMAD4):c.780C>T (p.Tyr260=) rs1568206103
NM_005359.5(SMAD4):c.787+15T>A rs374687785
NM_005359.5(SMAD4):c.787+15T>C rs374687785
NM_005359.5(SMAD4):c.787+15T>G rs374687785
NM_005359.5(SMAD4):c.787+18A>C rs748015964
NM_005359.5(SMAD4):c.787+1G>A rs1568206107
NM_005359.5(SMAD4):c.787+21dup rs1312566534
NM_005359.5(SMAD4):c.787+7A>G rs779803439
NM_005359.5(SMAD4):c.787+8C>T rs749225244
NM_005359.5(SMAD4):c.787A>G (p.Asn263Asp) rs1568206105
NM_005359.5(SMAD4):c.788-12delC rs1064794372
NM_005359.5(SMAD4):c.788-14G>A rs769943457
NM_005359.5(SMAD4):c.788-14G>T rs769943457
NM_005359.5(SMAD4):c.788-3T>C rs1555685949
NM_005359.5(SMAD4):c.788-9A>C rs775484792
NM_005359.5(SMAD4):c.788-?_1659+?del
NM_005359.5(SMAD4):c.789C>T (p.Asn263=) rs763510526
NM_005359.5(SMAD4):c.790A>G (p.Ser264Gly) rs587780125
NM_005359.5(SMAD4):c.792C>T (p.Ser264=) rs1555685951
NM_005359.5(SMAD4):c.795T>C (p.Thr265=) rs1568206153
NM_005359.5(SMAD4):c.798C>T (p.Thr266=) rs876660662
NM_005359.5(SMAD4):c.799A>C (p.Thr267Pro) rs1064793728
NM_005359.5(SMAD4):c.800C>T (p.Thr267Ile) rs1555685955
NM_005359.5(SMAD4):c.812G>A (p.Ser271Asn) rs1343555503
NM_005359.5(SMAD4):c.816G>A (p.Arg272=) rs1231028123
NM_005359.5(SMAD4):c.825A>G (p.Pro275=) rs762166596
NM_005359.5(SMAD4):c.829A>G (p.Thr277Ala) rs1555685960
NM_005359.5(SMAD4):c.831_832delAC (p.Pro278Terfs) rs377767336
NM_005359.5(SMAD4):c.837T>C (p.Asn279=) rs1555685961
NM_005359.5(SMAD4):c.842C>T (p.Pro281Leu) rs1568206174
NM_005359.5(SMAD4):c.845A>C (p.His282Pro) rs1555685962
NM_005359.5(SMAD4):c.84A>G (p.Gln28=) rs778465458
NM_005359.5(SMAD4):c.852A>G (p.Gln284=) rs144378484
NM_005359.5(SMAD4):c.855C>T (p.Asn285=) rs1187796771
NM_005359.5(SMAD4):c.856G>A (p.Gly286Ser) rs750111831
NM_005359.5(SMAD4):c.860A>G (p.His287Arg) rs1568206180
NM_005359.5(SMAD4):c.861T>C (p.His287=) rs1555685963
NM_005359.5(SMAD4):c.870C>T (p.His290=) rs1060504029
NM_005359.5(SMAD4):c.871C>T (p.His291Tyr) rs863224733
NM_005359.5(SMAD4):c.875C>T (p.Pro292Leu) rs786201404
NM_005359.5(SMAD4):c.876G>A (p.Pro292=) rs753358186
NM_005359.5(SMAD4):c.877C>T (p.Pro293Ser) rs1555685965
NM_005359.5(SMAD4):c.87T>G (p.Gly29=) rs886053893
NM_005359.5(SMAD4):c.880A>G (p.Met294Val) rs7238500
NM_005359.5(SMAD4):c.884C>T (p.Pro295Leu) rs370176106
NM_005359.5(SMAD4):c.885G>A (p.Pro295=) rs772028872
NM_005359.5(SMAD4):c.886_895delCCCCATCCCG (p.Pro296Aspfs) rs869312781
NM_005359.5(SMAD4):c.887C>A (p.Pro296His) rs1417632301
NM_005359.5(SMAD4):c.888C>G (p.Pro296=) rs1060504026
NM_005359.5(SMAD4):c.890A>G (p.His297Arg) rs1060500737
NM_005359.5(SMAD4):c.894C>T (p.Pro298=) rs781519690
NM_005359.5(SMAD4):c.898_904+1dupCATTACTG rs1555685974
NM_005359.5(SMAD4):c.899A>G (p.His300Arg) rs1060500731
NM_005359.5(SMAD4):c.8A>G (p.Asn3Ser)
NM_005359.5(SMAD4):c.903C>G (p.Tyr301Ter) rs746084369
NM_005359.5(SMAD4):c.903delC (p.Trp302Glyfs) rs1555685978
NM_005359.5(SMAD4):c.904+12_904+13insT rs759701996
NM_005359.5(SMAD4):c.904+14T>C rs200973136
NM_005359.5(SMAD4):c.904+298T>C rs869312649
NM_005359.5(SMAD4):c.904+29A>T rs543382977
NM_005359.5(SMAD4):c.904+45del rs386387676
NM_005359.5(SMAD4):c.904+45dup rs386387676
NM_005359.5(SMAD4):c.904+7T>G rs1207550894
NM_005359.5(SMAD4):c.904T>C (p.Trp302Arg) rs1555685979
NM_005359.5(SMAD4):c.905-19_905-17delTTT rs746847153
NM_005359.5(SMAD4):c.905-1G>A rs1555686070
NM_005359.5(SMAD4):c.905-32T=
NM_005359.5(SMAD4):c.905-3T>C
NM_005359.5(SMAD4):c.905-52A>G rs948589
NM_005359.5(SMAD4):c.905-9T>C rs1064795175
NM_005359.5(SMAD4):c.905G>A (p.Trp302Ter) rs1555686071
NM_005359.5(SMAD4):c.906G>A (p.Trp302Ter) rs878854769
NM_005359.5(SMAD4):c.907C>G (p.Pro303Ala) rs1568206575
NM_005359.5(SMAD4):c.909T>C (p.Pro303=) rs141149381
NM_005359.5(SMAD4):c.909T>G (p.Pro303=) rs141149381
NM_005359.5(SMAD4):c.90A>G (p.Gly30=) rs876660353
NM_005359.5(SMAD4):c.910G>A (p.Val304Ile) rs375185293
NM_005359.5(SMAD4):c.914A>C (p.His305Pro) rs1555686072
NM_005359.5(SMAD4):c.917A>G (p.Asn306Ser) rs730881953
NM_005359.5(SMAD4):c.918T>G (p.Asn306Lys) rs1555686075
NM_005359.5(SMAD4):c.919G>A (p.Glu307Lys) rs1555686079
NM_005359.5(SMAD4):c.921G>A (p.Glu307=) rs876660255
NM_005359.5(SMAD4):c.924T>C (p.Leu308=) rs864622414
NM_005359.5(SMAD4):c.925_928dupGCAT (p.Phe310Cysfs) rs377767338
NM_005359.5(SMAD4):c.927A>C (p.Ala309=) rs369088915
NM_005359.5(SMAD4):c.927A>G (p.Ala309=) rs369088915
NM_005359.5(SMAD4):c.930C>G (p.Phe310Leu) rs876658257
NM_005359.5(SMAD4):c.931C>T (p.Gln311Ter) rs876658694
NM_005359.5(SMAD4):c.935C>G (p.Pro312Arg) rs1555686082
NM_005359.5(SMAD4):c.939C>T (p.Pro313=) rs1305282354
NM_005359.5(SMAD4):c.939dup (p.Ile314Hisfs) rs1568206602
NM_005359.5(SMAD4):c.940A>G (p.Ile314Val) rs748622028
NM_005359.5(SMAD4):c.945C>T (p.Ser315=) rs1408798906
NM_005359.5(SMAD4):c.947A>G (p.Asn316Ser) rs377119288
NM_005359.5(SMAD4):c.954T>A (p.Pro318=) rs773615487
NM_005359.5(SMAD4):c.954T>C (p.Pro318=) rs773615487
NM_005359.5(SMAD4):c.955+15A>G rs185228929
NM_005359.5(SMAD4):c.955+15_955+17delAAA rs1555686095
NM_005359.5(SMAD4):c.955+19T>C rs372903861
NM_005359.5(SMAD4):c.955+1delG rs1555686086
NM_005359.5(SMAD4):c.955+25_955+43del rs1555686098
NM_005359.5(SMAD4):c.955+7G>A rs200386455
NM_005359.5(SMAD4):c.956-19T>C rs1203972910
NM_005359.5(SMAD4):c.956-3T>C rs748283001
NM_005359.5(SMAD4):c.956-4A>G rs1295343500
NM_005359.5(SMAD4):c.956-5T>C rs1057521660
NM_005359.5(SMAD4):c.956-7C>T rs778959035
NM_005359.5(SMAD4):c.963G>A (p.Glu321=) rs1057523565
NM_005359.5(SMAD4):c.966T>C (p.Tyr322=) rs1465916558
NM_005359.5(SMAD4):c.969G>T (p.Trp323Cys)
NM_005359.5(SMAD4):c.970T>C (p.Cys324Arg) rs377767339
NM_005359.5(SMAD4):c.971delG (p.Cys324Phefs) rs377767340
NM_005359.5(SMAD4):c.975C>T (p.Ser325=) rs1228827259
NM_005359.5(SMAD4):c.982_983insT (p.Tyr328Leufs) rs377767341
NM_005359.5(SMAD4):c.988G>A (p.Glu330Lys) rs377767342
NM_005359.5(SMAD4):c.989A>C (p.Glu330Ala) rs281875324
NM_005359.5(SMAD4):c.989A>G (p.Glu330Gly) rs281875324
NM_005359.5(SMAD4):c.9T>C (p.Asn3=) rs762273127
NM_005359.5:c.1018A>G
NM_005359.5:c.1063_1064insGACCCTTCTGGAGGAGATCGCTTTTGTTTGGGTCAACTCTCCAATGTCCACAGGACAGAAGCCATTGAGAGAGCAAGGTATTGATTG
NM_005359.5:c.1148T>G
NM_005359.5:c.1194G>A
NM_005359.5:c.119T>C
NM_005359.5:c.1213C>T
NM_005359.5:c.1228-1229delCA rs483352871
NM_005359.5:c.1249_1250delGA
NM_005359.5:c.1321C>T
NM_005359.5:c.1322G>A
NM_005359.5:c.1342C>G
NM_005359.5:c.1352C>A
NM_005359.5:c.1352C>T
NM_005359.5:c.1363C>T
NM_005359.5:c.1588C>A
NM_005359.5:c.1604_1605delTCinsAA
NM_005359.5:c.196G>A
NM_005359.5:c.203C>T
NM_005359.5:c.247C>T
NM_005359.5:c.267A>T
NM_005359.5:c.399C>A
NM_005359.5:c.3G>C
NM_005359.5:c.422T>C
NM_005359.5:c.451A>G
NM_005359.5:c.457C>T
NM_005359.5:c.478G>A
NM_005359.5:c.546C>G
NM_005359.5:c.629G>A
NM_005359.5:c.652C>A
NM_005359.5:c.686T>G
NM_005359.5:c.691G>C
NM_005359.5:c.731C>T
NM_005359.5:c.775A>G
NM_005359.5:c.923T>C
NM_005359.5:c.997G>A
NM_005359.6(SMAD4):c.1067dup (p.Ser357Phefs)
SMAD4, 1-BP INS
SMAD4, 14-BP DEL, NT1612
SMAD4, 2-BP DEL
SMAD4, 2-BP DEL, 959AC
SMAD4, 2-BP DEL/1-BP INS, 1596CC/T
SMAD4, 4-BP DEL, NT1372
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.